Accession ID: MIRT004318 [miRNA, hsa-miR-21-5p :: ERBB2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-21LinkOut: [miRBase ]
Synonyms MIRN21, hsa-mir-21, miR-21, miRNA21, MIR21
Description Homo sapiens miR-21 stem-loop
Comment Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-21-5p
Mature Sequence 8| UAGCUUAUCAGACUGAUGUUGA |29
Evidence Experimental
Experiments Northern
Putative hsa-miR-21-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol ERBB2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD340, HER-2, HER-2/neu, HER2, MLN 19, NEU, NGL, TKR1
Description v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
Transcript NM_0010058    LinkOut: [ RefSeq ]
Other Transcripts NM_0044   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on ERBB2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of ERBB2
(miRNA target sites are highlighted)
>ERBB2|NM_0010058|3'UTR
   1 TGAACCAGAAGGCCAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTCTGCTGGCATCAAGA
  81 GGTGGGAGGGCCCTCCGACCACTTCCAGGGGAACCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGA
 161 GTTCCCAGATGGCTGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGGGGAGTCTTTGTGGATTCTGAGGCCCTG
 241 CCCAATGAGACTCTAGGGTCCAGTGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGAAAGCCTT
 321 AGGGAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTCTAAGAACAAAAGCGACCCATTCAGAGACTGTCCCTGA
 401 AACCTAGTACTGCCCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGGCTTTGTACAGAGTGCTTTTCTGTTTAG
 481 TTTTTACTTTTTTTGTTTTGTTTTTTTAAAGATGAAATAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGT
 561 GTGGGGGGTCCTTCTCCACACCCACTTTGTCCATTTGCAAATATATTTTGGAAAACAGCTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUUGUAG-UCAGAC-UAUUCGau 5'
            || : | |||| | | ||||  
Target 5' agAAGGCCAAGTCCGCAGAAGCcc 3'
7 - 30 104.00 -5.40
2
miRNA  3' aguuguagUCAGA--CUAUUCGAu 5'
                  || ||  |: ||||| 
Target 5' gtactgaaAGCCTTAGGGAAGCTg 3'
307 - 330 104.00 -8.60
3
miRNA  3' agUUGUAGU-----CAGAC-UA--UUCGAu 5'
            |||| ||     ||| | ||  |:||| 
Target 5' ggAACAGCAATGGTGTCAGTATCCAGGCTt 3'
427 - 456 104.00 -11.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-21-5p :: ERBB2    [ Functional MTI ]
Validation Method qRT-PCR , Western blot
Conditions MDA-MIB-435
Original Description (Extracted from the article) ... We identified a putative oncogenic miRNA, miR-21, whose expression is correlated with HER2/neu up-regulation and is functionally involved in HER2/neu-induced cell invasion. We show that miR-21 is up-regulated via the MAPK (ERK1/2) pathway upon stimulation of HER2/neu signaling in breast cancer cells ...

- Huang, T. H. Wu, F. Loeb, G. B. Hsu, R. et al., 2009, J Biol Chem.

Article - Huang, T. H. Wu, F. Loeb, G. B. Hsu, R. et al.
- J Biol Chem, 2009
The cell surface receptor tyrosine kinase HER2/neu enhances tumor metastasis. Recent studies suggest that deregulated microRNA (miRNA) expression promotes invasion and metastasis of cancer cells; we therefore explored the possibility that HER2/neu signaling induces the expression of specific miRNAs involved in this process. We identified a putative oncogenic miRNA, miR-21, whose expression is correlated with HER2/neu up-regulation and is functionally involved in HER2/neu-induced cell invasion. We show that miR-21 is up-regulated via the MAPK (ERK1/2) pathway upon stimulation of HER2/neu signaling in breast cancer cells, and overexpression of other ERK1/2 activators such as RASV12 or ID-1 is sufficient to induce miR-21 up-regulation in HER2/neu-negative breast cancer cells. Furthermore, the metastasis suppressor protein PDCD4 (programmed cell death 4) is down-regulated by miR-21 in breast cancer cells expressing HER2/neu. Our data reveal a mechanism for HER2/neu-induced cancer cell invasion via miRNA deregulation. In addition, our results identify miR-21 as a potential therapeutic target for the prevention of breast cancer invasion and metastasis.
