Accession ID: MIRT004483 [miRNA, hsa-miR-34a-5p :: MAP2K1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-34aLinkOut: [miRBase ]
Description Homo sapiens miR-34a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-34a-5p
Mature Sequence 22| UGGCAGUGUCUUAGCUGGUUGU |43
Evidence Experimental
Experiments Cloned
Putative hsa-miR-34a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MAP2K1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MAPKK1, MEK1, MKK1, PRKMK1
Description mitogen-activated protein kinase kinase 1
Transcript NM_0027    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MAP2K1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MAP2K1
(miRNA target sites are highlighted)
>MAP2K1|NM_0027|3'UTR
   1 TAAGTGTTTGGGAAGCAACAAAGAGCGAGTCCCCTGCCCGGTGGTTTGCCATGTCGCTTTTGGGCCTCCTTCCCATGCCT
  81 GTCTCTGTTCAGATGTGCATTTCACCTGTGACAAAGGATGAAGAACACAGCATGTGCCAAGATTCTACTCTTGTCATTTT
 161 TAATATTACTGTCTTTATTCTTATTACTATTATTGTTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTGTGTA
 241 TGCTGATGATCAAAACCTGTGCCAGGCTGAATTACAGTGAAATTTTGGTGAATGTGGGTAGTCATTCTTACAATTGCACT
 321 GCTGTTCCTGCTCCATGACTGGCTGTCTGCCTGTATTTTCGGGATTCTTTGACATTTGGTGGTACTTTATTCTTGCTGGG
 401 CATACTTTCTCTCTAGGAGGGAGCCTTGTGAGATCCTTCACAGGCAGTGCATGTGAAGCATGCTTTGCTGCTATGAAAAT
 481 GAGCATCAGAGAGTGTACATCATGTTATTTTATTATTATTATTTGCTTTTCATGTAGAACTCAGCAGTTGACATCCAAAT
 561 CTAGCCAGAGCCCTTCACTGCCATGATAGCTGGGGCTTCACCAGTCTGTCTACTGTGGTGATCTGTAGACTTCTGGTTGT
 641 ATTTCTATATTTATTTTCAGTATACTGTGTGGGATACTTAGTGGTATGTCTCTTTAAGTTTTGATTAATGTTTCTTAAAT
 721 GGAATTATTTTGAATGTCACAAATTGATCAAGATATTAAAATGTCGGATTTATCTTTCCCCATATCCAAGTACCAATGCT
 801 GTTGTAAACAACGTGTATAGTGCCTAAAATTGTATGAAAATCCTTTTAACCATTTTAACCTAGATGTTTAACAAATCTAA
 881 TCTCTTATTCTAATAAATATACTATGAAATAAAAAAAAAAGGATGAAAGCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUUGGUCGAU-UC----UGUGACGGu 5'
            | |:||| | ||     ||||||| 
Target 5' aaATCTAGCCAGAGCCCTTCACTGCCa 3'
557 - 583 150.00 -21.92
2
miRNA  3' ugUUGGU-CGAUUCU----GUGACGGu 5'
            |::||  || | |    ||||||: 
Target 5' gtAGTCATTCTTACAATTGCACTGCTg 3'
298 - 324 130.00 -9.90
3
miRNA  3' ugUUGGUCGAUUCUGUGACGGu 5'
            ||  ||| |:  | ||||| 
Target 5' acAAAGAGCGAGTCCCCTGCCc 3'
18 - 39 124.00 -13.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-34a-5p :: MAP2K1    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot , Northern blot , Other
Conditions HEK293 , K562
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Reporter gene assays identified mitogen-activated protein kinase kinase 1 (MEK1) as a direct target of miR-34a and c-fos as a direct target of miR-221/222.//Taken together, the results show that PMA activates the MEK-ERK pathway and strongly induces miRNA-34a expression, which in turn inhibits cell proliferation by repressing the expression of MEK1//a. Transfection of the miR-34a precursor oligonucleotide significantly reduced luciferase expression from a reporter plasmid that contained the 3' UTR of MEK1 compared with the transfection of a scrambled RNA control (Fig. 5B). Likewise, the miR-221 or miR-222 precursor oligonucleotide reduced the activity of a reporter plasmid that contained the 3' UTR of c-fos (Fig. 5D). ...

- Ichimura, A. Ruike, Y. Terasawa, K. et al., 2010, Mol Pharmacol.

Article - Ichimura, A. Ruike, Y. Terasawa, K. et al.
- Mol Pharmacol, 2010
Phorbol 12-myristate 13-acetate (PMA) induces megakaryocytic differentiation of the human chronic myelocytic leukemia cell line K562. We examined the potential regulatory role of microRNAs (miRNAs) in this process. Genome-wide expression profiling identified 21 miRNAs (miRs) that were induced by the treatment of K562 cells with PMA. Among them, the expression of miR-34a, miR-221, and miR-222 was induced in the early stages and maintained throughout the late stages of differentiation. Cell signaling analysis showed that the activation of extracellular signal-regulated protein kinase (ERK) in response to PMA strongly induced miR-34a expression by transactivation via the activator protein-1 binding site in the upstream region of the miR-34a gene. Reporter gene assays identified mitogen-activated protein kinase kinase 1 (MEK1) as a direct target of miR-34a and c-fos as a direct target of miR-221/222. Although overexpression of the three miRNAs had little effect on cell differentiation, overexpression of miR-34a significantly repressed the proliferation of K562 cells with a concomitant reduction in MEK1 protein expression. Conversely, a locked nucleic acid probe against miR-34a significantly enhanced the proliferation of PMA-treated K562 cells. Taken together, the results show that PMA activates the MEK-ERK pathway and strongly induces miRNA-34a expression, which in turn inhibits cell proliferation by repressing the expression of MEK1. Thus, the results highlight an important regulatory role for miR-34a in the process of megakaryocytic differentiation, especially in the arrest of cell growth, which is a prerequisite for cells to enter differentiation.
