Accession ID: MIRT004390 [miRNA, hsa-miR-195-5p :: SKI, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-195LinkOut: [miRBase ]
Description Homo sapiens miR-195 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-195-5p
Mature Sequence 15| UAGCAGCACAGAAAUAUUGGC |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-195-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SKI LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms SKV
Description v-ski sarcoma viral oncogene homolog (avian)
Transcript NM_0030    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SKI LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SKI
(miRNA target sites are highlighted)
>SKI|NM_0030|3'UTR
   1 CGGGCCCGCCCCGAGGCTGCGGGCAGCGAGGGCGCTGCGGAGCTGGAGCCGTAGATTCCGTGCCTGCCGCCGCAGCGCCG
  81 CCGACAACGCGGGTGCAGGGGGGCGCGGCTGGGCGGTGCAGCTCCGCCCGGCTCCGCCCCTGCAGCCCACACAGCACAAC
 161 GTCTTACCGTGCCTATTACCAAGCGAGTGTTTGTAACCATGTAGTTTTGGAACCCACTGCAAAATTTTCTACTGGCCAAG
 241 TTCAAGTGAGTAAGCCGCGTCCCCCAACTACAGCTGGAGACGGGGCCAGCTCGGCGGCCTGCTGGTCCTCTGCTTGCTGG
 321 AACATTCTAACATTTACACTTTTGTTATAAGCTATTTAAAACCAGTAAGGAGACTTGAAATTCAGAAAATCAACACATTT
 401 TTAAATGACTAACTTCTAAAAGCCCCAACACATGACGCCATCTGAAGACCCGCAACGGAGTGGGGGTGGCGGCCGCCCCA
 481 CCCTCCCCACCCGGGGAAGCCATCACAGCTCATCTGCCCGCGGCTGCGTGAGGACAGCAGGGGTTTTTCTTCAGAGTCTA
 561 TTTTTTCAGCGACAAGGACCCAGGTCTTCCTGCTGCTGCCAGGGAGAGCAGGGACAGTGCCGCGTGCGAGATGAGCTCGA
 641 ACACTGCCCGCCTTACTGCCGCCTACCCCGCCCGCCACGCCGCCGTCGATGCCAGCGCTGTCCCCACGGGTACCAGGAAG
 721 TGCAGAGCCGCACAGGAGCTGCCCCGGAGCTGAGGGGACGGTCTTCGGCTCCTCTGCACCCCGTGATTCTGCCCACGCTC
 801 CTCCACCACGAGGCACTGACCTGCGTCGGGTGGTGACCGTGGCTGGCGGTCACGCCCTCAGCCCCTCCGGGCACACGTGC
 881 CGCCTGACCGGGCGACCCTTTTCAGTTCGGCAAACGTCGCTCCCTTCATTTTGGGACTGAGGCTGCAGCATTGGAACAAA
 961 AGAGCATTATTTCAATTTTTCTTTCTTTTTTTTTGTTCGTTCATTTAAACGTATATTTAGAACTGCACTTTGTCCACAAC
1041 CTTCCCTTCTCTTTCTATTCCCCAGTGAACTGAGGTTTTTACCGATTTATAGAGCAGTCAAATCCGAAGTGCTCGAGTGC
1121 TTAGAAACCCCCTCTGGTGCTTGGTTGAACAAGGGAATCACAAGAAAACGAAAATGCAAAAACTGAACTTCGGGGGTCGT
1201 TCTGTGCCTTCCAGCATCTTGTACAGCAAATCCTGACTCGTGTCTTTTTACCCCCAAGATATCTGTCTTCAGTAGCGACT
1281 GAATCTGCCACTCTCAGAATAAGTTCCTTGCATTTATTCCAAATAATCTCGTTTACTCTCACCTGTTTATGCAAATTGTA
1361 TAAGGTTTCTTATGCCCAAGCTTGAAAAATGATTTCCCAGTAGACAAGAGGCGGCTACCTATCCTACAGTTACGGTATTT
1441 ATTTACATAAGAAGATCTTACAGGAGTTCTTTGCTTGAATCCGTTCTAACACCCGCGGCAGCTGCACGCGCTCACAGAAG
1521 GTGGAGGTTACTTGCCCAGGTACAGACGACCTCGGGGCAGTGACGAGCAAAGACCAGAGACTGCTGAGCCCTCGCATCTG
1601 GGTGGCGGAATTGCCTGCGGGGTTTTGCCCTTGGTTTACTGAGGGGGGTCTTGGTTGCTGCTGAAGCCCCCCACCCCTTC
1681 TAAAGTGCAATGCAAAAGGGACATCATGTATATGCAGCGTTTGTTTGGAATTTTCTTTGCTTTTGTTTTCTTTGCGGTTG
