Accession ID: MIRT004396 [miRNA, hsa-miR-199b-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199bLinkOut: [miRBase ]
Synonyms MIRN199B, mir-199b, MIR199B
Description Homo sapiens miR-199b stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199b-3p
Mature Sequence 65| ACAGUAGUCUGCACAUUGGUUA |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199b-3p :: MECP2    [ Functional MTI ]
Validation Method Other
Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
77 hsa-miR-199b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004392 JUNB jun B proto-oncogene 1 1
MIRT004394 MED6 mediator complex subunit 6 1 1
MIRT004396 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT004397 CCNL1 cyclin L1 1 1
MIRT004399 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT004453 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT004514 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT004634 KRT7 keratin 7 1 1
MIRT057006 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT060357 UCK2 uridine-cytidine kinase 2 1 1
MIRT099169 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT101816 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT128859 KMT2A myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT177955 DDIT4 DNA-damage-inducible transcript 4 1 1
MIRT185224 ETNK1 ethanolamine kinase 1 1 1
MIRT264711 C11ORF57 chromosome 11 open reading frame 57 1 1
MIRT284091 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT408637 QKI QKI, KH domain containing, RNA binding 1 1
MIRT442567 CCDC59 coiled-coil domain containing 59 1 1
MIRT442902 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT448992 ARL15 ADP-ribosylation factor-like 15 1 1
MIRT450889 COL4A5 collagen, type IV, alpha 5 1 1
MIRT456424 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT461289 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 1
MIRT462874 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT466201 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT469344 RGMB RGM domain family, member B 1 1
MIRT470965 PKM pyruvate kinase, muscle 1 1
MIRT471602 PAQR5 progestin and adipoQ receptor family member V 1 9
MIRT472558 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT473448 MCOLN2 mucolipin 2 1 4
MIRT474143 LIN54 lin-54 homolog (C. elegans) 1 2
MIRT476748 FOXK2 forkhead box K2 1 1
MIRT478699 CSRP2 cysteine and glycine-rich protein 2 1 2
MIRT486960 HLA-B major histocompatibility complex, class I, B 1 1
MIRT491926 WNK2 WNK lysine deficient protein kinase 2 1 1
MIRT492120 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT493772 GNAS GNAS complex locus 1 1
MIRT495573 UNC5C unc-5 homolog C (C. elegans) 1 1
MIRT496526 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 1 1
MIRT497489 RGS17 regulator of G-protein signaling 17 1 1
MIRT499499 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT507638 CREBZF CREB/ATF bZIP transcription factor 1 3
MIRT531399 TMEM18 transmembrane protein 18 1 1
MIRT531449 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT533963 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT537186 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 2
MIRT540442 RBM43 RNA binding motif protein 43 1 1
MIRT543175 FICD FIC domain containing 1 1
MIRT543289 ZNF585B zinc finger protein 585B 1 1
MIRT546198 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT548052 GOLIM4 golgi integral membrane protein 4 1 1
MIRT548942 CDK17 cyclin-dependent kinase 17 1 1
MIRT552922 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT553305 TSPAN3 tetraspanin 3 1 1
MIRT553555 TMEM161B transmembrane protein 161B 1 1
MIRT553935 STC2 stanniocalcin 2 1 2
MIRT557867 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT558556 CSNK1A1 casein kinase 1, alpha 1 1 1
MIRT558787 CEP55 centrosomal protein 55kDa 1 1
MIRT559207 BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 1 1
MIRT560314 EFHD2 EF-hand domain family, member D2 1 1
MIRT568419 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT570377 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT570420 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT570453 TMEM189 transmembrane protein 189 1 1
MIRT613447 LUC7L2 LUC7-like 2 (S. cerevisiae) 1 2
MIRT614110 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 1 2
MIRT623041 OCIAD2 OCIA domain containing 2 1 1
MIRT632239 VTA1 Vps20-associated 1 homolog (S. cerevisiae) 1 1
MIRT632983 E2F2 E2F transcription factor 2 1 1
MIRT633318 LINC00346 long intergenic non-protein coding RNA 346 1 1
MIRT651153 ZNF384 zinc finger protein 384 1 1
MIRT696976 CCDC80 coiled-coil domain containing 80 1 1
MIRT699381 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 1
MIRT710555 PHF8 PHD finger protein 8 1 1
MIRT721556 FXN frataxin 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*