Accession ID: MIRT004396 [miRNA, hsa-miR-199b-3p :: MECP2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-199bLinkOut: [miRBase ]
Synonyms MIRN199B, mir-199b, MIR199B
Description Homo sapiens miR-199b stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-199b-3p
Mature Sequence 65| ACAGUAGUCUGCACAUUGGUUA |86
Evidence Experimental
Experiments Cloned
Putative hsa-miR-199b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-199b-3p :: MECP2    [ Functional MTI ]
Validation Method Other
Article - Murakami, Y. Yasuda, T. Saigo, K. Urashima, et al.
- Oncogene, 2006
MicroRNAs (miRNAs) are a non-coding family of genes involved in post-transcriptional gene regulation. These transcripts are associated with cell proliferation, cell differentiation, cell death and carcinogenesis. We analysed the miRNA expression profiles in 25 pairs of hepatocellular carcinoma (HCC) and adjacent non-tumorous tissue (NT) and nine additional chronic hepatitis (CH) specimens using a human miRNA microarray. Targets and references samples were co-hybridized to a microarray containing whole human mature and precursor miRNA sequences. Whereas three miRNAs exhibited higher expression in the HCC samples than that in the NT samples, five miRNAs demonstrated lower expression in the HCC samples than in the NT samples (P<0.0001). Classification of samples as HCC or NT by using support vector machine algorithms based on these data provided an overall prediction accuracy of 97.8% (45/46). In addition, the expression levels of four miRNAs were inversely correlated with the degree of HCC differentiation (P<0.01). A comparison of CH and liver cirrhosis samples revealed significantly different pattern of miRNA expression (P<0.01). There were no differences, however, between hepatitis B-positive and hepatitis C-positive samples. This information may help clarify the molecular mechanisms involved in the progression of liver disease, potentially serving as a diagnostic tool of HCC.
LinkOut: [PMID: 16331254]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
8 hsa-miR-199b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004392 JUNB jun B proto-oncogene 1 1
MIRT004394 MED6 mediator complex subunit 6 1 1
MIRT004396 MECP2 methyl CpG binding protein 2 (Rett syndrome) 1 1
MIRT004397 CCNL1 cyclin L1 1 1
MIRT004399 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1 1
MIRT004453 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT004514 MET met proto-oncogene (hepatocyte growth factor receptor) 1 1
MIRT004634 KRT7 keratin 7 1 1