Accession ID: MIRT004417 [miRNA, hsa-miR-128-3p :: CDKN1B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-128-1LinkOut: [miRBase ]
Description Homo sapiens miR-128-1 stem-loop
Comment The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical . The sequences are therefore renamed mir-128-1 and mir-128-2.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-128-3p
Mature Sequence 50| UCACAGUGAACCGGUCUCUUU |70
Evidence Experimental
Experiments Cloned
Putative hsa-miR-128-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDKN4, KIP1, MEN1B, MEN4, P27KIP1
Description cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Transcript NM_0040    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1B
(miRNA target sites are highlighted)
>CDKN1B|NM_0040|3'UTR
   1 TAAACAGCTCGAATTAAGAATATGTTTCCTTGTTTATCAGATACATCACTGCTTGATGAAGCAAGGAAGATATACATGAA
  81 AATTTTAAAAATACATATCGCTGACTTCATGGAATGGACATCCTGTATAAGCACTGAAAAACAACAACACAATAACACTA
 161 AAATTTTAGGCACTCTTAAATGATCTGCCTCTAAAAGCGTTGGATGTAGCATTATGCAATTAGGTTTTTCCTTATTTGCT
 241 TCATTGTACTACCTGTGTATATAGTTTTTACCTTTTATGTAGCACATAAACTTTGGGGAAGGGAGGGCAGGGTGGGGCTG
 321 AGGAACTGACGTGGAGCGGGGTATGAAGAGCTTGCTTTGATTTACAGCAAGTAGATAAATATTTGACTTGCATGAAGAGA
 401 AGCAATTTTGGGGAAGGGTTTGAATTGTTTTCTTTAAAGATGTAATGTCCCTTTCAGAGACAGCTGATACTTCATTTAAA
 481 AAAATCACAAAAATTTGAACACTGGCTAAAGATAATTGCTATTTATTTTTACAAGAAGTTTATTCTCATTTGGGAGATCT
 561 GGTGATCTCCCAAGCTATCTAAAGTTTGTTAGATAGCTGCATGTGGCTTTTTTAAAAAAGCAACAGAAACCTATCCTCAC
 641 TGCCCTCCCCAGTCTCTCTTAAAGTTGGAATTTACCAGTTAATTACTCAGCAGAATGGTGATCACTCCAGGTAGTTTGGG
 721 GCAAAAATCCGAGGTGCTTGGGAGTTTTGAATGTTAAGAATTGACCATCTGCTTTTATTAAATTTGTTGACAAAATTTTC
 801 TCATTTTCTTTTCACTTCGGGCTGTGTAAACACAGTCAAAATAATTCTAAATCCCTCGATATTTTTAAAGATCTGTAAGT
 881 AACTTCACATTAAAAAATGAAATATTTTTTAATTTAAAGCTTACTCTGTCCATTTATCCACAGGAAAGTGTTATTTTTCA
 961 AGGAAGGTTCATGTAGAGAAAAGCACACTTGTAGGATAAGTGAAATGGATACTACATCTTTAAACAGTATTTCATTGCCT
1041 GTGTATGGAAAAACCATTTGAAGTGTACCTGTGTACATAACTCTGTAAAAACACTGAAAAATTATACTAACTTATTTATG
1121 TTAAAAGATTTTTTTTAATCTAGACAATATACAAGCCAAAGTGGCATGTTTTGTGCATTTGTAAATGCTGTGTTGGGTAG
1201 AATAGGTTTTCCCCTCTTTTGTTAAATAATATGGCTATGCTTAAAAGGTTGCATACTGAGCCAAGTATAATTTTTTGTAA
1281 TGTGTGAAAAAGATGCCAATTATTGTTACACATTAAGTAATCAATAAAGAAAACTTCCATAGCTATT
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-128-3p :: CDKN1B    [ Functional MTI ]
Validation Method Other
Article - Kotani, A. Ha, D. Hsieh, J. Rao, P. K. et al.
