Accession ID: MIRT004395 [miRNA, hsa-miR-199a-5p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199a-1LinkOut: [miRBase ]
Synonyms MIRN199A1, MIR199A1
Description Homo sapiens miR-199a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199a-5p
Mature Sequence 6| CCCAGUGUUCAGACUACCUGUUC |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MECP2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AUTSX3, DKFZp686A24160, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT
Description methyl CpG binding protein 2 (Rett syndrome)
Transcript NM_0049    LinkOut: [ RefSeq ]
Other Transcripts NM_0011107   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MECP2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MECP2
(miRNA target sites are highlighted)
>MECP2|NM_0049|3'UTR
   1 TGACTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCT
  81 CTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGT
 161 GGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAG
 241 CTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCAC
 321 CTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCCGTTTT
 401 CGGTGCCATCAGTGCCCCGTCTACAGCTCCCCCAGCTCCCCCCACCTCCCCCACTCCCAACCACGTTGGGACAGGGAGGT
 481 GTGAGGCAGGAGAGACAGTTGGATTCTTTAGAGAAGATGGATATGACCAGTGGCTATGGCCTGTGCGATCCCACCCGTGG
 561 TGGCTCAAGTCTGGCCCCACACCAGCCCCAATCCAAAACTGGCAAGGACGCTTCACAGGACAGGAAAGTGGCACCTGTCT
 641 GCTCCAGCTCTGGCATGGCTAGGAGGGGGGAGTCCCTTGAACTACTGGGTGTAGACTGGCCTGAACCACAGGAGAGGATG
 721 GCCCAGGGTGAGGTGGCATGGTCCATTCTCAAGGGACGTCCTCCAACGGGTGGCGCTAGAGGCCATGGAGGCAGTAGGAC
 801 AAGGTGCAGGCAGGCTGGCCTGGGGTCAGGCCGGGCAGAGCACAGCGGGGTGAGAGGGATTCCTAATCACTCAGAGCAGT
 881 CTGTGACTTAGTGGACAGGGGAGGGGGCAAAGGGGGAGGAGAAGAAAATGTTCTTCCAGTTACTTTCCAATTCTCCTTTA
 961 GGGACAGCTTAGAATTATTTGCACTATTGAGTCTTCATGTTCCCACTTCAAAACAAACAGATGCTCTGAGAGCAAACTGG
1041 CTTGAATTGGTGACATTTAGTCCCTCAAGCCACCAGATGTGACAGTGTTGAGAACTACCTGGATTTGTATATATACCTGC
1121 GCTTGTTTTAAAGTGGGCTCAGCACATAGGGTTCCCACGAAGCTCCGAAACTCTAAGTGTTTGCTGCAATTTTATAAGGA
1201 CTTCCTGATTGGTTTCTCTTCTCCCCTTCCATTTCTGCCTTTTGTTCATTTCATCCTTTCACTTCTTTCCCTTCCTCCGT
1281 CCTCCTCCTTCCTAGTTCATCCCTTCTCTTCCAGGCAGCCGCGGTGCCCAACCACACTTGTCGGCTCCAGTCCCCAGAAC
1361 TCTGCCTGCCCTTTGTCCTCCTGCTGCCAGTACCAGCCCCACCCTGTTTTGAGCCCTGAGGAGGCCTTGGGCTCTGCTGA
1441 GTCCGACCTGGCCTGTCTGTGAAGAGCAAGAGAGCAGCAAGGTCTTGCTCTCCTAGGTAGCCCCCTCTTCCCTGGTAAGA
1521 AAAAGCAAAAGGCATTTCCCACCCTGAACAACGAGCCTTTTCACCCTTCTACTCTAGAGAAGTGGACTGGAGGAGCTGGG
