Accession ID: MIRT004396 [miRNA, hsa-miR-199b-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199bLinkOut: [miRBase ]
Synonyms MIRN199B, mir-199b, MIR199B
Description Homo sapiens miR-199b stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199b-3p
Mature Sequence 65| ACAGUAGUCUGCACAUUGGUUA |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MECP2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AUTSX3, DKFZp686A24160, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT
Description methyl CpG binding protein 2 (Rett syndrome)
Transcript NM_0049    LinkOut: [ RefSeq ]
Other Transcripts NM_0011107   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MECP2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MECP2
(miRNA target sites are highlighted)
>MECP2|NM_0049|3'UTR
   1 TGACTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCT
  81 CTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGT
 161 GGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAG
 241 CTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCAC
 321 CTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCCGTTTT
 401 CGGTGCCATCAGTGCCCCGTCTACAGCTCCCCCAGCTCCCCCCACCTCCCCCACTCCCAACCACGTTGGGACAGGGAGGT
 481 GTGAGGCAGGAGAGACAGTTGGATTCTTTAGAGAAGATGGATATGACCAGTGGCTATGGCCTGTGCGATCCCACCCGTGG
 561 TGGCTCAAGTCTGGCCCCACACCAGCCCCAATCCAAAACTGGCAAGGACGCTTCACAGGACAGGAAAGTGGCACCTGTCT
 641 GCTCCAGCTCTGGCATGGCTAGGAGGGGGGAGTCCCTTGAACTACTGGGTGTAGACTGGCCTGAACCACAGGAGAGGATG
 721 GCCCAGGGTGAGGTGGCATGGTCCATTCTCAAGGGACGTCCTCCAACGGGTGGCGCTAGAGGCCATGGAGGCAGTAGGAC
 801 AAGGTGCAGGCAGGCTGGCCTGGGGTCAGGCCGGGCAGAGCACAGCGGGGTGAGAGGGATTCCTAATCACTCAGAGCAGT
 881 CTGTGACTTAGTGGACAGGGGAGGGGGCAAAGGGGGAGGAGAAGAAAATGTTCTTCCAGTTACTTTCCAATTCTCCTTTA
 961 GGGACAGCTTAGAATTATTTGCACTATTGAGTCTTCATGTTCCCACTTCAAAACAAACAGATGCTCTGAGAGCAAACTGG
1041 CTTGAATTGGTGACATTTAGTCCCTCAAGCCACCAGATGTGACAGTGTTGAGAACTACCTGGATTTGTATATATACCTGC
1121 GCTTGTTTTAAAGTGGGCTCAGCACATAGGGTTCCCACGAAGCTCCGAAACTCTAAGTGTTTGCTGCAATTTTATAAGGA
1201 CTTCCTGATTGGTTTCTCTTCTCCCCTTCCATTTCTGCCTTTTGTTCATTTCATCCTTTCACTTCTTTCCCTTCCTCCGT
1281 CCTCCTCCTTCCTAGTTCATCCCTTCTCTTCCAGGCAGCCGCGGTGCCCAACCACACTTGTCGGCTCCAGTCCCCAGAAC
1361 TCTGCCTGCCCTTTGTCCTCCTGCTGCCAGTACCAGCCCCACCCTGTTTTGAGCCCTGAGGAGGCCTTGGGCTCTGCTGA