1761 TTCTGTGTGCATGGATTCCACACCTCTGCCGTAGGTAGATCCGTCAGCGGGCATTATTACCGTGTCTTGTAAAGGGTCGG
1841 TTTTGTTATGCAACATGCAGAATGCTGTTTTTAGCCTTGTTTTACCAGAGTTGTTTTTTTTTTCAGTTATTTCTTCAAGG
1921 GAAACTAAATGATTTAGTTGGAGCAAAGCTTTAAGTGTGTTGGCGTGCTTCTGTGTGGCTGTCCTGTGTCGCCAGGTCGA
2001 AGATCACAGTGAGGTAGAGGCCCTGCCCCATCCCCAGGGCCGCCAGGCTTGCTCCGTTTGCTTTGAGTTTTTAGACCCCA
2081 GAGGGAGATGAGCTTTTCCAAGCTGTGTCTGGGCCAGAGCCTCTCCTTGCCCTTGCTCCATCCCGACGGTCACCGTTGGG
2161 TCCACGCCTCCACCGCCCCATCTTGCCCCAAACGGAAAGCGCTGTATCTGCAGTGGCAGCCCTTCCCCACTTCGGCTCTG
2241 GGAGGGTCCAGCCAGTGTCACCTGGGCCCACCCTTTCCTGCAGCTGCCAGGCCCGTGCGGTCAGTGGGACCCGGACGTGG
2321 GCAGGCGAGCTCGGGACCCTCCCAGGCAGTTCCCACAGCTCTTGCCTCGGCTCACCAGGGTCACTTCCACTGTCAGGGGC
2401 CTGAGGGGGCAGCTGTGGCTGCAGGGCTGCTCTGGACTGAGGGGTCCCAGGCCCCGAGGGGTGCACGCCTGGCTCCCCTT
2481 GGCACAGGTGCGAGTCCGTTTCTTTTCAGCAGAAGGGGGAAGAGGTGTCCGCTGTGTGGGCTGCTGACTCCTCTGTGTGT
2561 GAGGCCCTTCATCTAAGTGATTGTGTATTCAGTTTAATTCTCATTATATTTCTATACTGAAAGAAGATTTTTAACGAAGG
2641 GAAAAACAACAGCAATAACATTCATATCTCTGGAGCAGCTAACTCATACACGTAATGTCTGCTTTTCGTACAGAACTAGC
2721 CAATGTAAAAACAGTTCACCTGTAAATACTTTTTCCTTTTTCACCGTTGTATTATACATGTATATGCTGGGTCCTTTTTC
2801 AGAAACTCTTTTCTTACCTGAGAGTTGTCTTGTTTTCTGGGCTGTTTTTAACTGAGGAAAAAAAAAATGCTTTCCTGCCG
2881 GGGGGCAGGGGAGACGGAGAAACCCATGTGCGTTTCCCATGTGACCCCCTCCTCCCTGTGGGTCTGAGCCCCGGCCCCCC
2961 CCACCTCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCACCCCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCAC
3041 CCCCTCCTCCCTGTGGGTCCGATCCCCGGCCCCCCCCACCCCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCCCCAC
3121 CCCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCACCCCTCCCTCAGCCCACCAGGGTCCAGGGAGATGTTCGTTCTC
3201 GCTTTAAGTCAGGAGTCACAAATGACTTTTTTTTTTCAATTAAGGAAAAAGCTCCATCTCTACCTTTAACATCACCCAGA
3281 CCCCCGCCCCTGCCCGTGCCCCACGCTGCTGCTAACGACAGTATGATGCTTACTCTGCTACTCGGAAACTATTTTTATGT
3361 AATTAATGTATGCTTTCTTGTTTATAAATGCCTGATTTAAAAAGAAAAGAGCTTGGCATATTTATCTATTTCGCTGTGTA
3441 CCTGTTAGTCCTTCCCCGACCCCGAAACAGATGACATTGTACAATAAAGGACTTTGAGAGGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgGUUAUAAAGACACGACGAu 5'
            | | :| |:  ||||||| 
Target 5' acCCAGGTCTTCCTGCTGCTg 3'
578 - 598 147.00 -15.60
2
miRNA  3' cggUUAUAAAGACACGACGAu 5'
             ::| ||  | ||||||| 
Target 5' gggGGTCTTGGT-TGCTGCTg 3'
1644 - 1663 145.00 -10.10
3
miRNA  3' cgguuauaaagacACGACGAu 5'
                       ||||||| 
Target 5' ccgtgccccacgcTGCTGCTa 3'
3294 - 3314 140.00 -12.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-195-5p :: SKI    [ Functional MTI ]
Validation Method Microarray , Northern blot , Other
