Accession ID: MIRT004317 [miRNA, hsa-miR-25-3p :: CDKN1C, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-25LinkOut: [miRBase ]
Synonyms MIRN25, hsa-mir-25, miR-25, MIR25
Description Homo sapiens miR-25 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-25-3p
Mature Sequence 52| CAUUGCACUUGUCUCGGUCUGA |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-25-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1C LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BWCR, BWS, KIP2, WBS, p57
Description cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0011226 , NM_0011226   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1C LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1C
(miRNA target sites are highlighted)
>CDKN1C|NM_0000|3'UTR
   1 TGAGCCAATTTAGAGCCCAAAGAGCCCCGAGGGAACCTGCCGGGGCAGCGGACGTTGGAAGGGCGCTGGGCCTCGGCTGG
  81 GACCGTTCATGTAGCAGCAACCGGCGGCGGCTGCCGCAGAGCAGCGTTCGGTTTTGTTTTTAAATTTTGAAAACTGTGCA
 161 ATGTATTAATAACGTCTTTTTATATCTAAATGTATTCTGCACGAGAAGGTACACTGGTCCCAAGGTGTAAAGCTTTAAGA
 241 GTCATTTATATAAAATGTTTAATCTCTGCTGAAACTCAGTGCAAAAAAAAGAAAAAAGAAAAAAAAAAGGAAAAAATAAA
 321 AAAACCATGTATATTTGTACAAAAAGTTTTTAAAGTTATACTAACTTATATTTTCTATTTATGTCCAGGCGTGGACCGCT
 401 CTGCCACGCACTAGCTCGGTTATTGGTTATGCCAAAGGCACTCTCCATCTCCCACATCTGGTTATTGACAAGTGTAACTT
 481 TATTTTCATCGCGGACTCTGGGGAAGGGGGTCACTCACAAGCTGTAGCTGCCATACATGCCCATCTAGCTTGCAGTCTCT
 561 TCGCGCTTTCGCTGTCTCTCTTATTATGACTGTGTTTATCTGAAACTTGAAGACAAGTCTGTTAAAATGGTTCCTGAGCC
 641 GTCTGTACCACTGCCCCGGCCCCTCGTCCGCCGGGTTCTAAATAAAGAGGCCGAAAAATGCTGCAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUCUGGCUCUGUU--CACGUUAc 5'
            | |::  || ||  ||||||| 
Target 5' ttAAATTTTGAAAACTGTGCAATg 3'
140 - 163 150.00 -11.40
2
miRNA  3' agucUGGCUCUG-UUCACGUUac 5'
              :|:|| ||  |||||||  
Target 5' ctctGCTGAAACTCAGTGCAAaa 3'
264 - 286 138.00 -12.20
3
miRNA  3' agucuggcuCUGUUCACGUUac 5'
                   ||||||||:||  
Target 5' ctggttattGACAAGTGTAAct 3'
458 - 479 129.00 -13.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-25-3p :: CDKN1C    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... We show that miR-25 targets p57 through the 3 UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. ...

- Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al., 2009, Nucleic Acids Res.

Article - Kim, Y. K. Yu, J. Han, T. S. Park, S. Y. et al.
- Nucleic Acids Res, 2009
microRNAs (miRNAs) play integral roles in diverse processes including tumorigenesis. miRNA gene loci are often found in close conjunction, and such clustered miRNA genes are transcribed from a common promoter to generate polycistronic primary transcript. The primary transcript (pri-miRNA) is then processed by two RNase III proteins to release the mature miRNAs. Although it has been speculated that the miRNAs in the same cluster may play related biological functions, this has not been experimentally addressed. Here we report that the miRNAs in two clusters (miR-106b approximately 93 approximately 25 and miR-222 approximately 221) suppress the Cip/Kip family members of Cdk inhibitors (p57(Kip2), p21(Cip1) and p27(Kip1)). We show that miR-25 targets p57 through the 3'-UTR. Furthermore, miR-106b and miR-93 control p21 while miR-222 and miR-221 regulate both p27 and p57. Ectopic expression of these miRNAs results in activation of Cdk2 and facilitation of G1/S phase transition. Consistent with these results, both clusters are abnormally upregulated in gastric cancer tissues compared to the corresponding normal tissues. Ectopic expression of miR-222 cluster enhanced tumor growth in the mouse xenograft model. Our study demonstrates the functional associations between clustered miRNAs and further implicates that effective cancer treatment may require a combinatorial approach to target multiple oncogenic miRNA clusters.
