Accession ID: MIRT004409 [miRNA, hsa-miR-146a-5p :: IL8, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-146aLinkOut: [miRBase ]
Synonyms MIRN146, MIRN146A, miR-146a, miRNA146A, MIR146A
Description Homo sapiens miR-146a stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-146a-5p
Mature Sequence 21| UGAGAACUGAAUUCCAUGGGUU |42
Evidence Experimental
Experiments Cloned
Putative hsa-miR-146a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL8 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CXCL8, GCP-1, GCP1, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1
Description interleukin 8
Transcript NM_0005    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL8 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL8
(miRNA target sites are highlighted)
>IL8|NM_0005|3'UTR
   1 TAAAAAAATTCATTCTCTGTGGTATCCAAGAATCAGTGAAGATGCCAGTGAAACTTCAAGCAAATCTACTTCAACACTTC
  81 ATGTATTGTGTGGGTCTGTTGTAGGGTTGCCAGATGCAATACAAGATTCCTGGTTAAATTTGAATTTCAGTAAACAATGA
 161 ATAGTTTTTCATTGTACCATGAAATATCCAGAACATACTTATATGTAAAGTATTATTTATTTGAATCTACAAAAAACAAC
 241 AAATAATTTTTAAATATAAGGATTTTCCTAGATATTGCACGGGAGAATATACAAATAGCAAAATTGAGGCCAAGGGCCAA
 321 GAGAATATCCGAACTTTAATTTCAGGAATTGAATGGGTTTGCTAGAATGTGATATTTGAAGCATCACATAAAAATGATGG
 401 GACAATAAATTTTGCCATAAAGTCAAATTTAGCTGGAAATCCTGGATTTTTTTCTGTTAAATCTGGCAACCCTAGTCTGC
 481 TAGCCAGGATCCACAAGTCCTTGTTCCACTGTGCCTTGGTTTCTCCTTTATTTCTAAGTGGAAAAAGTATTAGCCACCAT
 561 CTTACCTCACAGTGATGTTGTGAGGACATGTGGAAGCACTTTAAGTTTTTTCATCATAACATAAATTATTTTCAAGTGTA
 641 ACTTATTAACCTATTTATTATTTATGTATTTATTTAAGCATCAAATATTTGTGCAAGAATTTGGAAAAATAGAAGATGAA
 721 TCATTGATTGAATAGTTATAAAGATGTTATAGTAAATTTATTTTATTTTAGATATTAAATGATGTTTTATTAGATAAATT
 801 TCAATCAGGGTTTTTAGATTAAACAAACAAACAATTGGGTACCCAGTTAAATTTTCATTTCAGATAAACAACAAATAATT
 881 TTTTAGTATAAGTACATTATTGTTTATCTGAAATTTTAATTGAACTAACAATCCTAGTTTGATACTCCCAGTCTTGTCAT
 961 TGCCAGCTGTGTTGGTAGTGCTGTGTTGAATTACGGAATAATGAGTTAGAACTATTAAAACAGCCAAAACTCCACAGTCA
1041 ATATTAGTAATTTCTTGCTGGTTGAAACTTGTTTATTATGTACAAATAGATTCTTATAATATTATTTAAATGACTGCATT
1121 TTTAAATACAAGGCTTTATATTTTTAACTTTAAGATGTTTTTATGTGCTCTCCAAATTTTTTTTACTGTTTCTGATTGTA
1201 TGGAAATATAAAAGTAAATATGAAACATTTAAAATATAATTTGTTGTCAAAGTAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGGGUACCUU-----AAGUCAAGAGu 5'
            | ::|||||     || ||||:|: 
Target 5' gaCATGTGGAAGCACTTTAAGTTTTTt 3'
585 - 611 128.00 -10.90
2
miRNA  3' uuggGUACCUUAAGUCAAGAGu 5'
              ||  ||||  ||||:|: 
Target 5' taaaCAATGAAT--AGTTTTTc 3'
151 - 170 122.00 -5.20
3
miRNA  3' uuggguaccUUAAGUCAAGAGu 5'
                   |||||| ||||| 
Target 5' ---taaaaaAATTCA-TTCTCt 3'
1 - 18 113.00 -7.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-146a-5p :: IL8    [ Functional MTI ]
Validation Method Western blot , Northern blot
Conditions MDA-MB-231
Original Description (Extracted from the article) ... These ļ¬ndings implicate miR-146a/b as a negative regulator of constitutive NF-kB activity in a breast cancer setting and suggest that modulating miR-146a/b levels has therapeutic potential to suppress breast cancer metastases.//Although this observed reduction in MDA-MB invasiveness likely derives in large part from miR-146a/b-targeted suppression of the upstream NF-kB signaling proteins IRAK1 and TRAF6 ...

