Accession ID: MIRT004363 [miRNA, hsa-miR-125b-5p :: AKT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-125b-1LinkOut: [miRBase ]
Synonyms MIRN125B1, MIR125B1
Description Homo sapiens miR-125b-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-125b-5p
Mature Sequence 15| UCCCUGAGACCCUAACUUGUGA |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-125b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol AKT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AKT, MGC99656, PKB, PKB-ALPHA, PRKBA, RAC, RAC-ALPHA
Description v-akt murine thymoma viral oncogene homolog 1
Transcript NM_0051    LinkOut: [ RefSeq ]
Other Transcripts NM_0010144 , NM_0010144   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on AKT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of AKT1
(miRNA target sites are highlighted)
>AKT1|NM_0051|3'UTR
   1 TCGGCCAGCGGCACGGCCTGAGGCGGCGGTGGACTGCGCTGGACGATAGCTTGGAGGGATGGAGAGGCGGCCTCGTGCCA
  81 TGATCTGTATTTAATGGTTTTTATTTCTCGGGTGCATTTGAGAGAAGCCACGCTGTCCTCTCGAGCCCAGATGGAAAGAC
 161 GTTTTTGTGCTGTGGGCAGCACCCTCCCCCGCAGCGGGGTAGGGAAGAAAACTATCCTGCGGGTTTTAATTTATTTCATC
 241 CAGTTTGTTCTCCGGGTGTGGCCTCAGCCCTCAGAACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTAT
 321 GCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCT
 401 GTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTA
 481 TGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCAT
 561 CGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTA
 641 AATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCCTCCCCCTTCC
 721 CCTTCTGTGTCACAGTTCTTGGTGACTGTCCCACCGGGAGCCTCCCCCTCAGATGATCTCTCCACGGTAGCACTTGACCT
 801 TTTCGACGCTTAACCTTTCCGCTGTCGCCCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCAC
 881 GCCTCCTGGCCAGACGCTGCCGCTGCCGCTGCACCACGGCGTTTTTTTACAACATTCAACTTTAGTATTTTTACTATTAT
 961 AATATAATATGGAACCTTCCCTCCAAATTCTTCAATAAAAGTTGCTTTTCAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' aguGUUCAAUCCCAGAGUCCCu 5'
             | ||||  | |||| ||| 
Target 5' catCCAGTT-TGTTCTCCGGGt 3'
237 - 257 126.00 -10.60
2
miRNA  3' aguguucaaucccAGAGUCCCu 5'
                       |||| ||| 
Target 5' gctatctgtcatcTCTCTGGGg 3'
408 - 429 113.00 -10.30
3
miRNA  3' aguguucAAUCCCAGAGUCCcu 5'
                 |||   ||||:||  
Target 5' atggtttTTA-TTTCTCGGGtg 3'
94 - 114 110.00 -10.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-125b-5p :: AKT1    [ Functional MTI ]
Validation Method qRT-PCR , Western blot , Other
Conditions HepG2 , SK-Hep-1
Original Description (Extracted from the article) ... The results showed that mir-125b could obviously suppress the phosporylation of Akt. Summarizing these results, this study implicated that miR-125b might suppress cancer cell proliferation through inactivating Akt. ...

- Li, W. Xie, L. He, X. Li, J. Tu, K. Wei, L. et al., 2008, Int J Cancer.

Article - Li, W. Xie, L. He, X. Li, J. Tu, K. Wei, L. et al.
- Int J Cancer, 2008
MicroRNAs (miRNAs) are important gene regulators, which are often deregulated in cancers. In this study, the authors analyzed the microRNAs profiles of 78 matched cancer/noncanerous liver tissues from HCC patients and 10 normal liver tissues and found that 69 miRNAs were differentially expressed between hepatocellular carcinoma (HCC) and corresponding noncancerous liver tissues (N). Then the expressions of 8 differentially expressed miRNAs were validated by real time RT PCR. The set of differentially expressed miRNAs could distinctly classify HCC, N and normal liver tissues (NL). Moreover, some of these differentially expressed miRNAs were related to the clinical factors of HCC patients. Most importantly, Kaplan-Meier estimates and the log-rank test showed that high expression of hsa-miR-125b was correlated with good survival of HCC patients (hazard ratio, 1.787, 95% confidence interval, 1.020-3.133, p = 0.043). The transfection assay showed that overexpression of miR-125b in HCC cell line could obviously suppress the cell growth and phosporylation of Akt. In conclusion, the authors have demonstrated the diagnostic miRNA profile for HCC, and for the first time, identified the miR-125b with predictive significance for HCC prognosis.