LinkOut: [PMID: 19419954]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
525 hsa-miR-21-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000019 RASGRP1 RAS guanyl releasing protein 1 (calcium and DAG-regulated) 5 3
MIRT000157 CDC25A cell division cycle 25 homolog A (S. pombe) 4 3
MIRT000158 TP53 tumor protein p53 1 1
MIRT000159 BCL2 B-cell CLL/lymphoma 2 4 8
MIRT000163 WIBG within bgcn homolog (Drosophila) 1 2
MIRT000164 WFS1 Wolfram syndrome 1 (wolframin) 1 2
MIRT000166 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT000167 RTN4 reticulon 4 2 2
MIRT000168 RPS7 ribosomal protein S7 5 17
MIRT000169 PLOD3 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 2 2
MIRT000170 PDHA2 pyruvate dehydrogenase (lipoamide) alpha 2 1 2
MIRT000171 NCAPG non-SMC condensin I complex, subunit G 2 2
MIRT000172 DERL1 Der1-like domain family, member 1 3 3
MIRT000173 BASP1 brain abundant, membrane attached signal protein 1 2 3
MIRT000174 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) 1 1
MIRT000175 WNT1 wingless-type MMTV integration site family, member 1 1 1
MIRT000176 JAG1 jagged 1 (Alagille syndrome) 4 3
MIRT000177 REST RE1-silencing transcription factor 2 1
MIRT000672 SPRY2 sprouty homolog 2 (Drosophila) 3 4
MIRT000954 TIMP3 TIMP metallopeptidase inhibitor 3 5 4
MIRT000960 SOX5 SRY (sex determining region Y)-box 5 5 2
MIRT000961 MTAP methylthioadenosine phosphorylase 4 2
MIRT000969 RECK reversion-inducing-cysteine-rich protein with kazal motifs 5 7
MIRT001121 E2F2 E2F transcription factor 2 1 1
MIRT001188 FMOD fibromodulin 2 1
MIRT001189 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 5 5
MIRT001190 PTEN phosphatase and tensin homolog 5 33
MIRT001191 E2F1 E2F transcription factor 1 4 2
MIRT001208 TGFBI transforming growth factor, beta-induced, 68kDa 3 2
MIRT001220 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 4 3
MIRT001221 MARCKS myristoylated alanine-rich protein kinase C substrate 3 1
MIRT001980 TPM1 tropomyosin 1 (alpha) 5 9
MIRT002090 NFIB nuclear factor I/B 4 6
MIRT002406 CDK6 cyclin-dependent kinase 6 2 2
MIRT002407 RP2 retinitis pigmentosa 2 (X-linked recessive) 2 2
MIRT002408 SGK3 serum/glucocorticoid regulated kinase family, member 3 2 2
MIRT002409 SLC16A10 solute carrier family 16, member 10 (aromatic amino acid transporter) 2 2
MIRT002410 APAF1 apoptotic peptidase activating factor 1 5 3
MIRT002411 GLCCI1 glucocorticoid induced transcript 1 2 2
MIRT002412 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT002414 SESN1 sestrin 1 2 2
MIRT002416 BTG2 BTG family, member 2 6 4
MIRT002418 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT002419 HIPK3 homeodomain interacting protein kinase 3 1 1
MIRT002420 FAM3C family with sequence similarity 3, member C 2 2
MIRT002421 FAS Fas (TNF receptor superfamily, member 6) 2 2
MIRT002422 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT003054 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 6 35
MIRT003146 Pdcd4 programmed cell death 4 3 1
MIRT003147 Pten phosphatase and tensin homolog 3 1
MIRT003317 RHOB ras homolog gene family, member B 4 4
MIRT003567 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 4 7
MIRT003837 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 5 5
MIRT003988 RASA1 RAS p21 protein activator (GTPase activating protein) 1 3 1
MIRT004287 TGIF1 TGFB-induced factor homeobox 1 2 1
MIRT004306 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004307 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 2 1
MIRT004318 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 2 1
MIRT004812 SPATS2L spermatogenesis associated, serine-rich 2-like 1 1
MIRT004813 EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa 1 1
MIRT004814 PCBP1 poly(rC) binding protein 1 2 2
MIRT004838 Pten phosphatase and tensin homolog 3 1
MIRT004839 Reck reversion-inducing-cysteine-rich protein with kazal motifs 3 1
MIRT005323 JMY junction mediating and regulatory protein, p53 cofactor 3 1
MIRT005324 TOPORS topoisomerase I binding, arginine/serine-rich 4 3
MIRT005325 HNRNPK heterogeneous nuclear ribonucleoprotein K 3 4
MIRT005327 DAXX death-domain associated protein 4 1
MIRT005328 TP53BP2 tumor protein p53 binding protein, 2 3 1
MIRT005329 TP63 tumor protein p63 4 2
MIRT005330 TGFBR3 transforming growth factor, beta receptor III 4 3