- Bhaumik, D. Scott, G. K. Schokrpur, S. et al., 2008, Oncogene.

Article - Bhaumik, D. Scott, G. K. Schokrpur, S. et al.
- Oncogene, 2008
Cancer cells often acquire a constitutively active nuclear factor-kappaB (NF-kappaB) program to promote survival, proliferation and metastatic potential by mechanisms that remain largely unknown. Extending observations from an immunologic setting, we demonstrate that microRNA-146a and microRNA-146b (miR-146a/b) when expressed in the highly metastatic human breast cancer cell line MDA-MB-231 function to negatively regulate NF-kappaB activity. Lentiviral-mediated expression of miR-146a/b significantly downregulated interleukin (IL)-1 receptor-associated kinase and TNF receptor-associated factor 6, two key adaptor/scaffold proteins in the IL-1 and Toll-like receptor signaling pathway, known to positively regulate NF-kappaB activity. Impaired NF-kappaB activity was evident from reduced phosphorylation of the NF-kappaB inhibitor IkappaBalpha, reduced NF-kappaB DNA-binding activity and suppressed expression of the NF-kappaB target genes IL-8, IL-6 and matrix metalloproteinase-9. Functionally, miR-146a/b-expressing MDA-MB-231 cells showed markedly impaired invasion and migration capacity relative to control cells. These findings implicate miR-146a/b as a negative regulator of constitutive NF-kappaB activity in a breast cancer setting and suggest that modulating miR-146a/b levels has therapeutic potential to suppress breast cancer metastases.Oncogene advance online publication, 26 May 2008; doi:10.1038/onc.2008.171.
LinkOut: [PMID: 18504431]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-146a-5p :: IL8    [ Functional MTI ]
Validation Method Other
Article - Hou, J. Wang, P. Lin, L. Liu, X. Ma, F. An, et al.
- J Immunol, 2009
Upon recognition of viral components by pattern recognition receptors, including TLRs and retinoic acid-inducible gene I (RIG-I)- like helicases, cells are activated to produce type I IFN and proinflammatory cytokines. These pathways are tightly regulated by host to prevent inappropriate cellular response, but viruses can down-regulate these pathways for their survival. Recently, identification of negative regulators for cytoplasmic RNA-mediated antiviral signaling, especially the RIG-I pathway, attract much attention. However, there is no report about negative regulation of RIG-I antiviral pathway by microRNAs (miRNA) to date. We found that vesicular stomatitis virus (VSV) infection up-regulated miR-146a expression in mouse macrophages in TLR-myeloid differentiation factor 88-independent but RIG-I-NF-kappaB-dependent manner. In turn, miR-146a negatively regulated VSV-triggered type I IFN production, thus promoting VSV replication in macrophages. In addition to two known miR-146a targets, TRAF6 and IRAK1, we proved that IRAK2 was another target of miR-146a, which also participated in VSV-induced type I IFN production. Furthermore, IRAK1 and IRAK2 participated in VSV-induced type I IFN production by associating with Fas-associated death domain protein, an important adaptor in RIG-I signaling, in a VSV infection-inducible manner. Therefore, we demonstrate that miR-146a, up-regulated during viral infection, is a negative regulator of the RIG-I-dependent antiviral pathway by targeting TRAF6, IRAK1, and IRAK2.
LinkOut: [PMID: 19596990]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-146a-5p :: IL8    [ Functional MTI ]
Validation Method Microarray
Article - Li, Y. Vandenboom, T. G., 2nd Wang, Z. et al.