1441 GTCCGACCTGGCCTGTCTGTGAAGAGCAAGAGAGCAGCAAGGTCTTGCTCTCCTAGGTAGCCCCCTCTTCCCTGGTAAGA
1521 AAAAGCAAAAGGCATTTCCCACCCTGAACAACGAGCCTTTTCACCCTTCTACTCTAGAGAAGTGGACTGGAGGAGCTGGG
1601 CCCGATTTGGTAGTTGAGGAAAGCACAGAGGCCTCCTGTGGCCTGCCAGTCATCGAGTGGCCCAACAGGGGCTCCATGCC
1681 AGCCGACCTTGACCTCACTCAGAAGTCCAGAGTCTAGCGTAGTGCAGCAGGGCAGTAGCGGTACCAATGCAGAACTCCCA
1761 AGACCCGAGCTGGGACCAGTACCTGGGTCCCCAGCCCTTCCTCTGCTCCCCCTTTTCCCTCGGAGTTCTTCTTGAATGGC
1841 AATGTTTTGCTTTTGCTCGATGCAGACAGGGGGCCAGAACACCACACATTTCACTGTCTGTCTGGTCCATAGCTGTGGTG
1921 TAGGGGCTTAGAGGCATGGGCTTGCTGTGGGTTTTTAATTGATCAGTTTTCATGTGGGATCCCATCTTTTTAACCTCTGT
2001 TCAGGAAGTCCTTATCTAGCTGCATATCTTCATCATATTGGTATATCCTTTTCTGTGTTTACAGAGATGTCTCTTATATC
2081 TAAATCTGTCCAACTGAGAAGTACCTTATCAAAGTAGCAAATGAGACAGCAGTCTTATGCTTCCAGAAACACCCACAGGC
2161 ATGTCCCATGTGAGCTGCTGCCATGAACTGTCAAGTGTGTGTTGTCTTGTGTATTTCAGTTATTGTCCCTGGCTTCCTTA
2241 CTATGGTGTAATCATGAAGGAGTGAAACATCATAGAAACTGTCTAGCACTTCCTTGCCAGTCTTTAGTGATCAGGAACCA
2321 TAGTTGACAGTTCCAATCAGTAGCTTAAGAAAAAACCGTGTTTGTCTCTTCTGGAATGGTTAGAAGTGAGGGAGTTTGCC
2401 CCGTTCTGTTTGTAGAGTCTCATAGTTGGACTTTCTAGCATATATGTGTCCATTTCCTTATGCTGTAAAAGCAAGTCCTG
2481 CAACCAAACTCCCATCAGCCCAATCCCTGATCCCTGATCCCTTCCACCTGCTCTGCTGATGACCCCCCCAGCTTCACTTC
2561 TGACTCTTCCCCAGGAAGGGAAGGGGGGTCAGAAGAGAGGGTGAGTCCTCCAGAACTCTTCCTCCAAGGACAGAAGGCTC
2641 CTGCCCCCATAGTGGCCTCGAACTCCTGGCACTACCAAAGGACACTTATCCACGAGAGCGCAGCATCCGACCAGGTTGTC
2721 ACTGAGAAGATGTTTATTTTGGTCAGTTGGGTTTTTATGTATTATACTTAGTCAAATGTAATGTGGCTTCTGGAATCATT
2801 GTCCAGAGCTGCTTCCCCGTCACCTGGGCGTCATCTGGTCCTGGTAAGAGGAGTGCGTGGCCCACCAGGCCCCCCTGTCA
2881 CCCATGACAGTTCATTCAGGGCCGATGGGGCAGTCGTGGTTGGGAACACAGCATTTCAAGCGTCACTTTATTTCATTCGG
2961 GCCCCACCTGCAGCTCCCTCAAAGAGGCAGTTGCCCAGCCTCTTTCCCTTCCAGTTTATTCCAGAGCTGCCAGTGGGGCC
3041 TGAGGCTCCTTAGGGTTTTCTCTCTATTTCCCCCTTTCTTCCTCATTCCCTCGTCTTTCCCAAAGGCATCACGAGTCAGT
3121 CGCCTTTCAGCAGGCAGCCTTGGCGGTTTATCGCCCTGGCAGGCAGGGGCCCTGCAGCTCTCATGCTGCCCCTGCCTTGG
3201 GGTCAGGTTGACAGGAGGTTGGAGGGAAAGCCTTAAGCTGCAGGATTCTCACCAGCTGTGTCCGGCCCAGTTTTGGGGTG
3281 TGACCTCAATTTCAATTTTGTCTGTACTTGAACATTATGAAGATGGGGGCCTCTTTCAGTGAATTTGTGAACAGCAGAAT
3361 TGACCGACAGCTTTCCAGTACCCATGGGGCTAGGTCATTAAGGCCACATCCACAGTCTCCCCCACCCTTGTTCCAGTTGT