1601 CCCGATTTGGTAGTTGAGGAAAGCACAGAGGCCTCCTGTGGCCTGCCAGTCATCGAGTGGCCCAACAGGGGCTCCATGCC
1681 AGCCGACCTTGACCTCACTCAGAAGTCCAGAGTCTAGCGTAGTGCAGCAGGGCAGTAGCGGTACCAATGCAGAACTCCCA
1761 AGACCCGAGCTGGGACCAGTACCTGGGTCCCCAGCCCTTCCTCTGCTCCCCCTTTTCCCTCGGAGTTCTTCTTGAATGGC
1841 AATGTTTTGCTTTTGCTCGATGCAGACAGGGGGCCAGAACACCACACATTTCACTGTCTGTCTGGTCCATAGCTGTGGTG
1921 TAGGGGCTTAGAGGCATGGGCTTGCTGTGGGTTTTTAATTGATCAGTTTTCATGTGGGATCCCATCTTTTTAACCTCTGT
2001 TCAGGAAGTCCTTATCTAGCTGCATATCTTCATCATATTGGTATATCCTTTTCTGTGTTTACAGAGATGTCTCTTATATC
2081 TAAATCTGTCCAACTGAGAAGTACCTTATCAAAGTAGCAAATGAGACAGCAGTCTTATGCTTCCAGAAACACCCACAGGC
2161 ATGTCCCATGTGAGCTGCTGCCATGAACTGTCAAGTGTGTGTTGTCTTGTGTATTTCAGTTATTGTCCCTGGCTTCCTTA
2241 CTATGGTGTAATCATGAAGGAGTGAAACATCATAGAAACTGTCTAGCACTTCCTTGCCAGTCTTTAGTGATCAGGAACCA
2321 TAGTTGACAGTTCCAATCAGTAGCTTAAGAAAAAACCGTGTTTGTCTCTTCTGGAATGGTTAGAAGTGAGGGAGTTTGCC
2401 CCGTTCTGTTTGTAGAGTCTCATAGTTGGACTTTCTAGCATATATGTGTCCATTTCCTTATGCTGTAAAAGCAAGTCCTG
2481 CAACCAAACTCCCATCAGCCCAATCCCTGATCCCTGATCCCTTCCACCTGCTCTGCTGATGACCCCCCCAGCTTCACTTC
2561 TGACTCTTCCCCAGGAAGGGAAGGGGGGTCAGAAGAGAGGGTGAGTCCTCCAGAACTCTTCCTCCAAGGACAGAAGGCTC
2641 CTGCCCCCATAGTGGCCTCGAACTCCTGGCACTACCAAAGGACACTTATCCACGAGAGCGCAGCATCCGACCAGGTTGTC
2721 ACTGAGAAGATGTTTATTTTGGTCAGTTGGGTTTTTATGTATTATACTTAGTCAAATGTAATGTGGCTTCTGGAATCATT
2801 GTCCAGAGCTGCTTCCCCGTCACCTGGGCGTCATCTGGTCCTGGTAAGAGGAGTGCGTGGCCCACCAGGCCCCCCTGTCA
2881 CCCATGACAGTTCATTCAGGGCCGATGGGGCAGTCGTGGTTGGGAACACAGCATTTCAAGCGTCACTTTATTTCATTCGG
2961 GCCCCACCTGCAGCTCCCTCAAAGAGGCAGTTGCCCAGCCTCTTTCCCTTCCAGTTTATTCCAGAGCTGCCAGTGGGGCC
3041 TGAGGCTCCTTAGGGTTTTCTCTCTATTTCCCCCTTTCTTCCTCATTCCCTCGTCTTTCCCAAAGGCATCACGAGTCAGT
3121 CGCCTTTCAGCAGGCAGCCTTGGCGGTTTATCGCCCTGGCAGGCAGGGGCCCTGCAGCTCTCATGCTGCCCCTGCCTTGG
3201 GGTCAGGTTGACAGGAGGTTGGAGGGAAAGCCTTAAGCTGCAGGATTCTCACCAGCTGTGTCCGGCCCAGTTTTGGGGTG
3281 TGACCTCAATTTCAATTTTGTCTGTACTTGAACATTATGAAGATGGGGGCCTCTTTCAGTGAATTTGTGAACAGCAGAAT
3361 TGACCGACAGCTTTCCAGTACCCATGGGGCTAGGTCATTAAGGCCACATCCACAGTCTCCCCCACCCTTGTTCCAGTTGT
3441 TAGTTACTACCTCCTCTCCTGACAATACTGTATGTCGTCGAGCTCCCCCCAGGTCTACCCCTCCCGGCCCTGCCTGCTGG
3521 TGGGCTTGTCATAGCCAGTGGGATTGCCGGTCTTGACAGCTCAGTGAGCTGGAGATACTTGGTCACAGCCAGGCGCTAGC
3601 ACAGCTCCCTTCTGTTGATGCTGTATTCCCATATCAAAAGACACAGGGGACACCCAGAAACGCCACATCCCCCAATCCAT
3681 CAGTGCCAAACTAGCCAACGGCCCCAGCTTCTCAGCTCGCTGGATGGCGGAAGCTGCTACTCGTGAGCGCCAGTGCGGGT
3761 GCAGACAATCTTCTGTTGGGTGGCATCATTCCAGGCCCGAAGCATGAACAGTGCACCTGGGACAGGGAGCAGCCCCAAAT
