Accession ID: MIRT004456 [miRNA, hsa-miR-152-3p :: DNMT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-152LinkOut: [miRBase ]
Description Homo sapiens miR-152 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-152-3p
Mature Sequence 54| UCAGUGCAUGACAGAACUUGG |74
Evidence Experimental
Experiments Cloned
Putative hsa-miR-152-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DNMT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIM, CXXC9, DNMT, FLJ16293, MCMT, MGC104992
Description DNA (cytosine-5-)-methyltransferase 1
Transcript NM_0011308    LinkOut: [ RefSeq ]
Other Transcripts NM_0013   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DNMT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DNMT1
(miRNA target sites are highlighted)
>DNMT1|NM_0011308|3'UTR
   1 GCCAAAGCCCGAGAGAGTGCCTCAGCTAAAATAAAGGAGGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCC
  81 TGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTA
 161 CATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGT
 241 GCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAATTA
 321 AGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACCAAAAAAAAAAAAAAAAAAAA
 401 AAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-152-3p :: DNMT1    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions Mz-ChA-1
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Article - Braconi, C. Huang, N. Patel, T.
- Hepatology, 2010
Although the inflammation-associated cytokine interleukin-6 (IL-6) has been implicated in cholangiocarcinoma growth, the relationship between IL-6 and oncogenic changes is unknown. IL-6 can increase expression of DNA methyltransferase-1 (DNMT-1) and epigenetically regulate the expression of several genes, including microRNAs (miRNAs). DNMT-1 up-regulation occurs in hepatobiliary cancers and is associated with a poor prognosis. To understand the potential regulation of DNMT-1 by IL-6-dependent miRNAs, we examined the expression of a group of miRNAs which have sequence complementarity to the 3'-untranslated region of DNMT-1, namely miR-148a, miR-152, and miR-301. The expression of these miRNAs was decreased in cholangiocarcinoma cells. Moreover, the expression of all three miRNAs was decreased in IL-6-overexpressing malignant cholangiocytes in vitro and in tumor cell xenografts. There was a concomitant decrease in expression of the methylation-sensitive tumor suppressor genes Rassf1a and p16INK4a. Using luciferase reporter constructs, DNMT-1 was verified as a target for miR-148a and miR-152. Precursors to miR-148a and miR-152 decreased DNMT-1 protein expression, increased Rassf1a and p16INK4a expression, and reduced cell proliferation. Conclusion: These data indicate that IL-6 can regulate the activity of DNMT-1 and expression of methylation-dependent tumor suppressor genes by modulation of miR-148a and miR-152, and provide a link between this inflammation-associated cytokine and oncogenesis in cholangiocarcinoma. (HEPATOLOGY 2010.).
LinkOut: [PMID: 20146264]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-152-3p :: DNMT1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Reporter assay;Western blot;qRT-PCR
Conditions HepG2 , HepG2.2.15 , Huh-7 , LO2 , Hepa1-6
Disease hepatitis B virus related hepatocellular carcinoma;
Location of target site 3'UTR
Tools used in this research miRanda , mirGen , PicTar , TargetScan
Original Description (Extracted from the article) ... As shown in Fig. 3B, miR-152 significantly reduced the luciferase activity of the WT construct of the DNMT1 3'-UTR with respect to the negative control, whereas such a suppressive effect was not observed in cells with the Mut construct of DNMT1 3'-UTR.// ...

- Huang, J. Wang, Y. Guo, Y. Sun, S., 2010, Hepatology.

Article - Huang, J. Wang, Y. Guo, Y. Sun, S.
- Hepatology, 2010
The hepatitis B virus (HBV) X protein has been implicated as a potential trigger of the epigenetic modifications of some genes during hepatocarcinogenesis, but the underlying mechanisms remain unknown. MicroRNAs (miRNAs), which are noncoding RNAs that regulate gene expression, are involved in diverse biological functions and in carcinogenesis. In this study, we investigated whether some miRNAs are aberrantly expressed and involved in the regulation of the abnormal DNA methylation status in HBV-related hepatocellular carcinoma (HCC). Our results showed that the expression of microRNA-152 (miR-152) was frequently down-regulated in HBV-related HCC tissues in comparison with adjacent noncancerous hepatic tissues and was inversely correlated to DNA methyltransferase 1 (DNMT1) messenger RNA (mRNA) expression in HBV-related HCCs. The forced expression of miR-152 in liver cell lines resulted in a marked reduction of the expression of DNMT1 at both the mRNA and protein levels by directly targeting the 3' untranslated regions of DNMT1. This in turn led to a decrease in global DNA methylation, whereas inhibition of miR-152 caused global DNA hypermethylation and increased the methylation levels of two tumor suppressor genes, glutathione S-transferase pi 1 (GSTP1) and E-cadherin 1 (CDH1). Conclusion: Our findings suggest that miR-152 is frequently down-regulated and regulates DNMT1 in HBV-related HCC. These findings support a tumor-suppressive role of miR-152 in the epigenetic aberration of HBV-related HCC and the potential development of miRNA-based targeted approaches for the treatment of HBV-related HCC. HEPATOLOGY 2010.
LinkOut: [PMID: 20578129]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-152-3p :: DNMT1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Western blot
Conditions SK-N-BE(2) , KELLY
Location of target site 3'UTR
Original Description (Extracted from the article) ... Ectopic overexpression of miR-152, targeting DNMT1, also negatively affected cell invasiveness and anchorage-independent growth, contributing in part to the differentiated phenotype. ...

