Accession ID: MIRT004424 [miRNA, hsa-miR-326 :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-326LinkOut: [miRBase ]
Synonyms MIRN326, hsa-mir-326, MIR326
Description Homo sapiens miR-326 stem-loop
Comment This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-326
Mature Sequence 60| CCUCUGGGCCCUUCCUCCAG |79
Evidence Experimental
Experiments Cloned
Putative hsa-miR-326 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaCCUCCUU--CCCGGGUCUCc 5'
            |||| |:  |  :|||||| 
Target 5' taGGAGAAGCTGCATCCAGAGg 3'
515 - 536 136.00 -20.10
2
miRNA  3' gaCCUCC--UUCC--CGGGUCUCc 5'
            ||| |  |:||  | |||||| 
Target 5' gtGGATGCCAGGGCCGACCAGAGg 3'
63 - 86 126.00 -24.50
3
miRNA  3' gaccuccuucccGGGUCUCc 5'
                      |||||:| 
Target 5' cgtggtgccatcCCCAGGGg 3'
1441 - 1460 124.00 -17.16
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-326 :: NOTCH1    [ Functional MTI ]
Validation Method Western blot , Luciferase reporter assay ,
Conditions U251MG
Location of target site 3'UTR
Original Description (Extracted from the article) ... it significantly reduced output from Notch-1 and Notch-2 luciferase 3`UTR reporter plasmids ...

- Kefas, B. Comeau, L. Floyd, D. H. et al., 2009, J Neurosci.

Article - Kefas, B. Comeau, L. Floyd, D. H. et al.
- J Neurosci, 2009
Little is known of microRNA interactions with cellular pathways. Few reports have associated microRNAs with the Notch pathway, which plays key roles in nervous system development and in brain tumors. We previously implicated the Notch pathway in gliomas, the most common and aggressive brain tumors. While investigating Notch mediators, we noted microRNA-326 was upregulated following Notch-1 knockdown. This neuronally expressed microRNA was not only suppressed by Notch but also inhibited Notch proteins and activity, indicating a feedback loop. MicroRNA-326 was downregulated in gliomas via decreased expression of its host gene. Transfection of microRNA-326 into both established and stem cell-like glioma lines was cytotoxic, and rescue was obtained with Notch restoration. Furthermore, miR-326 transfection reduced glioma cell tumorigenicity in vivo. Additionally, we found microRNA-326 partially mediated the toxic effects of Notch knockdown. This work demonstrates a microRNA-326/Notch axis, shedding light on the biology of Notch and suggesting microRNA-326 delivery as a therapy.
LinkOut: [PMID: 19955368]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
119 hsa-miR-326 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000082 GLI1 GLI family zinc finger 1 2 1
MIRT000526 SMO smoothened, frizzled family receptor 3 3
MIRT004424 NOTCH1 notch 1 3 1
MIRT004425 NOTCH2 notch 2 3 1
MIRT004747 MSH3 mutS homolog 3 (E. coli) 5 1
MIRT005520 PKM pyruvate kinase, muscle 5 2
MIRT019530 CD9 CD9 molecule 2 1
MIRT043620 DYNLT1 dynein, light chain, Tctex-type 1 1 1
MIRT043621 CCDC12 coiled-coil domain containing 12 1 1
MIRT043622 PLA2G4F phospholipase A2, group IVF 1 1
MIRT043623 INPPL1 inositol polyphosphate phosphatase-like 1 1 1
MIRT043624 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT043625 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT043626 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT043627 FASN fatty acid synthase 1 1
MIRT043628 PPP2R4 protein phosphatase 2A activator, regulatory subunit 4 1 1
MIRT043629 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT043630 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT043631 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 1
MIRT043632 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT043633 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT043634 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT043635 ZNF689 zinc finger protein 689 1 1
MIRT043636 PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 1 1
MIRT043637 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 1 1
MIRT043638 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT043639 ERLIN2 ER lipid raft associated 2 1 1
MIRT043640 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT043641 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT043642 NKRF NFKB repressing factor 1 1
MIRT043643 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
MIRT043644 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT043645 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT043646 VKORC1 vitamin K epoxide reductase complex, subunit 1 1 1
MIRT043647 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT043648 KIAA1671 KIAA1671 1 1
MIRT043649 ARRDC1 arrestin domain containing 1 1 1