3841 TGTCACCTGCTTCTCTGCCCAGCTTTTCATTGCTGTGACAGTGATGGCGAAAGAGGGTAATAACCAGACACAAACTGCCA
3921 AGTTGGGTGGAGAAAGGAGTTTCTTTAGCTGACAGAATCTCTGAATTTTAAATCACTTAGTAAGCGGCTCAAGCCCAGGA
4001 GGGAGCAGAGGGATACGAGCGGAGTCCCCTGCGCGGGACCATCTGGAATTGGTTTAGCCCAAGTGGAGCCTGACAGCCAG
4081 AACTCTGTGTCCCCCGTCTAACCACAGCTCCTTTTCCAGAGCATTCCAGTCAGGCTCTCTGGGCTGACTGGGCCAGGGGA
4161 GGTTACAGGTACCAGTTCTTTAAGAAGATCTTTGGGCATATACATTTTTAGCCTGTGTCATTGCCCCAAATGGATTCCTG
4241 TTTCAAGTTCACACCTGCAGATTCTAGGACCTGTGTCCTAGACTTCAGGGAGTCAGCTGTTTCTAGAGTTCCTACCATGG
4321 AGTGGGTCTGGAGGACCTGCCCGGTGGGGGGGCAGAGCCCTGCTCCCTCCGGGTCTTCCTACTCTTCTCTCTGCTCTGAC
4401 GGGATTTGTTGATTCTCTCCATTTTGGTGTCTTTCTCTTTTAGATATTGTATCAATCTTTAGAAAAGGCATAGTCTACTT
4481 GTTATAAATCGTTAGGATACTGCCTCCCCCAGGGTCTAAAATTACATATTAGAGGGGAAAAGCTGAACACTGAAGTCAGT
4561 TCTCAACAATTTAGAAGGAAAACCTAGAAAACATTTGGCAGAAAATTACATTTCGATGTTTTTGAATGAATACGAGCAAG
4641 CTTTTACAACAGTGCTGATCTAAAAATACTTAGCACTTGGCCTGAGATGCCTGGTGAGCATTACAGGCAAGGGGAATCTG
4721 GAGGTAGCCGACCTGAGGACATGGCTTCTGAACCTGTCTTTTGGGAGTGGTATGGAAGGTGGAGCGTTCACCAGTGACCT
4801 GGAAGGCCCAGCACCACCCTCCTTCCCACTCTTCTCATCTTGACAGAGCCTGCCCCAGCGCTGACGTGTCAGGAAAACAC
4881 CCAGGGAACTAGGAAGGCACTTCTGCCTGAGGGGCAGCCTGCCTTGCCCACTCCTGCTCTGCTCGCCTCGGATCAGCTGA
4961 GCCTTCTGAGCTGGCCTCTCACTGCCTCCCCAAGGCCCCCTGCCTGCCCTGTCAGGAGGCAGAAGGAAGCAGGTGTGAGG
5041 GCAGTGCAAGGAGGGAGCACAACCCCCAGCTCCCGCTCCGGGCTCCGACTTGTGCACAGGCAGAGCCCAGACCCTGGAGG
5121 AAATCCTACCTTTGAATTCAAGAACATTTGGGGAATTTGGAAATCTCTTTGCCCCCAAACCCCCATTCTGTCCTACCTTT
5201 AATCAGGTCCTGCTCAGCAGTGAGAGCAGATGAGGTGAAAAGGCCAAGAGGTTTGGCTCCTGCCCACTGATAGCCCCTCT
5281 CCCCGCAGTGTTTGTGTGTCAAGTGGCAAAGCTGTTCTTCCTGGTGACCCTGATTATATCCAGTAACACATAGACTGTGC
5361 GCATAGGCCTGCTTTGTCTCCTCTATCCTGGGCTTTTGTTTTGCTTTTTAGTTTTGCTTTTAGTTTTTCTGTCCCTTTTA
5441 TTTAACGCACCGACTAGACACACAAAGCAGTTGAATTTTTATATATATATCTGTATATTGCACAATTATAAACTCATTTT
5521 GCTTGTGGCTCCACACACACAAAAAAAGACCTGTTAAAATTATACCTGTTGCTTAATTACAATATTTCTGATAACCATAG
5601 CATAGGACAAGGGAAAATAAAAAAAGAAAAAAAAGAAAAAAAAACGACAAATCTGTCTGCTGGTCACTTCTTCTGTCCAA
5681 GCAGATTCGTGGTCTTTTCCTCGCTTCTTTCAAGGGCTTTCCTGTGCCAGGTGAAGGAGGCTCCAGGCAGCACCCAGGTT
5761 TTGCACTCTTGTTTCTCCCGTGCTTGTGAAAGAGGTCCCAAGGTTCTGGGTGCAGGAGCGCTCCCTTGACCTGCTGAAGT
5841 CCGGAACGTAGTCGGCACAGCCTGGTCGCCTTCCACCTCTGGGAGCTGGAGTCCACTGGGGTGGCCTGACTCCCCCAGTC
5921 CCCTTCCCGTGACCTGGTCAGGGTGAGCCCATGTGGAGTCAGCCTCGCAGGCCTCCCTGCCAGTAGGGTCCGAGTGTGTT