- Cancer Res, 2010
The aggressive course of pancreatic cancer is believed to reflect its unusually invasive and metastatic nature, which is associated with epidermal growth factor receptor (EGFR) overexpression and NF-kappaB activation. MicroRNAs (miRNA) have been implicated in the regulation of various pathobiological processes in cancer, including metastasis in pancreatic cancer and in other human malignancies. In this study, we report lower expression of miR-146a in pancreatic cancer cells compared with normal human pancreatic duct epithelial cells. Reexpression of miR-146a inhibited the invasive capacity of pancreatic cancer cells with concomitant downregulation of EGFR and the NF-kappaB regulatory kinase interleukin 1 receptor-associated kinase 1 (IRAK-1). Cellular mechanism studies revealed crosstalk between EGFR, IRAK-1, IkappaBalpha, NF-kappaB, and MTA-2, a transcription factor that regulates metastasis. Treatment of pancreatic cancer cells with the natural products 3,3'-diinodolylmethane (DIM) or isoflavone, which increased miR-146a expression, caused a downregulation of EGFR, MTA-2, IRAK-1, and NF-kappaB, resulting in an inhibition of pancreatic cancer cell invasion. Our findings reveal DIM and isoflavone as nontoxic activators of a miRNA that can block pancreatic cancer cell invasion and metastasis, offering starting points to design novel anticancer agents.
LinkOut: [PMID: 20124483]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
97 hsa-miR-146a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000006 CXCR4 chemokine (C-X-C motif) receptor 4 5 2
MIRT000301 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1 1
MIRT000303 CFH complement factor H 2 3
MIRT000304 IRAK2 interleukin-1 receptor-associated kinase 2 3 2
MIRT000449 TLR2 toll-like receptor 2 4 1
MIRT000638 FADD Fas (TNFRSF6)-associated via death domain 2 1
MIRT000711 TRAF6 TNF receptor-associated factor 6 5 13
MIRT000712 IRAK1 interleukin-1 receptor-associated kinase 1 5 11
MIRT000945 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 3 1
MIRT001919 BRCA2 breast cancer 2, early onset 2 1
MIRT001920 BRCA1 breast cancer 1, early onset 5 2
MIRT003319 FAF1 Fas (TNFRSF6) associated factor 1 3 1
MIRT004017 CCNA2 cyclin A2 4 2
MIRT004018 PA2G4 proliferation-associated 2G4, 38kDa 4 2
MIRT004249 SNAP25 synaptosomal-associated protein, 25kDa 1 1
MIRT004409 IL8 interleukin 8 3 3
MIRT004459 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 5 3
MIRT004661 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT004730 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 4 4
MIRT004731 MTA2 metastasis associated 1 family, member 2 3 1
MIRT005463 CD40LG CD40 ligand 4 1
MIRT005581 FAS Fas (TNF receptor superfamily, member 6) 3 1
MIRT005705 CDKN3 cyclin-dependent kinase inhibitor 3 2 1
MIRT005706 KIF22 kinesin family member 22 2 1
MIRT005806 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 3 1
MIRT006209 SMAD4 SMAD family member 4 4 2
MIRT006530 TLR4 toll-like receptor 4 4 1
MIRT007243 WASF2 WAS protein family, member 2 1 1
MIRT021214 NFIX nuclear factor I/X (CCAAT-binding transcription factor) 1 1
MIRT021215 IRF7 interferon regulatory factor 7 1 1
MIRT021216 RAD54L RAD54-like (S. cerevisiae) 1 1
MIRT021217 PPP1R1C protein phosphatase 1, regulatory (inhibitor) subunit 1C 1 1
MIRT021218 TRIM14 tripartite motif-containing 14 1 1
MIRT021219 TMSB15A thymosin beta 15a 1 1
MIRT021220 ITGB2 integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) 1 1
MIRT021221 SNTG2 syntrophin, gamma 2 1 1