MIRT043650 ACTB actin, beta 1 1
MIRT043651 ACTG1 actin, gamma 1 1 1
MIRT043652 ATXN2L ataxin 2-like 1 1
MIRT043653 ZNF746 zinc finger protein 746 1 1
MIRT043654 PAQR8 progestin and adipoQ receptor family member VIII 1 1
MIRT043655 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 1
MIRT043656 UCK1 uridine-cytidine kinase 1 1 1
MIRT043657 HNRNPUL2 heterogeneous nuclear ribonucleoprotein U-like 2 1 1
MIRT043658 JMJD1C jumonji domain containing 1C 1 1
MIRT043659 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT043660 SRRM1 serine/arginine repetitive matrix 1 1 1
MIRT438105 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 1 1
MIRT438404 CD274 CD274 molecule 2 1
MIRT443542 ZNRF2 zinc and ring finger 2 1 1
MIRT445576 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT447253 IHH Indian hedgehog 1 1
MIRT464636 UBE4A ubiquitination factor E4A 1 1
MIRT466571 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT479099 CNNM4 cyclin M4 1 1
MIRT479767 CCND1 cyclin D1 1 1
MIRT484766 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT490617 SLC47A1 solute carrier family 47, member 1 1 2
MIRT491280 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT492302 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT498317 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT499746 USH1G Usher syndrome 1G (autosomal recessive) 1 2
MIRT502069 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT504055 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT511951 FAM127B family with sequence similarity 127, member B 1 1
MIRT519654 ZNF772 zinc finger protein 772 1 2
MIRT519750 ZNF394 zinc finger protein 394 1 2
MIRT524865 ARL5B ADP-ribosylation factor-like 5B 1 2
MIRT526297 SORCS2 sortilin-related VPS10 domain containing receptor 2 1 2
MIRT528733 FAM26E family with sequence similarity 26, member E 1 1
MIRT532686 PATZ1 POZ (BTB) and AT hook containing zinc finger 1 1 1
MIRT534737 RBM47 RNA binding motif protein 47 1 1
MIRT535381 PEX5L peroxisomal biogenesis factor 5-like 1 1
MIRT539176 AR androgen receptor 1 1
MIRT543150 AKT1 v-akt murine thymoma viral oncogene homolog 1 1 1
MIRT544652 PHF8 PHD finger protein 8 1 2
MIRT554005 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT576777 Tmem127 transmembrane protein 127 1 1
MIRT609382 FAM216B family with sequence similarity 216, member B 1 2
MIRT609625 TRPC4AP transient receptor potential cation channel, subfamily C, member 4 associated protein 1 1
MIRT610799 KLK2 kallikrein-related peptidase 2 1 1
MIRT617183 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT620585 WBSCR27 Williams Beuren syndrome chromosome region 27 1 2
MIRT622054 SSBP2 single-stranded DNA binding protein 2 1 1
MIRT626270 EPHB3 EPH receptor B3 1 2
MIRT627458 SYNRG synergin, gamma 1 1
MIRT630737 C1R complement component 1, r subcomponent 1 1
MIRT633968 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT634974 C8orf17 chromosome 8 open reading frame 17 1 1
MIRT636416 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT644084 A4GALT alpha 1,4-galactosyltransferase 1 1
MIRT650377 MOCS3 molybdenum cofactor synthesis 3 1 1
MIRT653652 SLC27A4 solute carrier family 27 (fatty acid transporter), member 4 1 1
MIRT658230 FBXL16 F-box and leucine-rich repeat protein 16 1 1
MIRT658451 FAM167B family with sequence similarity 167, member B 1 1
MIRT660243 BMP7 bone morphogenetic protein 7 1 1
MIRT662603 MAGEB4 melanoma antigen family B, 4 1 1
MIRT662915 MED18 mediator complex subunit 18 1 1
MIRT667038 PDE3A phosphodiesterase 3A, cGMP-inhibited 1 1
MIRT668177 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT669677 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT669911 KIAA0754 KIAA0754 1 2
MIRT670372 ULBP3 UL16 binding protein 3 1 2
MIRT670646 BVES blood vessel epicardial substance 1 1
MIRT670753 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT689636 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT693955 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT702903 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT703934 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT712003 F9 coagulation factor IX 1 1
MIRT712788 ZNF154 zinc finger protein 154 1 1
MIRT713834 NUP98 nucleoporin 98kDa 1 1
MIRT718498 GYS1 glycogen synthase 1 (muscle) 1 1
MIRT718676 LSM10 LSM10, U7 small nuclear RNA associated 1 1
MIRT720764 FAM193A family with sequence similarity 193, member A 1 1
MIRT722577 C1orf95 chromosome 1 open reading frame 95 1 1
MIRT723662 RPTN repetin 1 1
MIRT725248 PDE1B phosphodiesterase 1B, calmodulin-dependent 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*