- Blood, 2009
MLL-AF4 Acute Lymphocytic Leukemia (ALL) has a poor prognosis. MicroRNAs (miRNA) are small noncoding RNAs that post-transcriptionally regulate expression of target mRNAs. Our analysis of data published by Lu etc. (1), showed that expression of miR-128b and miR-221 is downregulated in MLL rearranged ALL relative to other types of ALL. Re-expression of these miRNAs cooperatively sensitizes two cultured lines of MLL-AF4 ALL cells to glucocorticoids. Target genes downregulated by miR-128b include MLL, AF4, and both MLL-AF4 and AF4-MLL fusion genes; miR-221 downregulates CDKN1B. These results demonstrate that downregulation of miR-128b and miR-221 is implicated in glucocorticoid resistance, that restoration of their levels is a potentially promising therapeutic in MLL-AF4 ALL.
LinkOut: [PMID: 19749093]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
290 hsa-miR-128-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000340 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 2 2
MIRT001070 DCX doublecortin 4 1
MIRT001071 RELN reelin 4 1
MIRT003734 E2F3 E2F transcription factor 3 2 2
MIRT004353 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 2 2
MIRT004415 MLL myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT004416 AFF1 AF4/FMR2 family, member 1 1 1
MIRT004417 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT004645 BMI1 BMI1 polycomb ring finger oncogene 5 4
MIRT004650 TGFBR1 transforming growth factor, beta receptor 1 4 2
MIRT004757 FBXW7 F-box and WD repeat domain containing 7 5 2
MIRT006099 WEE1 WEE1 homolog (S. pombe) 3 2
MIRT007324 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT021868 RND1 Rho family GTPase 1 1 1
MIRT021869 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT021870 TUSC5 tumor suppressor candidate 5 1 1
MIRT021871 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 1 1
MIRT021872 EFEMP2 EGF-containing fibulin-like extracellular matrix protein 2 1 1
MIRT021873 LRRC40 leucine rich repeat containing 40 1 1
MIRT021874 RGS14 regulator of G-protein signaling 14 1 1
MIRT021875 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT021876 TNNI1 troponin I type 1 (skeletal, slow) 1 1
MIRT021877 JAK1 Janus kinase 1 1 1
MIRT021878 PRR11 proline rich 11 1 1
MIRT021879 CCDC6 coiled-coil domain containing 6 1 1
MIRT021880 AJUBA jub, ajuba homolog (Xenopus laevis) 1 1
MIRT021881 BOC Boc homolog (mouse) 1 1
MIRT021882 NBEA neurobeachin 1 1
MIRT021883 INTS2 integrator complex subunit 2 1 1
MIRT021884 INA internexin neuronal intermediate filament protein, alpha 1 1
MIRT021885 MOB1A MOB1, Mps One Binder kinase activator-like 1B (yeast) 1 1
MIRT021886 DCK deoxycytidine kinase 1 1
MIRT021887 ARHGAP5 Rho GTPase activating protein 5 1 1
MIRT021888 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT021889 TSPAN13 tetraspanin 13 1 1
MIRT021890 HRASLS5 HRAS-like suppressor family, member 5 1 1
MIRT021891 GATA6 GATA binding protein 6 1 1
MIRT021892 YPEL1 yippee-like 1 (Drosophila) 1 1
MIRT021893 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT021894 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT021895 LDLR low density lipoprotein receptor 2 2
MIRT021896 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT021897 ZNF652 zinc finger protein 652 1 1
MIRT021898 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT021899 GCNT2 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) 1 1
MIRT021900 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT021901 CASC3 cancer susceptibility candidate 3 1 1
MIRT021902 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT021903 UNC13C unc-13 homolog C (C. elegans) 1 1
MIRT021904 NXT1 NTF2-like export factor 1 1 1
MIRT021905 KIF5B kinesin family member 5B 1 1
MIRT021906 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT021907 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT021908 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT021909 SUPT7L suppressor of Ty 7 (S. cerevisiae)-like 1 1
MIRT021910 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT021911 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT021912 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT021913 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT021914 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT021915 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT021916 HOXC6 homeobox C6 1 1