3441 TAGTTACTACCTCCTCTCCTGACAATACTGTATGTCGTCGAGCTCCCCCCAGGTCTACCCCTCCCGGCCCTGCCTGCTGG
3521 TGGGCTTGTCATAGCCAGTGGGATTGCCGGTCTTGACAGCTCAGTGAGCTGGAGATACTTGGTCACAGCCAGGCGCTAGC
3601 ACAGCTCCCTTCTGTTGATGCTGTATTCCCATATCAAAAGACACAGGGGACACCCAGAAACGCCACATCCCCCAATCCAT
3681 CAGTGCCAAACTAGCCAACGGCCCCAGCTTCTCAGCTCGCTGGATGGCGGAAGCTGCTACTCGTGAGCGCCAGTGCGGGT
3761 GCAGACAATCTTCTGTTGGGTGGCATCATTCCAGGCCCGAAGCATGAACAGTGCACCTGGGACAGGGAGCAGCCCCAAAT
3841 TGTCACCTGCTTCTCTGCCCAGCTTTTCATTGCTGTGACAGTGATGGCGAAAGAGGGTAATAACCAGACACAAACTGCCA
3921 AGTTGGGTGGAGAAAGGAGTTTCTTTAGCTGACAGAATCTCTGAATTTTAAATCACTTAGTAAGCGGCTCAAGCCCAGGA
4001 GGGAGCAGAGGGATACGAGCGGAGTCCCCTGCGCGGGACCATCTGGAATTGGTTTAGCCCAAGTGGAGCCTGACAGCCAG
4081 AACTCTGTGTCCCCCGTCTAACCACAGCTCCTTTTCCAGAGCATTCCAGTCAGGCTCTCTGGGCTGACTGGGCCAGGGGA
4161 GGTTACAGGTACCAGTTCTTTAAGAAGATCTTTGGGCATATACATTTTTAGCCTGTGTCATTGCCCCAAATGGATTCCTG
4241 TTTCAAGTTCACACCTGCAGATTCTAGGACCTGTGTCCTAGACTTCAGGGAGTCAGCTGTTTCTAGAGTTCCTACCATGG
4321 AGTGGGTCTGGAGGACCTGCCCGGTGGGGGGGCAGAGCCCTGCTCCCTCCGGGTCTTCCTACTCTTCTCTCTGCTCTGAC
4401 GGGATTTGTTGATTCTCTCCATTTTGGTGTCTTTCTCTTTTAGATATTGTATCAATCTTTAGAAAAGGCATAGTCTACTT
4481 GTTATAAATCGTTAGGATACTGCCTCCCCCAGGGTCTAAAATTACATATTAGAGGGGAAAAGCTGAACACTGAAGTCAGT
4561 TCTCAACAATTTAGAAGGAAAACCTAGAAAACATTTGGCAGAAAATTACATTTCGATGTTTTTGAATGAATACGAGCAAG
4641 CTTTTACAACAGTGCTGATCTAAAAATACTTAGCACTTGGCCTGAGATGCCTGGTGAGCATTACAGGCAAGGGGAATCTG
4721 GAGGTAGCCGACCTGAGGACATGGCTTCTGAACCTGTCTTTTGGGAGTGGTATGGAAGGTGGAGCGTTCACCAGTGACCT
4801 GGAAGGCCCAGCACCACCCTCCTTCCCACTCTTCTCATCTTGACAGAGCCTGCCCCAGCGCTGACGTGTCAGGAAAACAC
4881 CCAGGGAACTAGGAAGGCACTTCTGCCTGAGGGGCAGCCTGCCTTGCCCACTCCTGCTCTGCTCGCCTCGGATCAGCTGA
4961 GCCTTCTGAGCTGGCCTCTCACTGCCTCCCCAAGGCCCCCTGCCTGCCCTGTCAGGAGGCAGAAGGAAGCAGGTGTGAGG
5041 GCAGTGCAAGGAGGGAGCACAACCCCCAGCTCCCGCTCCGGGCTCCGACTTGTGCACAGGCAGAGCCCAGACCCTGGAGG
5121 AAATCCTACCTTTGAATTCAAGAACATTTGGGGAATTTGGAAATCTCTTTGCCCCCAAACCCCCATTCTGTCCTACCTTT
5201 AATCAGGTCCTGCTCAGCAGTGAGAGCAGATGAGGTGAAAAGGCCAAGAGGTTTGGCTCCTGCCCACTGATAGCCCCTCT
5281 CCCCGCAGTGTTTGTGTGTCAAGTGGCAAAGCTGTTCTTCCTGGTGACCCTGATTATATCCAGTAACACATAGACTGTGC
5361 GCATAGGCCTGCTTTGTCTCCTCTATCCTGGGCTTTTGTTTTGCTTTTTAGTTTTGCTTTTAGTTTTTCTGTCCCTTTTA
5441 TTTAACGCACCGACTAGACACACAAAGCAGTTGAATTTTTATATATATATCTGTATATTGCACAATTATAAACTCATTTT