MIRT005331 PPIF peptidylprolyl isomerase F 3 2
MIRT005429 MSH2 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) 5 3
MIRT005430 MSH6 mutS homolog 6 (E. coli) 4 1
MIRT005565 TIAM1 T-cell lymphoma invasion and metastasis 1 4 2
MIRT005717 ISCU iron-sulfur cluster scaffold homolog (E. coli) 3 1
MIRT005737 MEF2C myocyte enhancer factor 2C 1 1
MIRT005772 EIF4A2 eukaryotic translation initiation factor 4A2 4 1
MIRT005773 ANKRD46 ankyrin repeat domain 46 4 1
MIRT005807 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 4 2
MIRT005951 IL1B interleukin 1, beta 3 1
MIRT005952 ICAM1 intercellular adhesion molecule 1 3 1
MIRT005953 PLAT plasminogen activator, tissue 3 1
MIRT005954 PTX3 pentraxin 3, long 1 1
MIRT005955 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT005956 CCR1 chemokine (C-C motif) receptor 1 1 1
MIRT005974 CDK2AP1 cyclin-dependent kinase 2 associated protein 1 3 2
MIRT006199 CCL20 chemokine (C-C motif) ligand 20 1 1
MIRT006236 SP1 Sp1 transcription factor 2 1
MIRT006288 PIAS3 protein inhibitor of activated STAT, 3 1 1
MIRT006313 DOCK4 dedicator of cytokinesis 4 2 1
MIRT006314 DOCK5 dedicator of cytokinesis 5 2 1
MIRT006315 DOCK7 dedicator of cytokinesis 7 2 1
MIRT006323 DUSP10 dual specificity phosphatase 10 3 1
MIRT006422 PPARA peroxisome proliferator-activated receptor alpha 4 2
MIRT006515 ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 3 1
MIRT006516 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 3 1
MIRT006529 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 1 1
MIRT006797 NTF3 neurotrophin 3 2 1
MIRT006821 COL4A1 collagen, type IV, alpha 1 2 1
MIRT006989 FASLG Fas ligand (TNF superfamily, member 6) 4 3
MIRT006997 SOD3 superoxide dismutase 3, extracellular 1 1
MIRT007085 TCF21 transcription factor 21 1 1
MIRT007362 SMAD7 SMAD family member 7 2 1
MIRT030661 PHIP pleckstrin homology domain interacting protein 1 1
MIRT030662 PALLD palladin, cytoskeletal associated protein 1 1
MIRT030663 BOC Boc homolog (mouse) 1 1
MIRT030664 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT030665 C20orf194 chromosome 20 open reading frame 194 1 1
MIRT030666 COL5A2 collagen, type V, alpha 2 1 1
MIRT030667 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT030668 NIN ninein (GSK3B interacting protein) 1 1
MIRT030669 PPAP2A phosphatidic acid phosphatase type 2A 1 1
MIRT030670 TRIM38 tripartite motif-containing 38 1 1
MIRT030671 DDR2 discoidin domain receptor tyrosine kinase 2 1 1
MIRT030672 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT030673 KIAA1715 KIAA1715 1 1
MIRT030674 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT030675 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT030676 USP34 ubiquitin specific peptidase 34 1 1
MIRT030677 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 1 1
MIRT030678 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT030679 CLOCK clock homolog (mouse) 1 1
MIRT030680 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT030681 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT030682 DDHD2 DDHD domain containing 2 1 1
MIRT030683 C2orf43 chromosome 2 open reading frame 43 1 1
MIRT030684 SGCB sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) 1 1
MIRT030685 FANCI Fanconi anemia, complementation group I 1 1
MIRT030686 EDIL3 EGF-like repeats and discoidin I-like domains 3 1 1
MIRT030687 DTX3L deltex 3-like (Drosophila) 1 1
MIRT030688 IREB2 iron-responsive element binding protein 2 1 1
MIRT030689 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 1 1
MIRT030690 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT030691 CYBRD1 cytochrome b reductase 1 1 1
MIRT030692 SLAIN2 SLAIN motif family, member 2 1 1
MIRT030693 KIAA1551 chromosome 12 open reading frame 35 1 1
MIRT030694 SOX2 SRY (sex determining region Y)-box 2 1 1
MIRT030695 GTF2A1 general transcription factor IIA, 1, 19/37kDa 1 1
MIRT030696 RRAGC Ras-related GTP binding C 1 1
MIRT030697 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT030698 HPS5 Hermansky-Pudlak syndrome 5 1 1
MIRT030699 SESTD1 SEC14 and spectrin domains 1 1 1
MIRT030700 MEF2A myocyte enhancer factor 2A 1 1
MIRT030701 ZBTB47 zinc finger and BTB domain containing 47 1 1
MIRT030702 ELOVL4 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 1 1
MIRT030703 EPHA4 EPH receptor A4 1 1