LinkOut: [PMID: 18649363]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
342 hsa-miR-125b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000346 BMPR1B bone morphogenetic protein receptor, type IB 2 1
MIRT000347 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 3 1
MIRT000348 HMGA2 high mobility group AT-hook 2 2 1
MIRT000349 HMGA1 high mobility group AT-hook 1 2 1
MIRT000350 GLI1 GLI family zinc finger 1 2 1
MIRT000351 CDK6 cyclin-dependent kinase 6 1 2
MIRT000462 NKIRAS2 NFKB inhibitor interacting Ras-like 2 4 1
MIRT000525 SMO smoothened homolog (Drosophila) 3 2
MIRT000535 TP53 tumor protein p53 4 6
MIRT001037 LIF leukemia inhibitory factor (cholinergic differentiation factor) 1 1
MIRT001197 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 3 1
MIRT002358 FAM19A1 family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 1 1
MIRT002359 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 1 1
MIRT002360 ID3 inhibitor of DNA binding 3, dominant negative helix-loop-helix protein 1 1
MIRT002362 TENM2 odz, odd Oz/ten-m homolog 2 (Drosophila) 1 1
MIRT002363 MAN1A1 mannosidase, alpha, class 1A, member 1 1 1
MIRT002364 TSPAN8 tetraspanin 8 1 2
MIRT002365 UGT2B17 UDP glucuronosyltransferase 2 family, polypeptide B17 1 1
MIRT002366 PIGR polymeric immunoglobulin receptor 1 1
MIRT002369 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 1 1
MIRT002370 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT002371 PCDHB10 protocadherin beta 10 1 1
MIRT002372 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 1 1
MIRT002373 DIO3 deiodinase, iodothyronine, type III 1 2
MIRT002374 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT002375 CASP6 caspase 6, apoptosis-related cysteine peptidase 1 1
MIRT002376 UGT2B28 UDP glucuronosyltransferase 2 family, polypeptide B28 1 1
MIRT002377 IL1RN interleukin 1 receptor antagonist 1 1
MIRT002379 RBM8A RNA binding motif protein 8A 1 1
MIRT002380 UBE2I ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 1 1
MIRT002381 UGT2B15 UDP glucuronosyltransferase 2 family, polypeptide B15 1 1
MIRT002382 ANAPC16 anaphase promoting complex subunit 16 1 1
MIRT002383 CBX7 chromobox homolog 7 1 1
MIRT002385 HIST1H4A histone cluster 1, H4a 1 1
MIRT002386 CBLN2 cerebellin 2 precursor 1 1
MIRT002387 CEBPG CCAAT/enhancer binding protein (C/EBP), gamma 2 2
MIRT002388 CASP7 caspase 7, apoptosis-related cysteine peptidase 1 1
MIRT002389 GPR160 G protein-coupled receptor 160 1 1
MIRT002390 HOMER2 homer homolog 2 (Drosophila) 1 1
MIRT002391 B3GALT4 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 1 1
MIRT002392 PERP PERP, TP53 apoptosis effector 1 1
MIRT002393 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1 1
MIRT002394 BAK1 BCL2-antagonist/killer 1 4 5
MIRT002938 ERBB3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 4 4
MIRT002939 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 5 4
MIRT003394 BMF Bcl2 modifying factor 3 2
MIRT003421 KLF13 Kruppel-like factor 13 5 2
MIRT003754 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 3 1
MIRT003845 LIN28A lin-28 homolog A (C. elegans) 3 5
MIRT003970 CBFB core-binding factor, beta subunit 5 3
MIRT003997 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 1
MIRT004363 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT004408 CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 4 2
MIRT004418 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 2 1
MIRT004533 PRDM1 PR domain containing 1, with ZNF domain 3 1
MIRT004534 IRF4 interferon regulatory factor 4 3 1
MIRT004578 GRIN2A glutamate receptor, ionotropic, N-methyl D-aspartate 2A 3 1
MIRT004709 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 2 1
MIRT004936 KRT7 keratin 7 2 1
MIRT004985 SAMD10 sterile alpha motif domain containing 10 2 1
MIRT004986 QSOX2 quiescin Q6 sulfhydryl oxidase 2 2 1
MIRT004987 SLC7A6 solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 2 1