Original Description (Extracted from the article) ... UUsing these algorithms, we listed cancer-related mRNA targets of miRNA (Table 4). Especially, searching a candidate gene for miR-18, we picked up two candidates; connective tissue growth factor (CTGF) and receptor activator nuclear factor kappa B ligand (RANKL). ...

- Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al., 2006, Oncogene.

Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
39 hsa-miR-195-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000222 WEE1 WEE1 homolog (S. pombe) 5 2
MIRT000223 E2F3 E2F transcription factor 3 4 2
MIRT000224 CDK6 cyclin-dependent kinase 6 4 1
MIRT000225 CCND1 cyclin D1 3 4
MIRT000785 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT000795 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT004273 VEGFA vascular endothelial growth factor A 2 1
MIRT004390 SKI v-ski sarcoma viral oncogene homolog (avian) 2 1
MIRT004669 CCL4 chemokine (C-C motif) ligand 4 3 1
MIRT004937 KRT7 keratin 7 2 1
MIRT005362 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT006077 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 3 1
MIRT006080 RUNX2 runt-related transcription factor 2 3 1
MIRT006235 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 2 1
MIRT006245 TBCCD1 TBCC domain containing 1 2 1
MIRT006246 CCND3 cyclin D3 2 1
MIRT006252 CDK4 cyclin-dependent kinase 4 1 1
MIRT006995 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT007054 CAB39 calcium binding protein 39 2 1
MIRT007169 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007170 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT007219 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT007237 CCNE1 cyclin E1 1 1
MIRT007370 BCL2L2 BCL2-like 2 2 1
MIRT044858 JAK2 Janus kinase 2 1 1
MIRT044859 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT044860 AGER advanced glycosylation end product-specific receptor 1 1
MIRT044861 LSM11 LSM11, U7 small nuclear RNA associated 1 1
MIRT044862 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT044863 ZNF280C zinc finger protein 280C 1 1
MIRT044864 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT044865 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT044866 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT044867 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT044868 RPL10 ribosomal protein L10 1 1
MIRT044869 TMC6 transmembrane channel-like 6 1 1
MIRT044870 TPI1 triosephosphate isomerase 1 1 1
MIRT044871 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 1 1
MIRT044872 AGO1 eukaryotic translation initiation factor 2C, 1 1 1