LinkOut: [PMID: 19153141]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
182 hsa-miR-25-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000983 PRMT5 protein arginine methyltransferase 5 2 1
MIRT001107 CORO1A coronin, actin binding protein, 1A 1 1
MIRT003413 BCL2L11 BCL2-like 11 (apoptosis facilitator) 5 4
MIRT003605 KLF4 Kruppel-like factor 4 (gut) 2 1
MIRT004317 CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) 4 1
MIRT004329 KAT2B K(lysine) acetyltransferase 2B 3 1
MIRT005417 TP53 tumor protein p53 4 1
MIRT006119 WDR4 WD repeat domain 4 3 1
MIRT006230 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 3 1
MIRT006454 CCL26 chemokine (C-C motif) ligand 26 3 1
MIRT006632 MDM2 Mdm2 p53 binding protein homolog (mouse) 3 1
MIRT006746 PTEN phosphatase and tensin homolog 1 1
MIRT006919 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT007242 SMAD7 SMAD family member 7 1 1
MIRT030359 TAF6L TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT030360 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT050199 NDNL2 necdin-like 2 1 1
MIRT050200 NDUFAF3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 1 1
MIRT050201 TNPO2 transportin 2 1 1
MIRT050202 ANKRD18A ankyrin repeat domain 18A 1 1
MIRT050203 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT050204 RPSA ribosomal protein SA 1 1
MIRT050205 CDK4 cyclin-dependent kinase 4 1 1
MIRT050206 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT050207 TMEM173 transmembrane protein 173 1 1
MIRT050208 NAT1 N-acetyltransferase 1 (arylamine N-acetyltransferase) 1 1
MIRT050209 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT050210 CCNE2 cyclin E2 1 1
MIRT050211 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT050212 C2CD5 KIAA0528 1 1
MIRT050213 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT050214 CHRAC1 chromatin accessibility complex 1 1 1
MIRT050215 ACTL6A actin-like 6A 1 1
MIRT050216 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT050217 CNOT11 chromosome 2 open reading frame 29 1 1
MIRT050218 UBR1 ubiquitin protein ligase E3 component n-recognin 1 1 1
MIRT050219 SMAP1 small ArfGAP 1 1 1
MIRT050220 EP300 E1A binding protein p300 1 1
MIRT050221 ZNF557 zinc finger protein 557 1 1
MIRT050222 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT050223 RNASEH2A ribonuclease H2, subunit A 1 1
MIRT050224 ACSS1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT050225 DKK4 dickkopf homolog 4 (Xenopus laevis) 1 1
MIRT050226 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT050227 STAG1 stromal antigen 1 1 1
MIRT050228 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT050229 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT050230 CTSE cathepsin E 1 1
MIRT050231 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT050232 ZNF682 zinc finger protein 682 1 1
MIRT050233 HYAL1 hyaluronoglucosaminidase 1 1 1
MIRT050234 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT050235 DDX49 DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 1 1
MIRT050236 ARPC5L actin related protein 2/3 complex, subunit 5-like 1 1
MIRT050237 ARPC3 actin related protein 2/3 complex, subunit 3, 21kDa 1 1
MIRT050238 SMAP2 small ArfGAP2 1 1
MIRT050239 BPTF bromodomain PHD finger transcription factor 1 1
MIRT050240 TUSC3 tumor suppressor candidate 3 1 1
MIRT050241 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT050242 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT050243 ADAMTSL1 ADAMTS-like 1 1 1