MIRT004988 RNF144A ring finger protein 144A 2 1
MIRT004989 ABCC4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 2 1
MIRT004990 LYPLA2 lysophospholipase II 2 1
MIRT004991 CASC3 cancer susceptibility candidate 3 3 2
MIRT004992 ULK3 unc-51-like kinase 3 (C. elegans) 2 1
MIRT004993 PABPC1 poly(A) binding protein, cytoplasmic 1 2 1
MIRT004994 CGN cingulin 2 1
MIRT004995 PLEKHA8 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 2 1
MIRT004996 TP53INP1 tumor protein p53 inducible nuclear protein 1 5 2
MIRT004997 SLC35A4 solute carrier family 35, member A4 2 1
MIRT004998 LACTB lactamase, beta 1 1
MIRT004999 SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 2 1
MIRT005000 SLC7A1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 2 1
MIRT005006 STAT3 signal transducer and activator of transcription 3 (acute-phase response factor) 2 1
MIRT005007 ATXN1 ataxin 1 2 1
MIRT005008 SEL1L sel-1 suppressor of lin-12-like (C. elegans) 2 1
MIRT005009 KCNS3 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 2 1
MIRT005010 PPAT phosphoribosyl pyrophosphate amidotransferase 2 1
MIRT005011 RPL29 ribosomal protein L29 2 1
MIRT005503 E2F3 E2F transcription factor 3 4 2
MIRT005738 IGF2 insulin-like growth factor 2 (somatomedin A) 2 1
MIRT005804 LIN28B lin-28 homolog B (C. elegans) 3 1
MIRT005914 Bak1 BCL2-antagonist/killer 1 3 1
MIRT005915 BBC3 BCL2 binding component 3 3 1
MIRT006081 Tef thyrotroph embryonic factor 2 1
MIRT006127 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme 3 1
MIRT006128 PRKRA protein kinase, interferon-inducible double stranded RNA dependent activator 3 1
MIRT006253 BCL2 B-cell CLL/lymphoma 2 2 1
MIRT006387 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 1 1
MIRT006430 RPS6KA1 ribosomal protein S6 kinase, 90kDa, polypeptide 1 3 1
MIRT006472 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 2 1
MIRT006495 PIGF phosphatidylinositol glycan anchor biosynthesis, class F 3 1
MIRT006500 BCL3 B-cell CLL/lymphoma 3 1 1
MIRT006523 TBC1D1 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 1 1
MIRT006524 DGAT1 diacylglycerol O-acyltransferase homolog 1 (mouse) 1 1
MIRT006678 FGFR2 fibroblast growth factor receptor 2 3 1
MIRT006719 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT006740 TRIM71 tripartite motif-containing 71 0 1
MIRT006810 SMAD4 SMAD family member 4 2 1
MIRT006843 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 3 1
MIRT006844 IL6R interleukin 6 receptor 3 1
MIRT006849 STARD13 StAR-related lipid transfer (START) domain containing 13 1 1
MIRT006910 ABTB1 ankyrin repeat and BTB (POZ) domain containing 1 1 1
MIRT006945 HK2 hexokinase 2 2 1
MIRT006974 E2F2 E2F transcription factor 2 3 1
MIRT006990 MMP13 matrix metallopeptidase 13 (collagenase 3) 1 1
MIRT007066 MAPK14 mitogen-activated protein kinase 14 4 1
MIRT022104 PF4 platelet factor 4 1 1
MIRT022105 IL6 interleukin 6 (interferon, beta 2) 1 1
MIRT022106 GP9 glycoprotein IX (platelet) 1 1
MIRT022107 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT022108 Lin28a lin-28 homolog A (C. elegans) 1 1
MIRT022109 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT022110 TBXAS1 thromboxane A synthase 1 (platelet) 1 1
MIRT022111 KLF1 Kruppel-like factor 1 (erythroid) 1 1
MIRT022112 EPO erythropoietin 1 1
MIRT022114 MUC1 mucin 1, cell surface associated 2 1
MIRT035540 NES nestin 1 1
MIRT035583 ATP6AP1L ATPase, H+ transporting, lysosomal accessory protein 1-like 1 1
MIRT035584 DICER1 dicer 1, ribonuclease type III 1 3
MIRT035585 ST18 suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) 1 1
MIRT035586 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT035587 KRT19 keratin 19 1 1
MIRT045889 SLC16A4 solute carrier family 16, member 4 (monocarboxylic acid transporter 5) 1 1
MIRT045890 KIF24 kinesin family member 24 1 1
MIRT045891 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT045892 RGS19 regulator of G-protein signaling 19 1 1