- Das, S. Foley, N. Bryan, K. Watters, K. M. et al., 2010, Cancer Res.

Article - Das, S. Foley, N. Bryan, K. Watters, K. M. et al.
- Cancer Res, 2010
Neuroblastoma is an often fatal pediatric cancer arising from precursor cells of the sympathetic nervous system. 13-Cis retinoic acid is included in the treatment regimen for patients with high-risk disease, and a similar derivative, all-trans-retinoic acid (ATRA), causes neuroblastoma cell lines to undergo differentiation. The molecular signaling pathways involved with ATRA-induced differentiation are complex, and the role that DNA methylation changes might play are unknown. The purpose of this study was to evaluate the genome-wide effects of ATRA on DNA methylation using methylated DNA immunoprecipitation applied to microarrays representing all known promoter and CpG islands. Four hundred and two gene promoters became demethylated, whereas 88 were hypermethylated post-ATRA. mRNA expression microarrays revealed that 82 of the demethylated genes were overexpressed by >2-fold, whereas 13 of the hypermethylated genes were underexpressed. Gene ontology analysis indicated that demethylated and re-expressed genes were enriched for signal transduction pathways, including NOS1, which is required for neural cell differentiation. As a potential mechanism for the DNA methylation changes, we show the downregulation of methyltransferases, DNMT1 and DNMT3B, along with the upregulation of endogenous microRNAs targeting them. Ectopic overexpression of miR-152, targeting DNMT1, also negatively affected cell invasiveness and anchorage-independent growth, contributing in part to the differentiated phenotype. We conclude that functionally important, miRNA-mediated DNA demethylation changes contribute to the process of ATRA-induced differentiation resulting in the activation of NOS1, a critical determinant of neural cell differentiation. Our findings illustrate the plasticity and dynamic nature of the epigenome during cancer cell differentiation.
LinkOut: [PMID: 20841484]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-152-3p :: DNMT1    [ Functional MTI ]
Validation Method Immunoblot , Immunoprecipitaion , Luciferase reporter assay , qRT-PCR , Western blot
Conditions 16HBE
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-152 represses DNMT1 expression by targeting 3′-UTR ...

- Ji, W. Yang, L. Yuan, J. Yang, L. Zhang, M. et al., 2012, Carcinogenesis.

Article - Ji, W. Yang, L. Yuan, J. Yang, L. Zhang, M. et al.
- Carcinogenesis, 2012
Nickel (Ni) compounds are well-recognized human carcinogens, yet the molecular mechanisms by which they cause human cancer are still not well understood. MicroRNAs (miRNAs), which are small non-coding RNAs, are involved in diverse biological functions and carcinogenesis. In previous study, we identified upregulation of DNA methyltransferase 1 (DNMT1) expression in nickel sulfide (NiS)-transformed human bronchial epithelial (16HBE) cells. Here, we investigated whether some miRNAs are aberrantly expressed and targets DNMT1 in NiS-transformed cells. Our results showed that the expression of miRNA-152 (miR-152) was specifically downregulated in NiS-transformed cells via promoter DNA hypermethylation, whereas ectopic expression of miR-152 in NiS-transformed cells resulted in a marked reduction of DNMT1 expression. Further experiments revealed that miR-152 directly downregulated DNMT1 expression by targeting the 3' untranslated regions of its transcript. Interestingly, treatment of DNMT inhibitor, 5-aza-2-deoxycytidine, or depletion of DNMT1 led to increased miR-152 expression by reversion of promoter hypermethylation, DNMT1 and MeCP2 binding to miR-152 promoter in NiS-transformed cells. Moreover, inhibition of miR-152 expression in 16HBE cells could increase DNMT1 expression and result in an increase in DNA methylation, DNMT1 and MeCP2 binding to miR-152 promoter, indicating an interaction between miR-152 and DNMT1 is regulated by a double-negative circuit. Furthermore, ectopic expression of miR-152 in NiS-transformed cells led to a significant decrease of cell growth. Conversely, inhibition of miR-152 expression in 16HBE cells significantly increased cell growth. Taken together, these observations demonstrate a crucial functional crosstalk between miR-152 and the DNMT1 via a feedback loop involved in NiS-induced malignant transformation.
LinkOut: [PMID: 23125218]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
9 hsa-miR-152-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000293 HLA-G major histocompatibility complex, class I, G 2 1
MIRT004456 DNMT1 DNA (cytosine-5-)-methyltransferase 1 5 4
MIRT006860 IRS1 insulin receptor substrate 1 2 1
MIRT006861 IGF1R insulin-like growth factor 1 receptor 2 1
MIRT035552 TGFA transforming growth factor, alpha 1 1
MIRT045818 SETDB1 SET domain, bifurcated 1 1 1
MIRT045819 ECHS1 enoyl CoA hydratase, short chain, 1, mitochondrial 1 1
MIRT045820 R3HCC1L chromosome 10 open reading frame 28 1 1
MIRT045821 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1