MIRT050244 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT050245 CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 1 1
MIRT050246 EXOC6B exocyst complex component 6B 1 1
MIRT050247 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050248 RCOR1 REST corepressor 1 1 1
MIRT050249 PEX5 peroxisomal biogenesis factor 5 1 1
MIRT050250 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT050251 LOXHD1 lipoxygenase homology domains 1 1 1
MIRT050252 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT050253 RPS28 ribosomal protein S28 1 1
MIRT050254 STXBP1 syntaxin binding protein 1 1 1
MIRT050255 DNM1L dynamin 1-like 1 1
MIRT050256 DEAF1 deformed epidermal autoregulatory factor 1 (Drosophila) 1 1
MIRT050257 WDR11 WD repeat domain 11 1 1
MIRT050258 ACP1 acid phosphatase 1, soluble 1 1
MIRT050259 C10orf118 chromosome 10 open reading frame 118 1 1
MIRT050260 TVP23B family with sequence similarity 18, member B 1 1
MIRT050261 ZDHHC8 zinc finger, DHHC-type containing 8 1 1
MIRT050262 CABIN1 calcineurin binding protein 1 1 1
MIRT050263 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 1
MIRT050264 ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 1 1
MIRT050265 NHP2 NHP2 ribonucleoprotein homolog (yeast) 1 1
MIRT050266 TUBGCP4 tubulin, gamma complex associated protein 4 1 1
MIRT050267 MARCH6 membrane-associated ring finger (C3HC4) 6 1 1
MIRT050268 PDGFRL platelet-derived growth factor receptor-like 1 1
MIRT050269 TRAF3IP1 TNF receptor-associated factor 3 interacting protein 1 1 1
MIRT050270 TUBB tubulin, beta 1 1
MIRT050271 RPL7A ribosomal protein L7a 1 1
MIRT050272 PLEKHA5 pleckstrin homology domain containing, family A member 5 1 1
MIRT050273 RPS14 ribosomal protein S14 1 1
MIRT050274 DENND4A DENN/MADD domain containing 4A 1 1
MIRT050275 MLEC malectin 1 1
MIRT050276 DCTN1 dynactin 1 (p150, glued homolog, Drosophila) 1 1
MIRT050277 FECH ferrochelatase 1 1
MIRT050278 PDXP pyridoxal (pyridoxine, vitamin B6) phosphatase 1 1
MIRT050279 XPC xeroderma pigmentosum, complementation group C 1 1
MIRT050280 NOL12 nucleolar protein 12 1 1
MIRT050281 PELO pelota homolog (Drosophila) 1 1
MIRT050282 SYNPR synaptoporin 1 1
MIRT050283 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT050284 ETFA electron-transfer-flavoprotein, alpha polypeptide 1 1
MIRT050285 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) 1 1
MIRT050286 SSRP1 structure specific recognition protein 1 1 1
MIRT050287 NOTCH2 Notch homolog 2 (Drosophila) 1 1
MIRT050288 DENND5A DENN/MADD domain containing 5A 1 1
MIRT050289 CEP170B KIAA0284 1 1
MIRT050290 PDK2 pyruvate dehydrogenase kinase, isozyme 2 1 1
MIRT050291 EME2 essential meiotic endonuclease 1 homolog 2 (S. pombe) 1 1
MIRT050292 FNBP1 formin binding protein 1 1 1
MIRT050293 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT050294 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT050295 CCDC96 coiled-coil domain containing 96 1 1
MIRT050296 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT050297 YBX1 Y box binding protein 1 1 1
MIRT050298 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT050299 RPL26 ribosomal protein L26 1 1
MIRT050300 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT050301 HMBS hydroxymethylbilane synthase 1 1
MIRT050302 EIF4B eukaryotic translation initiation factor 4B 1 1