MIRT045893 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT045894 ADM adrenomedullin 1 1
MIRT045895 THUMPD3 THUMP domain containing 3 1 1
MIRT045896 RHOV ras homolog gene family, member V 1 1
MIRT045897 R3HDM2 R3H domain containing 2 1 1
MIRT045898 C2orf88 chromosome 2 open reading frame 88 1 1
MIRT045899 SHMT1 serine hydroxymethyltransferase 1 (soluble) 1 1
MIRT045900 CRTC1 CREB regulated transcription coactivator 1 1 1
MIRT045901 XIAP X-linked inhibitor of apoptosis 1 1
MIRT045902 CNGB1 cyclic nucleotide gated channel beta 1 1 1
MIRT045903 THAP3 THAP domain containing, apoptosis associated protein 3 1 1
MIRT045904 WDR11 WD repeat domain 11 1 1
MIRT045905 CD320 CD320 molecule 1 1
MIRT045906 ACLY ATP citrate lyase 1 1
MIRT045907 HOXA13 homeobox A13 1 1
MIRT045908 SMYD5 SMYD family member 5 1 1
MIRT045909 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT045910 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT045911 HKR1 HKR1, GLI-Kruppel zinc finger family member 1 1
MIRT045912 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT045913 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT045914 BCOR BCL6 corepressor 1 1
MIRT045915 SORT1 sortilin 1 1 1
MIRT045916 MYEF2 myelin expression factor 2 1 1
MIRT045917 E2F7 E2F transcription factor 7 1 1
MIRT045918 S100A8 S100 calcium binding protein A8 1 1
MIRT045919 CCNE1 cyclin E1 1 1
MIRT045920 MTMR3 myotubularin related protein 3 1 1
MIRT045921 KIAA0141 KIAA0141 1 1
MIRT045922 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT045923 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1 1
MIRT045924 SMIM8 chromosome 6 open reading frame 162 1 1
MIRT045925 CEP170 centrosomal protein 170kDa 1 1
MIRT045926 SIK2 salt-inducible kinase 2 1 1
MIRT045927 HMGN1 high-mobility group nucleosome binding domain 1 1 1
MIRT045928 ILVBL ilvB (bacterial acetolactate synthase)-like 1 1
MIRT045929 LTV1 LTV1 homolog (S. cerevisiae) 1 1
MIRT045930 MYO19 myosin XIX 1 1
MIRT045931 CHMP3 vacuolar protein sorting 24 homolog (S. cerevisiae) 1 1
MIRT045932 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT045933 ADRM1 adhesion regulating molecule 1 1 1
MIRT045934 ZNF592 zinc finger protein 592 1 1
MIRT045935 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT045936 PCDHGB2 protocadherin gamma subfamily B, 2 1 1
MIRT045937 SUPT6H suppressor of Ty 6 homolog (S. cerevisiae) 1 1
MIRT045938 ARF3 ADP-ribosylation factor 3 1 1
MIRT045939 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT045940 HNRNPK heterogeneous nuclear ribonucleoprotein K 1 1
MIRT045941 ZMYND11 zinc finger, MYND domain containing 11 1 1
MIRT045942 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT045943 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT045944 VCL vinculin 1 1
MIRT045945 MRTO4 mRNA turnover 4 homolog (S. cerevisiae) 1 1
MIRT045946 ZNF483 zinc finger protein 483 1 1
MIRT045947 VDAC1 voltage-dependent anion channel 1 1 1
MIRT045948 SMC6 structural maintenance of chromosomes 6 1 1
MIRT045949 PTOV1 prostate tumor overexpressed 1 1 1
MIRT045950 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT045951 COX7C cytochrome c oxidase subunit VIIc 1 1
MIRT045952 NSUN2 NOP2/Sun domain family, member 2 1 1
MIRT045953 RASGRP1 RAS guanyl releasing protein 1 (calcium and DAG-regulated) 1 1
MIRT045954 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 1 1
MIRT045955 CARHSP1 calcium regulated heat stable protein 1, 24kDa 1 1
MIRT045956 CCDC124 coiled-coil domain containing 124 1 1
MIRT045957 RPS7 ribosomal protein S7 1 1
MIRT045958 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT045959 GPRIN1 G protein regulated inducer of neurite outgrowth 1 1 1
MIRT045960 UNKL unkempt homolog (Drosophila)-like 1 1
MIRT045961 CREBBP CREB binding protein 1 1
MIRT045962 NDOR1 NADPH dependent diflavin oxidoreductase 1 1 1
MIRT045963 KHSRP KH-type splicing regulatory protein 1 1
MIRT045964 GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 1 1
MIRT045965 CDRT4 CMT1A duplicated region transcript 4 1 1
