Accession ID: MIRT004395 [miRNA, hsa-miR-199a-5p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199a-1LinkOut: [miRBase ]
Synonyms MIRN199A1, MIR199A1
Description Homo sapiens miR-199a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199a-5p
Mature Sequence 6| CCCAGUGUUCAGACUACCUGUUC |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199a-5p :: MECP2    [ Functional MTI ]
Validation Method Microarray , Northern blot , Other
Original Description (Extracted from the article) ... UUsing these algorithms, we listed cancer-related mRNA targets of miRNA (Table 4). Especially, searching a candidate gene for miR-18, we picked up two candidates; connective tissue growth factor (CTGF) and receptor activator nuclear factor kappa B ligand (RANKL). ...

- Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al., 2006, Oncogene.

Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
24 hsa-miR-199a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003809 EZH2 enhancer of zeste homolog 2 (Drosophila) 2 1
MIRT003828 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 4 1
MIRT003963 CCNL1 cyclin L1 2 2
MIRT004325 LIF leukemia inhibitory factor 2 1
MIRT004391 JUNB jun B proto-oncogene 2 1
MIRT004393 MED6 mediator complex subunit 6 2 1
MIRT004395 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT004398 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 2 1
MIRT004674 DDR1 discoidin domain receptor tyrosine kinase 1 3 1
MIRT005432 EDN1 endothelin 1 2 1
MIRT005873 MAP3K11 mitogen-activated protein kinase kinase kinase 11 3 1
MIRT006138 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 3 1
MIRT006193 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT006561 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 3 1
MIRT006786 CD44 CD44 molecule (Indian blood group) 1 1
MIRT006832 TMEM54 transmembrane protein 54 2 1
MIRT007013 SMAD4 SMAD family member 4 1 2
MIRT007036 SULT1E1 sulfotransferase family 1E, estrogen-preferring, member 1 1 1
MIRT007061 GPR78 G protein-coupled receptor 78 1 1
MIRT007265 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 1 1
MIRT007303 UNG uracil-DNA glycosylase 1 1
MIRT026024 ALOX5AP arachidonate 5-lipoxygenase-activating protein 1 1
MIRT035548 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT052646 SIRT1 sirtuin 1 2 1