MIRT021917 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT021918 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT021919 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT021920 ZBTB18 zinc finger protein 238 1 1
MIRT021921 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 2 2
MIRT021922 EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa 1 1
MIRT021923 TUB tubby homolog (mouse) 1 2
MIRT021924 SOX2 SRY (sex determining region Y)-box 2 1 1
MIRT021925 FAM213B chromosome 1 open reading frame 93 1 1
MIRT021926 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT021927 FAM89A family with sequence similarity 89, member A 1 1
MIRT021928 CCL17 chemokine (C-C motif) ligand 17 1 1
MIRT021929 NCK2 NCK adaptor protein 2 1 1
MIRT021930 LILRB5 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 1 1
MIRT021931 ZNF552 zinc finger protein 552 1 1
MIRT021932 MCTP1 multiple C2 domains, transmembrane 1 1 1
MIRT021933 PLA2G5 phospholipase A2, group V 1 1
MIRT021934 MID2 midline 2 1 1
MIRT021935 CLDN5 claudin 5 1 1
MIRT021936 FAM9B family with sequence similarity 9, member B 1 1
MIRT021937 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT021938 STK3 serine/threonine kinase 3 (STE20 homolog, yeast) 1 1
MIRT021939 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 1 1
MIRT021940 KCNJ6 potassium inwardly-rectifying channel, subfamily J, member 6 1 1
MIRT021941 HTRA4 HtrA serine peptidase 4 1 1
MIRT021942 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT021943 CDK19 cyclin-dependent kinase 19 1 1
MIRT021944 SLC35F4 solute carrier family 35, member F4 1 1
MIRT021945 DNAJB8 DnaJ (Hsp40) homolog, subfamily B, member 8 1 1
MIRT021946 PDZRN4 PDZ domain containing ring finger 4 1 1
MIRT021947 CDH5 cadherin 5, type 2 (vascular endothelium) 1 1
MIRT021948 A2M alpha-2-macroglobulin 1 1
MIRT021949 GAS7 growth arrest-specific 7 1 1
MIRT021950 PYGO1 pygopus homolog 1 (Drosophila) 1 1
MIRT021951 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT021952 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT021953 RBM24 RNA binding motif protein 24 1 1
MIRT021954 CDY2B chromodomain protein, Y-linked, 2B 1 1
MIRT021955 ARF6 ADP-ribosylation factor 6 1 1
MIRT021956 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT021957 KNG1 kininogen 1 1 1
MIRT021958 GPR83 G protein-coupled receptor 83 1 1
MIRT021959 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT021960 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT021961 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT021962 SERTAD4 SERTA domain containing 4 1 1
MIRT021963 MARCKSL1 MARCKS-like 1 1 1
MIRT021964 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT021965 ZNF236 zinc finger protein 236 1 1
MIRT021966 CASQ2 calsequestrin 2 (cardiac muscle) 1 1
MIRT021967 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT021968 ZNF614 zinc finger protein 614 1 1
MIRT021969 TRIM36 tripartite motif-containing 36 1 1
MIRT021970 FAM49B family with sequence similarity 49, member B 1 1
MIRT021971 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT021972 MOB3B MOB1, Mps One Binder kinase activator-like 2B (yeast) 1 1
MIRT021973 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT021974 RBBP5 retinoblastoma binding protein 5 1 1
MIRT021975 UBE2D1 ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) 1 1
MIRT021976 PTCHD1 patched domain containing 1 1 1
MIRT021977 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT021978 TSPAN6 tetraspanin 6 1 1
MIRT021979 ZBED6CL chromosome 7 open reading frame 29 1 1
MIRT021980 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT021981 GLRX glutaredoxin (thioltransferase) 1 1
MIRT021982 RFX3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT021983 GCC2 GRIP and coiled-coil domain containing 2 1 1
MIRT021984 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT021985 SH3RF1 SH3 domain containing ring finger 1 1 1
MIRT021986 MYPN myopalladin 1 1
MIRT021987 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT021988 BAG2 BCL2-associated athanogene 2 1 1
MIRT021989 VEGFC vascular endothelial growth factor C 1 1
MIRT021990 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT021991 CTSZ cathepsin Z 1 1