MIRT045966 RPLP0 ribosomal protein, large, P0 1 1
MIRT045967 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT045968 EXOC7 exocyst complex component 7 1 1
MIRT045969 RASAL2 RAS protein activator like 2 1 1
MIRT045970 RPS3A ribosomal protein S3A 1 1
MIRT045971 PRKAG1 protein kinase, AMP-activated, gamma 1 non-catalytic subunit 1 1
MIRT045972 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 1 1
MIRT045973 LBX2 ladybird homeobox 2 1 1
MIRT045974 SLC9A3R2 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2 1 1
MIRT045975 SPRTN chromosome 1 open reading frame 124 1 1
MIRT045976 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT045977 STRN3 striatin, calmodulin binding protein 3 1 1
MIRT045978 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT045979 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT045980 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 1 1
MIRT045981 ZNF212 zinc finger protein 212 1 1
MIRT045982 SLC19A1 solute carrier family 19 (folate transporter), member 1 1 1
MIRT045983 LTA4H leukotriene A4 hydrolase 1 1
MIRT045984 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT045985 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT045986 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT045987 UNG uracil-DNA glycosylase 1 1
MIRT045988 HSPD1 heat shock 60kDa protein 1 (chaperonin) 1 1
MIRT045989 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT045990 EPHA7 EPH receptor A7 1 1
MIRT045991 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT045992 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT045993 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT045994 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT045995 ZNF395 zinc finger protein 395 1 1
MIRT045996 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT045997 PLXND1 plexin D1 1 1
MIRT045998 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT045999 RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 1 1
MIRT046000 RPS12 ribosomal protein S12 1 1
MIRT046001 PDZD11 PDZ domain containing 11 1 1
MIRT046002 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT046003 RNASEH2A ribonuclease H2, subunit A 1 1
MIRT046004 MTMR4 myotubularin related protein 4 1 1
MIRT046005 ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 1 1
MIRT046006 NDC1 transmembrane protein 48 1 1
MIRT046007 TDG thymine-DNA glycosylase 1 1
MIRT046008 SMC2 structural maintenance of chromosomes 2 1 1
MIRT046009 MATR3 matrin 3 1 1
MIRT046010 TARDBP TAR DNA binding protein 1 1
MIRT046011 FBN1 fibrillin 1 1 1
MIRT046012 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT046013 STARD8 StAR-related lipid transfer (START) domain containing 8 1 1
MIRT046014 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 1 1
MIRT046015 GANAB glucosidase, alpha; neutral AB 1 1
MIRT046016 NUP93 nucleoporin 93kDa 1 1
MIRT046017 NUP205 nucleoporin 205kDa 1 1
MIRT046018 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT046019 HSPBP1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 1 1
MIRT046020 PLA2G4F phospholipase A2, group IVF 1 1
MIRT046021 FAM60A family with sequence similarity 60, member A 1 1
MIRT046022 DHX38 DEAH (Asp-Glu-Ala-His) box polypeptide 38 1 1
MIRT046023 PRDX2 peroxiredoxin 2 1 1
MIRT046024 FAM208A chromosome 3 open reading frame 63 1 1
MIRT046025 ZDHHC5 zinc finger, DHHC-type containing 5 1 1
MIRT046026 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 1 1
MIRT046027 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT046028 EHMT1 euchromatic histone-lysine N-methyltransferase 1 1 1
MIRT046029 SUGP2 splicing factor, arginine/serine-rich 14 1 1
MIRT046030 GALNT18 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 1 1
MIRT046031 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT046032 FBXO38 F-box protein 38 1 1
MIRT046033 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT046034 EMD emerin 1 1