5521 GCTTGTGGCTCCACACACACAAAAAAAGACCTGTTAAAATTATACCTGTTGCTTAATTACAATATTTCTGATAACCATAG
5601 CATAGGACAAGGGAAAATAAAAAAAGAAAAAAAAGAAAAAAAAACGACAAATCTGTCTGCTGGTCACTTCTTCTGTCCAA
5681 GCAGATTCGTGGTCTTTTCCTCGCTTCTTTCAAGGGCTTTCCTGTGCCAGGTGAAGGAGGCTCCAGGCAGCACCCAGGTT
5761 TTGCACTCTTGTTTCTCCCGTGCTTGTGAAAGAGGTCCCAAGGTTCTGGGTGCAGGAGCGCTCCCTTGACCTGCTGAAGT
5841 CCGGAACGTAGTCGGCACAGCCTGGTCGCCTTCCACCTCTGGGAGCTGGAGTCCACTGGGGTGGCCTGACTCCCCCAGTC
5921 CCCTTCCCGTGACCTGGTCAGGGTGAGCCCATGTGGAGTCAGCCTCGCAGGCCTCCCTGCCAGTAGGGTCCGAGTGTGTT
6001 TCATCCTTCCCACTCTGTCGAGCCTGGGGGCTGGAGCGGAGACGGGAGGCCTGGCCTGTCTCGGAACCTGTGAGCTGCAC
6081 CAGGTAGAACGCCAGGGACCCCAGAATCATGTGCGTCAGTCCAAGGGGTCCCCTCCAGGAGTAGTGAAGACTCCAGAAAT
6161 GTCCCTTTCTTCTCCCCCATCCTACGAGTAATTGCATTTGCTTTTGTAATTCTTAATGAGCAATATCTGCTAGAGAGTTT
6241 AGCTGTAACAGTTCTTTTTGATCATCTTTTTTTAATAATTAGAAACACCAAAAAAATCCAGAAACTTGTTCTTCCAAAGC
6321 AGAGAGCATTATAATCACCAGGGCCAAAAGCTTCCCTCCCTGCTGTCATTGCTTCTTCTGAGGCCTGAATCCAAAAGAAA
6401 AACAGCCATAGGCCCTTTCAGTGGCCGGGCTACCCGTGAGCCCTTCGGAGGACCAGGGCTGGGGCAGCCTCTGGGCCCAC
6481 ATCCGGGGCCAGCTCCGGCGTGTGTTCAGTGTTAGCAGTGGGTCATGATGCTCTTTCCCACCCAGCCTGGGATAGGGGCA
6561 GAGGAGGCGAGGAGGCCGTTGCCGCTGATGTTTGGCCGTGAACAGGTGGGTGTCTGCGTGCGTCCACGTGCGTGTTTTCT
6641 GACTGACATGAAATCGACGCCCGAGTTAGCCTCACCCGGTGACCTCTAGCCCTGCCCGGATGGAGCGGGGCCCACCCGGT
6721 TCAGTGTTTCTGGGGAGCTGGACAGTGGAGTGCAAAAGGCTTGCAGAACTTGAAGCCTGCTCCTTCCCTTGCTACCACGG
6801 CCTCCTTTCCGTTTGATTTGTCACTGCTTCAATCAATAACAGCCGCTCCAGAGTCAGTAGTCAATGAATATATGACCAAA
6881 TATCACCAGGACTGTTACTCAATGTGTGCCGAGCCCTTGCCCATGCTGGGCTCCCGTGTATCTGGACACTGTAACGTGTG
6961 CTGTGTTTGCTCCCCTTCCCCTTCCTTCTTTGCCCTTTACTTGTCTTTCTGGGGTTTTTCTGTTTGGGTTTGGTTTGGTT
7041 TTTATTTCTCCTTTTGTGTTCCAAACATGAGGTTCTCTCTACTGGTCCTCTTAACTGTGGTGTTGAGGCTTATATTTGTG
7121 TAATTTTTGGTGGGTGAAAGGAATTTTGCTAAGTAAATCTCTTCTGTGTTTGAACTGAAGTCTGTATTGTAACTATGTTT
7201 AAAGTAATTGTTCCAGAGACAAATATTTCTAGACACTTTTTCTTTACAAACAAAAGCATTCGGAGGGAGGGGGATGGTGA
7281 CTGAGATGAGAGGGGAGAGCTGAACAGATGACCCCTGCCCAGATCAGCCAGAAGCCACCCAAAGCAGTGGAGCCCAGGAG
7361 TCCCACTCCAAGCCAGCAAGCCGAATAGCTGATGTGTTGCCACTTTCCAAGTCACTGCAAAACCAGGTTTTGTTCCGCCC
7441 AGTGGATTCTTGTTTTGCTTCCCCTCCCCCCGAGATTATTACCACCATCCCGTGCTTTTAAGGAAAGGCAAGATTGATGT