MIRT030704 ENAH enabled homolog (Drosophila) 1 1
MIRT030705 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT030706 NBEA neurobeachin 1 1
MIRT030707 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT030708 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT030709 CD47 CD47 molecule 1 1
MIRT030710 LATS1 LATS, large tumor suppressor, homolog 1 (Drosophila) 1 1
MIRT030711 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT030712 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT030713 KBTBD7 kelch repeat and BTB (POZ) domain containing 7 1 1
MIRT030714 MEIS1 Meis homeobox 1 1 1
MIRT030715 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT030716 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 1 1
MIRT030717 VEGFA vascular endothelial growth factor A 2 2
MIRT030718 REV3L REV3-like, catalytic subunit of DNA polymerase zeta (yeast) 1 1
MIRT030719 TXLNG2P chromosome Y open reading frame 15A 1 1
MIRT030720 KLHL3 kelch-like 3 (Drosophila) 1 1
MIRT030721 SCAF11 splicing factor, arginine/serine-rich 2, interacting protein 1 1
MIRT030722 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT030723 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT030724 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT030725 CERS6 LAG1 homolog, ceramide synthase 6 1 1
MIRT030726 SNX13 sorting nexin 13 1 1
MIRT030727 SNRNP48 small nuclear ribonucleoprotein 48kDa (U11/U12) 1 1
MIRT030728 FUBP1 far upstream element (FUSE) binding protein 1 1 1
MIRT030729 RTF1 Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT030730 TGFB1 transforming growth factor, beta 1 1 1
MIRT030731 ANKRD28 ankyrin repeat domain 28 1 1
MIRT030732 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT030733 OSBPL1A oxysterol binding protein-like 1A 1 1
MIRT030734 RSPRY1 ring finger and SPRY domain containing 1 1 1
MIRT030735 SRSF11 splicing factor, arginine/serine-rich 11 1 1
MIRT030736 ASRGL1 asparaginase like 1 1 1
MIRT030737 CUL3 cullin 3 1 1
MIRT030738 RB1 retinoblastoma 1 1 1
MIRT030739 TSN translin 1 1
MIRT030740 EXOC8 exocyst complex component 8 1 1
MIRT030741 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT030742 UTRN utrophin 1 1
MIRT030743 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT030744 ACAT1 acetyl-CoA acetyltransferase 1 1 1
MIRT030745 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT030746 PDGFD platelet derived growth factor D 1 1
MIRT030747 COBLL1 COBL-like 1 1 1
MIRT030748 SAMD5 sterile alpha motif domain containing 5 1 1
MIRT030749 MOAP1 modulator of apoptosis 1 1 1
MIRT030750 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT030751 ZNF326 zinc finger protein 326 1 1
MIRT030752 WHSC1 Wolf-Hirschhorn syndrome candidate 1 1 1
MIRT030753 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT030754 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT030755 TNS3 tensin 3 1 1
MIRT030756 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT030757 MYEF2 myelin expression factor 2 1 1
MIRT030758 PPP1R3B protein phosphatase 1, regulatory (inhibitor) subunit 3B 1 1
MIRT030759 PKD2 polycystic kidney disease 2 (autosomal dominant) 1 1
MIRT030760 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT030761 PAN3 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1
MIRT030762 ZRANB1 zinc finger, RAN-binding domain containing 1 1 1
MIRT030763 MON2 MON2 homolog (S. cerevisiae) 1 1
MIRT030764 RASEF RAS and EF-hand domain containing 1 1
MIRT030765 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT030766 HERPUD2 HERPUD family member 2 1 1
MIRT030767 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT030768 THOC2 THO complex 2 1 1
MIRT030769 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT030770 PHF17 PHD finger protein 17 1 1
MIRT030771 USP7 ubiquitin specific peptidase 7 (herpes virus-associated) 1 1
MIRT030772 GTF2I general transcription factor IIi 1 1
MIRT030773 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT030774 CLCN5 chloride channel 5 1 1
MIRT030775 TRIM2 tripartite motif-containing 2 1 1
MIRT030776 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT030777 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT030778 PHF16 PHD finger protein 16 1 1
MIRT030779 ELOVL7 ELOVL family member 7, elongation of long chain fatty acids (yeast) 1 1
