Accession ID: MIRT004424 [miRNA, hsa-miR-326 :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-326LinkOut: [miRBase ]
Synonyms MIRN326, hsa-mir-326, MIR326
Description Homo sapiens miR-326 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-326
Mature Sequence 60| CCUCUGGGCCCUUCCUCCAG |79
Evidence Experimental
Experiments Cloned
Putative hsa-miR-326 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description Notch homolog 1, translocation-associated (Drosophila)
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 TAAACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCC
  81 GACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTAT
 161 GTACTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCT
 241 ATTCTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATAT
 321 AAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGA
 401 AGGGAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCA
 481 AGCCAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCT
 561 CACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTT
 641 AGATGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCAT
 721 GAATCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCC
 801 CCCTGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACA
 881 CGGAGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACA
 961 GTGTCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTC
1041 CCGTGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCC
1121 CGCAGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTT
1201 GGGAGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTT
1281 TGTTTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCC
1361 TTAGCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGG
1441 CCGCGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTG
1521 TAGTTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACT
1601 GATTTGCAATAAAAATGATACTGATGGTGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-326 :: NOTCH1    [ Functional MTI ]
Validation Method Western blot , Luciferase reporter assay ,
Conditions U251MG
Location of target site 3'UTR
Original Description (Extracted from the article) ... it significantly reduced output from Notch-1 and Notch-2 luciferase 3`UTR reporter plasmids ...

- Kefas, B. Comeau, L. Floyd, D. H. et al., 2009, J Neurosci.

Article - Kefas, B. Comeau, L. Floyd, D. H. et al.
- J Neurosci, 2009
Little is known of microRNA interactions with cellular pathways. Few reports have associated microRNAs with the Notch pathway, which plays key roles in nervous system development and in brain tumors. We previously implicated the Notch pathway in gliomas, the most common and aggressive brain tumors. While investigating Notch mediators, we noted microRNA-326 was upregulated following Notch-1 knockdown. This neuronally expressed microRNA was not only suppressed by Notch but also inhibited Notch proteins and activity, indicating a feedback loop. MicroRNA-326 was downregulated in gliomas via decreased expression of its host gene. Transfection of microRNA-326 into both established and stem cell-like glioma lines was cytotoxic, and rescue was obtained with Notch restoration. Furthermore, miR-326 transfection reduced glioma cell tumorigenicity in vivo. Additionally, we found microRNA-326 partially mediated the toxic effects of Notch knockdown. This work demonstrates a microRNA-326/Notch axis, shedding light on the biology of Notch and suggesting microRNA-326 delivery as a therapy.
LinkOut: [PMID: 19955368]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
48 hsa-miR-326 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000082 GLI1 GLI family zinc finger 1 2 1
MIRT000526 SMO smoothened homolog (Drosophila) 3 3
MIRT004424 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 3 1
MIRT004425 NOTCH2 Notch homolog 2 (Drosophila) 3 1
MIRT004747 MSH3 mutS homolog 3 (E. coli) 5 1
MIRT005520 PKM pyruvate kinase, muscle 5 2
MIRT019530 CD9 CD9 molecule 2 1
MIRT043620 DYNLT1 dynein, light chain, Tctex-type 1 1 1
MIRT043621 CCDC12 coiled-coil domain containing 12 1 1
MIRT043622 PLA2G4F phospholipase A2, group IVF 1 1
MIRT043623 INPPL1 inositol polyphosphate phosphatase-like 1 1 1
MIRT043624 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT043625 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT043626 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT043627 FASN fatty acid synthase 1 1
MIRT043628 PPP2R4 protein phosphatase 2A activator, regulatory subunit 4 1 1
MIRT043629 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT043630 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT043631 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT043632 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT043633 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT043634 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT043635 ZNF689 zinc finger protein 689 1 1
MIRT043636 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT043637 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 1 1
MIRT043638 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT043639 ERLIN2 ER lipid raft associated 2 1 1
MIRT043640 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT043641 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT043642 NKRF NFKB repressing factor 1 1
MIRT043643 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT043644 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT043645 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT043646 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT043647 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT043648 KIAA1671 KIAA1671 1 1
MIRT043649 ARRDC1 arrestin domain containing 1 1 1
MIRT043650 ACTB actin, beta 1 1
MIRT043651 ACTG1 actin, gamma 1 1 1
MIRT043652 ATXN2L ataxin 2-like 1 1
MIRT043653 ZNF746 zinc finger protein 746 1 1
MIRT043654 PAQR8 progestin and adipoQ receptor family member VIII 1 1
MIRT043655 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 1
MIRT043656 UCK1 uridine-cytidine kinase 1 1 1
MIRT043657 HNRNPUL2 heterogeneous nuclear ribonucleoprotein U-like 2 1 1
MIRT043658 JMJD1C jumonji domain containing 1C 1 1
MIRT043659 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT043660 SRRM1 serine/arginine repetitive matrix 1 1 1