MIRT021222 RSAD2 radical S-adenosyl methionine domain containing 2 1 1
MIRT021223 TIMELESS timeless homolog (Drosophila) 1 1
MIRT021224 PRR15 proline rich 15 1 1
MIRT021225 PEX11G peroxisomal biogenesis factor 11 gamma 1 1
MIRT021226 PLEKHA4 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 1 1
MIRT021227 BGLAP bone gamma-carboxyglutamate (gla) protein 1 1
MIRT021228 SYT12 synaptotagmin XII 1 1
MIRT021229 STAT1 signal transducer and activator of transcription 1, 91kDa 1 1
MIRT021230 LMO2 LIM domain only 2 (rhombotin-like 1) 1 2
MIRT021231 CD83 CD83 molecule 1 1
MIRT021232 IFIT1 interferon-induced protein with tetratricopeptide repeats 1 1 1
MIRT021233 IFITM1 interferon induced transmembrane protein 1 (9-27) 1 1
MIRT021234 OLFML2A olfactomedin-like 2A 1 1
MIRT021235 ISG15 ISG15 ubiquitin-like modifier 1 1
MIRT021236 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT021237 IFITM3 interferon induced transmembrane protein 3 (1-8U) 1 1
MIRT021238 RGS13 regulator of G-protein signaling 13 1 1
MIRT021239 CCL8 chemokine (C-C motif) ligand 8 1 1
MIRT021240 MTUS2 microtubule associated tumor suppressor candidate 2 1 1
MIRT021241 BLMH bleomycin hydrolase 1 1
MIRT021242 MCPH1 microcephalin 1 1 1
MIRT021243 NMI N-myc (and STAT) interactor 1 1
MIRT021244 HSPA1A heat shock 70kDa protein 1A 1 1
MIRT021245 TRIM22 tripartite motif-containing 22 1 1
MIRT021246 ITGBL1 integrin, beta-like 1 (with EGF-like repeat domains) 1 1
MIRT021247 SPATS2L spermatogenesis associated, serine-rich 2-like 1 1
MIRT021248 POLE2 polymerase (DNA directed), epsilon 2 (p59 subunit) 1 1
MIRT021249 IFI44 interferon-induced protein 44 1 1
MIRT021250 OASL 2'-5'-oligoadenylate synthetase-like 1 1
MIRT021251 LTB lymphotoxin beta (TNF superfamily, member 3) 1 1
MIRT021252 PBLD phenazine biosynthesis-like protein domain containing 1 1
MIRT021253 IFI44L interferon-induced protein 44-like 1 1
MIRT021254 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT021255 MR1 major histocompatibility complex, class I-related 1 1
MIRT021256 IFI27 interferon, alpha-inducible protein 27 1 1
MIRT021257 TBP TATA box binding protein 1 1
MIRT021258 ELL3 elongation factor RNA polymerase II-like 3 1 1
MIRT021259 METTL7A methyltransferase like 7A 1 1
MIRT021260 MCM10 minichromosome maintenance complex component 10 1 1
MIRT021261 LINC00304 chromosome 16 open reading frame 81 1 1
MIRT021262 SDCBP2 syndecan binding protein (syntenin) 2 1 1
MIRT021263 STON2 stonin 2 1 1
MIRT021264 BCL2A1 BCL2-related protein A1 1 1
MIRT021265 COL13A1 collagen, type XIII, alpha 1 1 1
MIRT021266 IRF5 interferon regulatory factor 5 1 1
MIRT021267 MX2 myxovirus (influenza virus) resistance 2 (mouse) 1 1
MIRT021268 VWCE von Willebrand factor C and EGF domains 1 1
MIRT021269 EPSTI1 epithelial stromal interaction 1 (breast) 1 1
MIRT021270 OSBPL1A oxysterol binding protein-like 1A 1 1
MIRT021271 CD86 CD86 molecule 1 1
MIRT021272 IFIT5 interferon-induced protein with tetratricopeptide repeats 5 1 1
MIRT021273 C1orf21 chromosome 1 open reading frame 21 1 1
MIRT021274 GIMAP4 GTPase, IMAP family member 4 1 1
MIRT021275 CCR9 chemokine (C-C motif) receptor 9 1 1
MIRT021276 SAMD9L sterile alpha motif domain containing 9-like 1 1
MIRT021277 IFIT3 interferon-induced protein with tetratricopeptide repeats 3 1 1
MIRT021278 CD80 CD80 molecule 1 1
MIRT021279 SPP1 secreted phosphoprotein 1 1 1
MIRT021280 SLPI secretory leukocyte peptidase inhibitor 2 1
MIRT035533 L1CAM L1 cell adhesion molecule 1 1
MIRT045694 MSC musculin 1 1