MIRT030780 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT030781 SASH1 SAM and SH3 domain containing 1 1 1
MIRT030782 RAB22A RAB22A, member RAS oncogene family 1 1
MIRT030783 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT030784 SPIN1 spindlin 1 1 1
MIRT030785 POLR3B polymerase (RNA) III (DNA directed) polypeptide B 1 1
MIRT030786 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 1 1
MIRT030787 CCDC34 coiled-coil domain containing 34 1 1
MIRT030788 PGRMC2 progesterone receptor membrane component 2 1 1
MIRT030789 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT030790 GID4 chromosome 17 open reading frame 39 1 1
MIRT030791 FAM63B family with sequence similarity 63, member B 1 1
MIRT030792 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT030793 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT030794 ZNF367 zinc finger protein 367 1 1
MIRT030795 TMEM245 chromosome 9 open reading frame 5 1 1
MIRT030796 MBNL1 muscleblind-like (Drosophila) 1 1
MIRT030797 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT030798 ZNF35 zinc finger protein 35 1 1
MIRT030799 PSRC1 proline/serine-rich coiled-coil 1 1 1
MIRT030800 FOXN3 forkhead box N3 1 1
MIRT030801 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT030802 FBXO3 F-box protein 3 1 1
MIRT030803 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT030804 PM20D2 peptidase M20 domain containing 2 1 1
MIRT030805 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 1
MIRT030806 DMTF1 cyclin D binding myb-like transcription factor 1 1 1
MIRT030807 DDX46 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 1 1
MIRT030808 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 1 1
MIRT030809 LMBR1 limb region 1 homolog (mouse) 1 1
MIRT030810 MUC1 mucin 1, cell surface associated 1 1
MIRT030811 IL6R interleukin 6 receptor 1 1
MIRT030812 TUBGCP5 tubulin, gamma complex associated protein 5 1 1
MIRT030813 RHOQ ras homolog gene family, member Q 1 1
MIRT030814 TET1 tet oncogene 1 1 1
MIRT030815 CASC5 cancer susceptibility candidate 5 1 1
MIRT030816 ARHGAP21 Rho GTPase activating protein 21 1 1
MIRT030817 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 1
MIRT030818 LARS leucyl-tRNA synthetase 1 1
MIRT030819 FAXDC2 chromosome 5 open reading frame 4 1 1
MIRT030820 CDK19 cyclin-dependent kinase 19 1 1
MIRT030821 LAMP2 lysosomal-associated membrane protein 2 1 1
MIRT030822 MOXD1 monooxygenase, DBH-like 1 1 1
MIRT030823 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1 1
MIRT030824 PIK3C2A phosphoinositide-3-kinase, class 2, alpha polypeptide 1 1
MIRT030825 TMEM2 transmembrane protein 2 1 1
MIRT030826 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT030827 RAI14 retinoic acid induced 14 1 1
MIRT030828 MYO9A myosin IXA 1 1
MIRT030829 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT030830 FBXL17 F-box and leucine-rich repeat protein 17 1 1
MIRT030831 AGGF1 angiogenic factor with G patch and FHA domains 1 1 1
MIRT030832 SLC26A2 solute carrier family 26 (sulfate transporter), member 2 1 1
MIRT030833 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT030834 SREK1 splicing factor, arginine/serine-rich 12 1 1
MIRT030835 FAM20B family with sequence similarity 20, member B 1 1
MIRT030836 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT030837 SERPINI1 serpin peptidase inhibitor, clade I (neuroserpin), member 1 1 1
MIRT030838 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT030839 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT030840 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT030841 JPH1 junctophilin 1 1 1
MIRT030842 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT030843 FKBP5 FK506 binding protein 5 1 1
MIRT030844 TGFB2 transforming growth factor, beta 2 1 1
MIRT030845 ZMYM2 zinc finger, MYM-type 2 1 1
MIRT030846 TRIM33 tripartite motif-containing 33 1 1
MIRT030847 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1 1
MIRT030848 MTPN myotrophin 1 1
MIRT030849 GOLGA4 golgin A4 1 1
MIRT030850 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT030851 ATAD2B ATPase family, AAA domain containing 2B 1 1
MIRT030852 FIGN fidgetin 1 1
MIRT030853 EPM2A epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) 1 1
MIRT030854 RAB6C RAB6C, member RAS oncogene family 1 1
MIRT030855 TSNAX translin-associated factor X 1 1