6001 TCATCCTTCCCACTCTGTCGAGCCTGGGGGCTGGAGCGGAGACGGGAGGCCTGGCCTGTCTCGGAACCTGTGAGCTGCAC
6081 CAGGTAGAACGCCAGGGACCCCAGAATCATGTGCGTCAGTCCAAGGGGTCCCCTCCAGGAGTAGTGAAGACTCCAGAAAT
6161 GTCCCTTTCTTCTCCCCCATCCTACGAGTAATTGCATTTGCTTTTGTAATTCTTAATGAGCAATATCTGCTAGAGAGTTT
6241 AGCTGTAACAGTTCTTTTTGATCATCTTTTTTTAATAATTAGAAACACCAAAAAAATCCAGAAACTTGTTCTTCCAAAGC
6321 AGAGAGCATTATAATCACCAGGGCCAAAAGCTTCCCTCCCTGCTGTCATTGCTTCTTCTGAGGCCTGAATCCAAAAGAAA
6401 AACAGCCATAGGCCCTTTCAGTGGCCGGGCTACCCGTGAGCCCTTCGGAGGACCAGGGCTGGGGCAGCCTCTGGGCCCAC
6481 ATCCGGGGCCAGCTCCGGCGTGTGTTCAGTGTTAGCAGTGGGTCATGATGCTCTTTCCCACCCAGCCTGGGATAGGGGCA
6561 GAGGAGGCGAGGAGGCCGTTGCCGCTGATGTTTGGCCGTGAACAGGTGGGTGTCTGCGTGCGTCCACGTGCGTGTTTTCT
6641 GACTGACATGAAATCGACGCCCGAGTTAGCCTCACCCGGTGACCTCTAGCCCTGCCCGGATGGAGCGGGGCCCACCCGGT
6721 TCAGTGTTTCTGGGGAGCTGGACAGTGGAGTGCAAAAGGCTTGCAGAACTTGAAGCCTGCTCCTTCCCTTGCTACCACGG
6801 CCTCCTTTCCGTTTGATTTGTCACTGCTTCAATCAATAACAGCCGCTCCAGAGTCAGTAGTCAATGAATATATGACCAAA
6881 TATCACCAGGACTGTTACTCAATGTGTGCCGAGCCCTTGCCCATGCTGGGCTCCCGTGTATCTGGACACTGTAACGTGTG
6961 CTGTGTTTGCTCCCCTTCCCCTTCCTTCTTTGCCCTTTACTTGTCTTTCTGGGGTTTTTCTGTTTGGGTTTGGTTTGGTT
7041 TTTATTTCTCCTTTTGTGTTCCAAACATGAGGTTCTCTCTACTGGTCCTCTTAACTGTGGTGTTGAGGCTTATATTTGTG
7121 TAATTTTTGGTGGGTGAAAGGAATTTTGCTAAGTAAATCTCTTCTGTGTTTGAACTGAAGTCTGTATTGTAACTATGTTT
7201 AAAGTAATTGTTCCAGAGACAAATATTTCTAGACACTTTTTCTTTACAAACAAAAGCATTCGGAGGGAGGGGGATGGTGA
7281 CTGAGATGAGAGGGGAGAGCTGAACAGATGACCCCTGCCCAGATCAGCCAGAAGCCACCCAAAGCAGTGGAGCCCAGGAG
7361 TCCCACTCCAAGCCAGCAAGCCGAATAGCTGATGTGTTGCCACTTTCCAAGTCACTGCAAAACCAGGTTTTGTTCCGCCC
7441 AGTGGATTCTTGTTTTGCTTCCCCTCCCCCCGAGATTATTACCACCATCCCGTGCTTTTAAGGAAAGGCAAGATTGATGT
7521 TTCCTTGAGGGGAGCCAGGAGGGGATGTGTGTGTGCAGAGCTGAAGAGCTGGGGAGAATGGGGCTGGGCCCACCCAAGCA
7601 GGAGGCTGGGACGCTCTGCTGTGGGCACAGGTCAGGCTAATGTTGGCAGATGCAGCTCTTCCTGGACAGGCCAGGTGGTG
7681 GGCATTCTCTCTCCAAGGTGTGCCCCGTGGGCATTACTGTTTAAGACACTTCCGTCACATCCCACCCCATCCTCCAGGGC
7761 TCAACACTGTGACATCTCTATTCCCCACCCTCCCCTTCCCAGGGCAATAAAATGACCATGGAGGGGGCTTGCACTCTCTT
7841 GGCTGTCACCCGATCGCCAGCAAAACTTAGATGTGAGAAAACCCCTTCCCATTCCATGGCGAAAACATCTCCTTAGAAAA
7921 GCCATTACCCTCATTAGGCATGGTTTTGGGCTCCCAAAACACCTGACAGCCCCTCCCTCCTCTGAGAGGCGGAGAGTGCT
8001 GACTGTAGTGACCATTGCATGCCGGGTGCAGCATCTGGAAGAGCTAGGCAGGGTGTCTGCCCCCTCCTGAGTTGAAGTCA
8081 TGCTCCCCTGTGCCAGCCCAGAGGCCGAGAGCTATGGACAGCATTGCCAGTAACACAGGCCACCCTGTGCAGAAGGGAGC
8161 TGGCTCCAGCCTGGAAACCTGTCTGAGGTTGGGAGAGGTGCACTTGGGGCACAGGGAGAGGCCGGGACACACTTAGCTGG