MIRT046035 AKAP2 A kinase (PRKA) anchor protein 2 1 1
MIRT046036 PCBP2 poly(rC) binding protein 2 1 1
MIRT046037 SDHB succinate dehydrogenase complex, subunit B, iron sulfur (Ip) 1 1
MIRT046038 PSMB1 proteasome (prosome, macropain) subunit, beta type, 1 1 1
MIRT046039 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT046040 CSRNP2 cysteine-serine-rich nuclear protein 2 1 1
MIRT046041 RANBP2 RAN binding protein 2 1 1
MIRT046042 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT046043 TNKS1BP1 tankyrase 1 binding protein 1, 182kDa 1 1
MIRT046044 ESRP2 epithelial splicing regulatory protein 2 1 1
MIRT046045 RPL35A ribosomal protein L35a 1 1
MIRT046046 TMEM2 transmembrane protein 2 1 1
MIRT046047 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT046048 EXTL3 exostoses (multiple)-like 3 1 1
MIRT046049 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT046050 FMNL3 formin-like 3 1 1
MIRT046051 PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) 1 1
MIRT046052 RPL3 ribosomal protein L3 1 1
MIRT046053 AURKB aurora kinase B 1 1
MIRT046054 EDEM1 ER degradation enhancer, mannosidase alpha-like 1 1 1
MIRT046055 TIMM23 translocase of inner mitochondrial membrane 23 homolog (yeast) 1 1
MIRT046056 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT046057 TEF thyrotrophic embryonic factor 1 1
MIRT046058 MED1 mediator complex subunit 1 1 1
MIRT046059 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT046060 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT046061 BTBD3 BTB (POZ) domain containing 3 1 1
MIRT046062 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT046063 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT046064 PTGES prostaglandin E synthase 1 1
MIRT046065 MEPCE methylphosphate capping enzyme 1 1
MIRT046066 MTF1 metal-regulatory transcription factor 1 1 1
MIRT046067 PKM pyruvate kinase, muscle 1 1
MIRT046068 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 1
MIRT046069 IRS4 insulin receptor substrate 4 1 1
MIRT046070 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT046071 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT046072 FZD4 frizzled homolog 4 (Drosophila) 1 1
MIRT046073 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT046074 NRARP NOTCH-regulated ankyrin repeat protein 1 1
MIRT046075 THUMPD1 THUMP domain containing 1 1 1
MIRT046076 HDGF hepatoma-derived growth factor 1 1
MIRT046077 ZFYVE1 zinc finger, FYVE domain containing 1 1 1
MIRT046078 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT046079 C19orf54 chromosome 19 open reading frame 54 1 1
MIRT046080 RIMS4 regulating synaptic membrane exocytosis 4 1 1
MIRT046081 MTMR12 myotubularin related protein 12 1 1
MIRT046082 NME2 non-metastatic cells 2, protein (NM23B) expressed in 1 1
MIRT046083 TMEM9 transmembrane protein 9 1 1
MIRT046084 ACSS1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT046085 USP8 ubiquitin specific peptidase 8 1 1
MIRT046086 FUS fused in sarcoma 1 1
MIRT046087 PAM peptidylglycine alpha-amidating monooxygenase 1 1
MIRT046088 NPTN neuroplastin 1 1
MIRT046089 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT046090 NEBL nebulette 1 1
MIRT046091 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT046092 RPS28 ribosomal protein S28 1 1
MIRT046093 STC2 stanniocalcin 2 1 1
MIRT046094 LSM14B LSM14B, SCD6 homolog B (S. cerevisiae) 1 1
MIRT046095 C1orf109 chromosome 1 open reading frame 109 1 1
MIRT046096 KPNB1 karyopherin (importin) beta 1 1 1
MIRT046097 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT046098 C17orf80 chromosome 17 open reading frame 80 1 1
MIRT046099 EMC1 KIAA0090 1 1
MIRT046100 ETF1 eukaryotic translation termination factor 1 1 1
MIRT046101 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT046102 RFWD3 ring finger and WD repeat domain 3 1 1
MIRT046103 RYBP RING1 and YY1 binding protein 1 1
MIRT046104 ABL1 c-abl oncogene 1, receptor tyrosine kinase 1 1
MIRT046105 IP6K1 inositol hexakisphosphate kinase 1 1 1