MIRT030856 TRAPPC2 trafficking protein particle complex 2 1 1
MIRT030857 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT030858 CALD1 caldesmon 1 1 1
MIRT030859 LYRM7 Lyrm7 homolog (mouse) 1 1
MIRT030860 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT030861 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT030862 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT030863 LRRC57 leucine rich repeat containing 57 1 1
MIRT030864 DUSP8 dual specificity phosphatase 8 1 1
MIRT030865 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT030866 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT030867 PBRM1 polybromo 1 1 1
MIRT030868 SMNDC1 survival motor neuron domain containing 1 1 1
MIRT030869 NCSTN nicastrin 1 1
MIRT030870 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT030871 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 1 1
MIRT030872 PARP9 poly (ADP-ribose) polymerase family, member 9 1 1
MIRT030873 CKAP5 cytoskeleton associated protein 5 1 1
MIRT030874 CAPRIN1 cell cycle associated protein 1 1 1
MIRT030875 CNTRL centrosomal protein 110kDa 1 1
MIRT030876 PHTF1 putative homeodomain transcription factor 1 1 1
MIRT030877 MRAP2 melanocortin 2 receptor accessory protein 2 1 1
MIRT030878 MYCBP2 MYC binding protein 2 1 1
MIRT030879 ITSN2 intersectin 2 1 1
MIRT030880 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 1
MIRT030881 PPFIA4 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 1 1
MIRT030882 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT030883 ZNF667 zinc finger protein 667 1 1
MIRT030884 ETNK1 ethanolamine kinase 1 1 1
MIRT030885 CYP4V2 cytochrome P450, family 4, subfamily V, polypeptide 2 1 1
MIRT030886 BRCA1 breast cancer 1, early onset 1 1
MIRT030887 DOCK10 dedicator of cytokinesis 10 1 1
MIRT030888 DMD dystrophin 1 1
MIRT030889 TMX4 thioredoxin-related transmembrane protein 4 1 1
MIRT030890 PTBP3 ROD1 regulator of differentiation 1 (S. pombe) 1 1
MIRT030891 APOLD1 apolipoprotein L domain containing 1 1 1
MIRT030892 CCT6P1 chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1 1 1
MIRT030893 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT030894 NEK1 NIMA (never in mitosis gene a)-related kinase 1 1 1
MIRT030895 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT030896 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT030897 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 1
MIRT030898 TRIM59 tripartite motif-containing 59 1 1
MIRT030899 SPTLC3 serine palmitoyltransferase, long chain base subunit 3 1 1
MIRT030900 TMEM56 transmembrane protein 56 1 1
MIRT030901 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT030902 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT030903 ZNF217 zinc finger protein 217 1 1
MIRT030904 FAM217B chromosome 20 open reading frame 177 1 1
MIRT030905 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT030906 FNBP1 formin binding protein 1 1 1
MIRT030907 ZFYVE16 zinc finger, FYVE domain containing 16 1 1
MIRT030908 VPS13A vacuolar protein sorting 13 homolog A (S. cerevisiae) 1 1
MIRT030909 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 1 1
MIRT030910 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT030911 GPD1L glycerol-3-phosphate dehydrogenase 1-like 1 1
MIRT030912 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT030913 PRKCE protein kinase C, epsilon 1 1
MIRT030914 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT030915 SEC63 SEC63 homolog (S. cerevisiae) 1 1
MIRT030916 TAF1 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa 1 1
MIRT030917 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1 1
MIRT030918 PTK2 PTK2 protein tyrosine kinase 2 1 1
MIRT030919 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 1 1
MIRT030920 SSFA2 sperm specific antigen 2 1 1
MIRT030921 HECTD1 HECT domain containing 1 1 1
MIRT030922 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 1
MIRT030923 SFXN1 sideroflexin 1 1 1
MIRT030924 HAPLN1 hyaluronan and proteoglycan link protein 1 1 1
MIRT030925 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT030926 KLHL42 kelch domain containing 5 1 1
MIRT030927 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT030928 SLC9A6 solute carrier family 9 (sodium/hydrogen exchanger), member 6 1 1
MIRT030929 ZNF207 zinc finger protein 207 1 1