MIRT021992 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT021993 MYO9A myosin IXA 1 1
MIRT021994 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT021995 TRMT112 tRNA methyltransferase 11-2 homolog (S. cerevisiae) 1 1
MIRT021996 YIPF5 Yip1 domain family, member 5 1 1
MIRT021997 RPL28 ribosomal protein L28 1 1
MIRT021998 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT021999 SSFA2 sperm specific antigen 2 1 1
MIRT022000 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT022001 ITPR1 inositol 1,4,5-triphosphate receptor, type 1 1 1
MIRT022002 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT022003 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT022004 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT022005 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT022006 CERK ceramide kinase 1 1
MIRT022007 MRPL44 mitochondrial ribosomal protein L44 1 1
MIRT022008 MBTD1 mbt domain containing 1 1 1
MIRT022009 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT022010 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT022011 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT022012 TMEM30A transmembrane protein 30A 1 1
MIRT022013 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT022014 TUSC3 tumor suppressor candidate 3 1 1
MIRT022015 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT022016 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT022017 RNF182 ring finger protein 182 1 1
MIRT022018 TAGLN transgelin 1 1
MIRT022019 POU5F1 POU class 5 homeobox 1 1 1
MIRT022020 GOLPH3L golgi phosphoprotein 3-like 1 1
MIRT022021 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT022022 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 1 1
MIRT022023 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT022024 FXYD2 FXYD domain containing ion transport regulator 2 1 1
MIRT022025 VPS13D vacuolar protein sorting 13 homolog D (S. cerevisiae) 1 1
MIRT022026 ROPN1L ropporin 1-like 1 1
MIRT022027 DACT2 dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis) 1 1
MIRT022028 AZGP1 alpha-2-glycoprotein 1, zinc-binding 1 1
MIRT022029 MUC13 mucin 13, cell surface associated 1 1
MIRT022030 CD300A CD300a molecule 1 1
MIRT022031 FRA10AC1 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 1 1
MIRT022032 GDNF glial cell derived neurotrophic factor 1 1
MIRT022033 CETN1 centrin, EF-hand protein, 1 1 1
MIRT022034 PTCHD3 patched domain containing 3 1 1
MIRT022035 INTS8 integrator complex subunit 8 1 1
MIRT022036 BRCA2 breast cancer 2, early onset 1 1
MIRT022037 CLCA4 chloride channel accessory 4 1 1
MIRT022038 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT022039 BPIFB3 chromosome 20 open reading frame 185 1 1
MIRT022040 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT022041 HEY2 hairy/enhancer-of-split related with YRPW motif 2 1 1
MIRT022042 SLC17A4 solute carrier family 17 (sodium phosphate), member 4 1 1
MIRT022043 TUBBP1 tubulin, beta pseudogene 1 1 1
MIRT022044 SUMF1 sulfatase modifying factor 1 1 1
MIRT022045 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT022046 RNF144B ring finger protein 144B 1 1
MIRT022047 ACSL5 acyl-CoA synthetase long-chain family member 5 1 1
MIRT022048 FYN FYN oncogene related to SRC, FGR, YES 1 1
MIRT022049 PIK3C2B phosphoinositide-3-kinase, class 2, beta polypeptide 1 1
MIRT022050 SLC22A14 solute carrier family 22, member 14 1 1
MIRT022051 SNRK SNF related kinase 1 1
MIRT022052 TBX3 T-box 3 1 1
MIRT022053 CNNM2 cyclin M2 1 1
MIRT022054 FNBP1 formin binding protein 1 1 1
MIRT022055 PHF14 PHD finger protein 14 1 1
MIRT022056 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT022057 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT022058 PDE3B phosphodiesterase 3B, cGMP-inhibited 1 1
MIRT022059 C6orf211 chromosome 6 open reading frame 211 1 1
MIRT022060 KIAA0319L KIAA0319-like 1 1
MIRT022061 EPB41L1 erythrocyte membrane protein band 4.1-like 1 1 1
MIRT022062 G6PC3 glucose 6 phosphatase, catalytic, 3 1 1
MIRT022063 TXNIP thioredoxin interacting protein 2 2
MIRT022064 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT022065 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT022066 TROVE2 TROVE domain family, member 2 1 1
MIRT022067 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT022068 ATP8A1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1 1