8241 AGATGTCTCTAAAAGCCCTGTATCGTATTCACCTTCAGTTTTTGTGTTTTGGGACAATTACTTTAGAAAATAAGTAGGTC
8321 GTTTTAAAAACAAAAATTATTGATTGCTTTTTTGTAGTGTTCAGAAAAAAGGTTCTTTGTGTATAGCCAAATGACTGAAA
8401 GCACTGATATATTTAAAAACAAAAGGCAATTTATTAAGGAAATTTGTACCATTTCAGTAAACCTGTCTGAATGTACCTGT
8481 ATACGTTTCAAAAACACCCCCCCCCCACTGAATCCCTGTAACCTATTTATTATATAAAGAGTTTGCCTTATAAATTT
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199a-5p :: MECP2    [ Functional MTI ]
Validation Method Microarray , Northern blot , Other
Original Description (Extracted from the article) ... UUsing these algorithms, we listed cancer-related mRNA targets of miRNA (Table 4). Especially, searching a candidate gene for miR-18, we picked up two candidates; connective tissue growth factor (CTGF) and receptor activator nuclear factor kappa B ligand (RANKL). ...

- Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al., 2006, Oncogene.

Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
24 hsa-miR-199a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003809 EZH2 enhancer of zeste homolog 2 (Drosophila) 2 1
MIRT003828 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 4 1
MIRT003963 CCNL1 cyclin L1 2 2
MIRT004325 LIF leukemia inhibitory factor (cholinergic differentiation factor) 2 1
MIRT004391 JUNB jun B proto-oncogene 2 1
MIRT004393 MED6 mediator complex subunit 6 2 1
MIRT004395 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT004398 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 2 1
MIRT004674 DDR1 discoidin domain receptor tyrosine kinase 1 3 1
MIRT005432 EDN1 endothelin 1 2 1
MIRT005873 MAP3K11 mitogen-activated protein kinase kinase kinase 11 3 1
MIRT006138 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 3 1
MIRT006193 SOX9 SRY (sex determining region Y)-box 9 1 1
MIRT006561 SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 3 1
MIRT006786 CD44 CD44 molecule (Indian blood group) 1 1
MIRT006832 TMEM54 transmembrane protein 54 2 1
MIRT007013 SMAD4 SMAD family member 4 1 2
MIRT007036 SULT1E1 sulfotransferase family 1E, estrogen-preferring, member 1 1 1
MIRT007061 GPR78 G protein-coupled receptor 78 1 1
MIRT007265 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 1 1
MIRT007303 UNG uracil-DNA glycosylase 1 1
MIRT026024 ALOX5AP arachidonate 5-lipoxygenase-activating protein 1 1
MIRT035548 CAV1 caveolin 1, caveolae protein, 22kDa 1 1
MIRT052646 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 2 1