MIRT030930 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT030931 FAM46A family with sequence similarity 46, member A 1 1
MIRT030932 MTMR12 myotubularin related protein 12 1 1
MIRT030933 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT030934 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT030935 ABCD3 ATP-binding cassette, sub-family D (ALD), member 3 1 1
MIRT030936 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT030937 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT030938 PURB purine-rich element binding protein B 1 1
MIRT030939 LCORL ligand dependent nuclear receptor corepressor-like 1 1
MIRT030940 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT030941 ST6GAL1 ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 1 1
MIRT030942 GPR64 G protein-coupled receptor 64 1 1
MIRT030943 SKP2 S-phase kinase-associated protein 2 (p45) 1 1
MIRT030944 ECI2 peroxisomal D3,D2-enoyl-CoA isomerase 1 1
MIRT030945 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT030946 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT030947 HS3ST3B1 heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 1 1
MIRT030948 ELAVL4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) 1 1
MIRT030949 CORO2A coronin, actin binding protein, 2A 1 1
MIRT030950 TTC33 tetratricopeptide repeat domain 33 1 2
MIRT030951 AUTS2 autism susceptibility candidate 2 2 2
MIRT030952 AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 1 1
MIRT030953 NKTR natural killer-tumor recognition sequence 1 2
MIRT030954 PTPN14 protein tyrosine phosphatase, non-receptor type 14 1 1
MIRT030955 STXBP5 syntaxin binding protein 5 (tomosyn) 1 1
MIRT030956 MGA MAX gene associated 1 3
MIRT030957 SMC5 structural maintenance of chromosomes 5 1 1
MIRT030958 KIFAP3 kinesin-associated protein 3 1 1
MIRT030959 SPG11 spastic paraplegia 11 (autosomal recessive) 1 1
MIRT030960 PER3 period homolog 3 (Drosophila) 1 1
MIRT030961 ZNF292 zinc finger protein 292 1 1
MIRT030962 ZNF587 zinc finger protein 587 1 1
MIRT030963 AIM1 absent in melanoma 1 1 1
MIRT030964 DSE dermatan sulfate epimerase 1 1
MIRT030965 SRPK2 SFRS protein kinase 2 1 1
MIRT030966 TSHZ3 teashirt zinc finger homeobox 3 1 1
MIRT030967 CEP97 centrosomal protein 97kDa 1 1
MIRT030968 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT030969 PHF20 PHD finger protein 20 1 1
MIRT030970 SEMA5A sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A 1 1
MIRT030971 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT030972 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT030973 VPS36 vacuolar protein sorting 36 homolog (S. cerevisiae) 1 1
MIRT030974 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT030975 NUBPL nucleotide binding protein-like 1 1
MIRT030976 LIMCH1 LIM and calponin homology domains 1 1 1
MIRT030977 MTMR9 myotubularin related protein 9 1 1
MIRT030978 SERAC1 serine active site containing 1 1 1
MIRT030979 RUFY3 RUN and FYVE domain containing 3 1 1
MIRT030980 APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 1 1
MIRT030981 PBX1 pre-B-cell leukemia homeobox 1 1 1
MIRT030982 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT030983 WNT5A wingless-type MMTV integration site family, member 5A 1 1
MIRT030984 REV1 REV1 homolog (S. cerevisiae) 1 1
MIRT030985 FBXL2 F-box and leucine-rich repeat protein 2 1 1
MIRT030986 HOXA9 homeobox A9 1 1
MIRT030987 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT030988 FMR1 fragile X mental retardation 1 1 1
MIRT030989 SNX30 sorting nexin family member 30 1 1
MIRT030990 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 1 1
MIRT030991 PREPL prolyl endopeptidase-like 1 1
MIRT030992 CCDC14 coiled-coil domain containing 14 1 1
MIRT030993 ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 1 1
MIRT030994 USP47 ubiquitin specific peptidase 47 1 1
MIRT030995 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT030996 ARID4A AT rich interactive domain 4A (RBP1-like) 1 1
MIRT030997 ATP11B ATPase, class VI, type 11B 1 1
MIRT030998 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT030999 DLG1 discs, large homolog 1 (Drosophila) 1 1
MIRT031000 SOWAHC ankyrin repeat domain 57 1 1
MIRT031001 RSF1 remodeling and spacing factor 1 1 1
MIRT031002 SNRK SNF related kinase 1 1
MIRT031003 PLD1 phospholipase D1, phosphatidylcholine-specific 1 1