MIRT022069 E2F7 E2F transcription factor 7 1 1
MIRT022070 STAG1 stromal antigen 1 1 1
MIRT022071 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT022072 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT022073 MOB1B MOB1, Mps One Binder kinase activator-like 1A (yeast) 1 1
MIRT022074 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT022075 ALDH4A1 aldehyde dehydrogenase 4 family, member A1 1 1
MIRT022076 CLPP ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) 1 1
MIRT022077 NEK2 NIMA (never in mitosis gene a)-related kinase 2 1 1
MIRT022078 PDE3A phosphodiesterase 3A, cGMP-inhibited 1 1
MIRT022079 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT022080 SFXN2 sideroflexin 2 1 1
MIRT022081 PAGR1 chromosome 16 open reading frame 53 1 1
MIRT022082 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT022083 ZNF490 zinc finger protein 490 1 1
MIRT022084 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT022085 BYSL bystin-like 1 1
MIRT022086 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT022087 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT022088 ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) 1 1
MIRT022089 RAB21 RAB21, member RAS oncogene family 1 1
MIRT022090 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT022091 FOXP4 forkhead box P4 1 1
MIRT022092 LBR lamin B receptor 1 1
MIRT022093 USP25 ubiquitin specific peptidase 25 1 1
MIRT022094 LMNB1 lamin B1 1 1
MIRT022095 CD2AP CD2-associated protein 1 1
MIRT022096 TMEM170B transmembrane protein 170B 1 1
MIRT022097 MMS22L chromosome 6 open reading frame 167 1 1
MIRT022098 SLC39A7 solute carrier family 39 (zinc transporter), member 7 1 1
MIRT022099 FAM217B chromosome 20 open reading frame 177 1 1
MIRT022100 ZNF800 zinc finger protein 800 1 1
MIRT022101 AFF4 AF4/FMR2 family, member 4 1 1
MIRT022102 LITAF lipopolysaccharide-induced TNF factor 2 2
MIRT022103 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT035580 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT035581 ADORA2B adenosine A2b receptor 1 1
MIRT035582 DBI diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) 1 1
MIRT045851 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT045852 RAB22A RAB22A, member RAS oncogene family 1 1
MIRT045853 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT045854 RPS24 ribosomal protein S24 1 1
MIRT045855 RPL21 ribosomal protein L21 1 1
MIRT045856 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT045857 NDUFC2 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa 1 1
MIRT045858 METTL25 chromosome 12 open reading frame 26 1 1
MIRT045859 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT045860 STK35 serine/threonine kinase 35 1 1
MIRT045861 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT045862 CCDC117 coiled-coil domain containing 117 1 1
MIRT045863 KPNB1 karyopherin (importin) beta 1 1 1
MIRT045864 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT045865 POP4 processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT045866 C19orf47 chromosome 19 open reading frame 47 1 1
MIRT045867 SNX11 sorting nexin 11 1 1
MIRT045868 FUBP3 far upstream element (FUSE) binding protein 3 1 1
MIRT045869 ETF1 eukaryotic translation termination factor 1 1 1
MIRT045870 SH3D19 SH3 domain containing 19 1 1
MIRT045871 C2orf72 chromosome 2 open reading frame 72 1 1
MIRT045872 ZFHX4 zinc finger homeobox 4 1 1
MIRT045873 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT045874 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT045875 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT045876 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT045877 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT045878 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT045879 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT045880 WDR81 WD repeat domain 81 1 1
MIRT045881 TUBB4B tubulin, beta 2C 1 1
MIRT045882 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT045883 HIP1R huntingtin interacting protein 1 related 1 1
MIRT045884 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT045885 HIATL1 hippocampus abundant transcript-like 1 1 1
MIRT045886 INO80D INO80 complex subunit D 1 1
MIRT045887 UBE2G2 ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) 1 1
MIRT045888 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1