MIRT050303 ATN1 atrophin 1 1 1
MIRT050304 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT050305 ITM2B integral membrane protein 2B 1 1
MIRT050306 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT050307 CEP85 coiled-coil domain containing 21 1 1
MIRT050308 ELF4 E74-like factor 4 (ets domain transcription factor) 1 1
MIRT050309 RAPGEF1 Rap guanine nucleotide exchange factor (GEF) 1 1 1
MIRT050310 NRN1 neuritin 1 1 1
MIRT050311 TSHZ3 teashirt zinc finger homeobox 3 1 1
MIRT050312 SCAF4 splicing factor, arginine/serine-rich 15 1 1
MIRT050313 PHB2 prohibitin 2 1 1
MIRT050314 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT050315 SEMA4D sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1 1
MIRT050316 RYR2 ryanodine receptor 2 (cardiac) 1 1
MIRT050317 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT050318 EIF5A eukaryotic translation initiation factor 5A 1 1
MIRT050319 TLN1 talin 1 1 1
MIRT050320 CTNNBL1 catenin, beta like 1 1 1
MIRT050321 KIF23 kinesin family member 23 1 1
MIRT050322 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT050323 ARHGAP17 Rho GTPase activating protein 17 1 1
MIRT050324 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 1 1
MIRT050325 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT050326 ANXA11 annexin A11 1 1
MIRT050327 GPR157 G protein-coupled receptor 157 1 1
MIRT050328 CTC1 chromosome 17 open reading frame 68 1 1
MIRT050329 AIM1 absent in melanoma 1 1 1
MIRT050330 TUBB4B tubulin, beta 2C 1 1
MIRT050331 VMP1 transmembrane protein 49 1 1
MIRT050332 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT050333 EMD emerin 1 1
MIRT050334 DPH7 WD repeat domain 85 1 1
MIRT050335 PKDCC protein kinase domain containing, cytoplasmic homolog (mouse) 1 1
MIRT050336 ZNF346 zinc finger protein 346 1 1
MIRT050337 PRRC2A HLA-B associated transcript 2 1 1
MIRT050338 RNGTT RNA guanylyltransferase and 5'-phosphatase 1 1
MIRT050339 PCDH7 protocadherin 7 1 1
MIRT050340 TMUB1 transmembrane and ubiquitin-like domain containing 1 1 1
MIRT050341 NVL nuclear VCP-like 1 1
MIRT050342 SETD1B SET domain containing 1B 1 1
MIRT050343 HSPA8 heat shock 70kDa protein 8 1 1
MIRT050344 SERTAD3 SERTA domain containing 3 1 1
MIRT050345 TRAP1 TNF receptor-associated protein 1 1 1
MIRT050346 ASS1 argininosuccinate synthase 1 1 1
MIRT050347 MPP6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 1 1
MIRT050348 ROBO1 roundabout, axon guidance receptor, homolog 1 (Drosophila) 1 1
MIRT050349 NSMAF neutral sphingomyelinase (N-SMase) activation associated factor 1 1
MIRT050350 TSFM Ts translation elongation factor, mitochondrial 1 1
MIRT050351 PSMB4 proteasome (prosome, macropain) subunit, beta type, 4 1 1
MIRT050352 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 1 1
MIRT050353 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT050354 RPS3A ribosomal protein S3A 1 1
MIRT050355 SNPH syntaphilin 1 1
MIRT050356 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT050357 SBNO2 strawberry notch homolog 2 (Drosophila) 1 1
MIRT050358 PARL presenilin associated, rhomboid-like 1 1
MIRT050359 GPBP1 GC-rich promoter binding protein 1 1 1
MIRT050360 KATNB1 katanin p80 (WD repeat containing) subunit B 1 1 1
MIRT050361 EZR ezrin 1 1
MIRT050362 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 1
MIRT050363 RBM27 RNA binding motif protein 27 1 1
MIRT050364 CLIC1 chloride intracellular channel 1 1 1