MIRT031004 TLR4 toll-like receptor 4 1 1
MIRT031005 VPS26A vacuolar protein sorting 26 homolog A (S. pombe) 1 1
MIRT031006 ZYG11B zyg-11 homolog B (C. elegans) 1 1
MIRT031007 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT031008 TESK2 testis-specific kinase 2 1 1
MIRT031009 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT031010 RAB6A RAB6A, member RAS oncogene family 1 1
MIRT031011 PURA purine-rich element binding protein A 1 1
MIRT031012 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT031013 KLF9 Kruppel-like factor 9 1 1
MIRT031014 ATMIN ATM interactor 1 1
MIRT031015 PRPF39 PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae) 1 1
MIRT031016 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT031017 STAG2 stromal antigen 2 1 1
MIRT031018 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT031019 AKT2 v-akt murine thymoma viral oncogene homolog 2 2 1
MIRT031020 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT031021 PRRC1 proline-rich coiled-coil 1 1 1
MIRT031022 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT031023 ZNF532 zinc finger protein 532 1 1
MIRT031024 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT031025 TCF4 transcription factor 4 1 1
MIRT031026 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 1
MIRT031027 THBS1 thrombospondin 1 1 1
MIRT031028 PTPN3 protein tyrosine phosphatase, non-receptor type 3 1 1
MIRT031029 ATF2 activating transcription factor 2 1 1
MIRT031030 RBM27 RNA binding motif protein 27 1 1
MIRT031031 EXOC5 exocyst complex component 5 1 1
MIRT031032 AFTPH aftiphilin 1 1
MIRT031033 BID BH3 interacting domain death agonist 1 1
MIRT031034 KLHL8 kelch-like 8 (Drosophila) 1 1
MIRT031035 WDR7 WD repeat domain 7 1 1
MIRT031036 FAM126B family with sequence similarity 126, member B 1 1
MIRT031037 PTGFR prostaglandin F receptor (FP) 1 1
MIRT031038 PHF20L1 PHD finger protein 20-like 1 1 1
MIRT031039 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT031040 GLG1 golgi glycoprotein 1 1 1
MIRT031041 CEP152 centrosomal protein 152kDa 1 1
MIRT031042 HMGB3 high-mobility group box 3 1 1
MIRT031043 BDH2 3-hydroxybutyrate dehydrogenase, type 2 1 1
MIRT031044 LPIN1 lipin 1 1 1
MIRT031045 NETO2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT031046 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT031047 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT031048 TSC1 tuberous sclerosis 1 1 1
MIRT031049 ALMS1 Alstrom syndrome 1 1 1
MIRT031050 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT031051 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT031052 PIGX phosphatidylinositol glycan anchor biosynthesis, class X 1 1
MIRT031053 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT031054 APC adenomatous polyposis coli 1 1
MIRT031055 SLMAP sarcolemma associated protein 1 1
MIRT031056 SOCS4 suppressor of cytokine signaling 4 1 1
MIRT031057 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT031058 OSR1 odd-skipped related 1 (Drosophila) 1 1
MIRT031059 FBXO11 F-box protein 11 1 1
MIRT031060 SCRN1 secernin 1 1 1
MIRT031061 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT031062 CCNG1 cyclin G1 1 1
MIRT031063 MEGF9 multiple EGF-like-domains 9 1 1
MIRT031064 TNPO1 transportin 1 1 1
MIRT031065 FERMT2 fermitin family homolog 2 (Drosophila) 1 1
MIRT031066 KAT6A MYST histone acetyltransferase (monocytic leukemia) 3 1 1
MIRT031067 TNFRSF11B tumor necrosis factor receptor superfamily, member 11b 1 1
MIRT031068 WWC2 WW and C2 domain containing 2 1 2
MIRT031069 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT031070 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT031071 VASH2 vasohibin 2 1 2
MIRT031072 SLK STE20-like kinase (yeast) 1 2
MIRT031073 FILIP1L filamin A interacting protein 1-like 1 2
MIRT031074 DCP1A DCP1 decapping enzyme homolog A (S. cerevisiae) 1 4
MIRT031075 RNF11 ring finger protein 11 1 2
MIRT031076 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 4
MIRT031077 PELI1 pellino homolog 1 (Drosophila) 2 2
MIRT031078 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 2 2
MIRT031079 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 3 2
MIRT035524 BCL6 B-cell CLL/lymphoma 6 1 1
MIRT050474 OTUD1 OTU domain containing 1 1 1
MIRT050475 TMEM147 transmembrane protein 147 1 1