7521 TTCCTTGAGGGGAGCCAGGAGGGGATGTGTGTGTGCAGAGCTGAAGAGCTGGGGAGAATGGGGCTGGGCCCACCCAAGCA
7601 GGAGGCTGGGACGCTCTGCTGTGGGCACAGGTCAGGCTAATGTTGGCAGATGCAGCTCTTCCTGGACAGGCCAGGTGGTG
7681 GGCATTCTCTCTCCAAGGTGTGCCCCGTGGGCATTACTGTTTAAGACACTTCCGTCACATCCCACCCCATCCTCCAGGGC
7761 TCAACACTGTGACATCTCTATTCCCCACCCTCCCCTTCCCAGGGCAATAAAATGACCATGGAGGGGGCTTGCACTCTCTT
7841 GGCTGTCACCCGATCGCCAGCAAAACTTAGATGTGAGAAAACCCCTTCCCATTCCATGGCGAAAACATCTCCTTAGAAAA
7921 GCCATTACCCTCATTAGGCATGGTTTTGGGCTCCCAAAACACCTGACAGCCCCTCCCTCCTCTGAGAGGCGGAGAGTGCT
8001 GACTGTAGTGACCATTGCATGCCGGGTGCAGCATCTGGAAGAGCTAGGCAGGGTGTCTGCCCCCTCCTGAGTTGAAGTCA
8081 TGCTCCCCTGTGCCAGCCCAGAGGCCGAGAGCTATGGACAGCATTGCCAGTAACACAGGCCACCCTGTGCAGAAGGGAGC
8161 TGGCTCCAGCCTGGAAACCTGTCTGAGGTTGGGAGAGGTGCACTTGGGGCACAGGGAGAGGCCGGGACACACTTAGCTGG
8241 AGATGTCTCTAAAAGCCCTGTATCGTATTCACCTTCAGTTTTTGTGTTTTGGGACAATTACTTTAGAAAATAAGTAGGTC
8321 GTTTTAAAAACAAAAATTATTGATTGCTTTTTTGTAGTGTTCAGAAAAAAGGTTCTTTGTGTATAGCCAAATGACTGAAA
8401 GCACTGATATATTTAAAAACAAAAGGCAATTTATTAAGGAAATTTGTACCATTTCAGTAAACCTGTCTGAATGTACCTGT
8481 ATACGTTTCAAAAACACCCCCCCCCCACTGAATCCCTGTAACCTATTTATTATATAAAGAGTTTGCCTTATAAATTT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' auUGGUU----AC-ACGUC--UGAUGACa 5'
            | |||    || |||||  ||||||| 
Target 5' tcAACAAGGCTTGCTGCAGATACTACTGa 3'
268 - 296 160.00 -14.70
2
miRNA  3' auugguuacacgucUGAUGACa 5'
                        ||||||| 
Target 5' ggggagtcccttgaACTACTGg 3'
667 - 688 140.00 -10.60
3
miRNA  3' auuGGUU--ACACG------UC-UGAUGACa 5'
             ||||  |||||      :| |:||||| 
Target 5' tctCCAAGGTGTGCCCCGTGGGCATTACTGt 3'
7690 - 7720 139.00 -18.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199b-3p :: MECP2    [ Functional MTI ]
Validation Method Other
Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
8 hsa-miR-199b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004392 JUNB jun B proto-oncogene 1 1
MIRT004394 MED6 mediator complex subunit 6 1 1
MIRT004396 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT004397 CCNL1 cyclin L1 1 1
MIRT004399 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT004453 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT004514 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT004634 KRT7 keratin 7 1 1