LinkOut: [PMID: 20299489]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
492 hsa-miR-34a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000071 BIRC3 baculoviral IAP repeat-containing 3 2 1
MIRT000073 GRM7 glutamate receptor, metabotropic 7 3 2
MIRT000074 JAG1 jagged 1 (Alagille syndrome) 5 2
MIRT000695 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 6 6
MIRT000720 MYB v-myb myeloblastosis viral oncogene homolog (avian) 4 2
MIRT000748 HMGA2 high mobility group AT-hook 2 2 2
MIRT000750 E2F5 E2F transcription factor 5, p130-binding 2 1
MIRT000751 CDC25C cell division cycle 25 homolog C (S. pombe) 2 1
MIRT000759 MET met proto-oncogene (hepatocyte growth factor receptor) 4 10
MIRT000763 CDK4 cyclin-dependent kinase 4 5 6
MIRT000768 CCNE2 cyclin E2 4 4
MIRT000980 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 4 7
MIRT001010 CCND3 cyclin D3 2 1
MIRT001011 CDC25A cell division cycle 25 homolog A (S. pombe) 2 1
MIRT001012 CDK6 cyclin-dependent kinase 6 5 8
MIRT001013 CCND1 cyclin D1 5 6
MIRT001231 WNT1 wingless-type MMTV integration site family, member 1 4 2
MIRT001232 AXIN2 axin 2 2 1
MIRT001756 E2F3 E2F transcription factor 3 5 10
MIRT001757 DLL1 delta-like 1 (Drosophila) 2 3
MIRT001758 VAMP2 vesicle-associated membrane protein 2 (synaptobrevin 2) 1 1
MIRT002098 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 4 11
MIRT002298 BCL2 B-cell CLL/lymphoma 2 5 13
MIRT002875 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 5 11
MIRT003148 E2f3 E2F transcription factor 3 3 1
MIRT003149 Mycn v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 3 1
MIRT003150 Sirt1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 3 1
MIRT003356 HNF4A hepatocyte nuclear factor 4, alpha 4 2
MIRT004045 YY1 YY1 transcription factor 3 2
MIRT004109 MAGEA12 melanoma antigen family A, 12 3 1
MIRT004110 MAGEA6 melanoma antigen family A, 6 4 1
MIRT004111 MAGEA3 melanoma antigen family A, 3 4 1
MIRT004112 MAGEA2 melanoma antigen family A, 2 4 1
MIRT004403 MDM4 Mdm4 p53 binding protein homolog (mouse) 2 1
MIRT004483 MAP2K1 mitogen-activated protein kinase kinase 1 4 1
MIRT004502 PEA15 phosphoprotein enriched in astrocytes 15 2 2
MIRT004513 VEGFA vascular endothelial growth factor A 2 1
MIRT004617 IFNB1 interferon, beta 1, fibroblast 3 1
MIRT004821 E2F1 E2F transcription factor 1 3 2
MIRT004905 TNFRSF6B tumor necrosis factor receptor superfamily, member 6b, decoy 2 1
MIRT005029 NOTCH2 Notch homolog 2 (Drosophila) 5 2
MIRT005075 EMP1 epithelial membrane protein 1 2 1
MIRT005480 CD44 CD44 molecule (Indian blood group) 4 1
MIRT005546 FOXP1 forkhead box P1 3 2
MIRT005606 MAP3K9 mitogen-activated protein kinase kinase kinase 9 4 1
MIRT005723 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 1 1
MIRT005724 SPI1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 1 1
MIRT005760 ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 2 2
MIRT006212 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 3 1
MIRT006222 NANOG Nanog homeobox 2 1
MIRT006223 SOX2 SRY (sex determining region Y)-box 2 2 1
MIRT006254 IMPA1 inositol(myo)-1(or 4)-monophosphatase 1 1 1
MIRT006255 IMPDH2 IMP (inosine 5'-monophosphate) dehydrogenase 2 1 1
MIRT006286 ULBP2 UL16 binding protein 2 2 1
MIRT006304 SYT1 synaptotagmin I 2 1
MIRT006305 STX1A syntaxin 1A (brain) 2 1
MIRT006546 FOSL1 FOS-like antigen 1 3 1
MIRT006576 EPHA5 EPH receptor A5 2 1
MIRT006664 AXL AXL receptor tyrosine kinase 4 2
MIRT006869 CCL22 chemokine (C-C motif) ligand 22 1 1
MIRT006874 KLB klotho beta 1 1
MIRT007112 TP53 tumor protein p53 1 1
MIRT007193 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT007204 BMP7 bone morphogenetic protein 7 1 1
MIRT025210 KIF4A kinesin family member 4A 1 1
MIRT025211 HIST1H2AB histone cluster 1, H2ab 1 1
MIRT025212 ATXN2L ataxin 2-like 1 2
MIRT025213 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT025214 H3F3B H3 histone, family 3B (H3.3B) 1 1
MIRT025215 ACSL4 acyl-CoA synthetase long-chain family member 4 2 1
MIRT025216 HIST3H3 histone cluster 3, H3 1 1
MIRT025217 TNPO3 transportin 3 1 1
MIRT025218 HIST1H2BE histone cluster 1, H2be 1 1
MIRT025219 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT025220 STAM2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 1 1
MIRT025221 HIST1H3J histone cluster 1, H3j 1 1
MIRT025222 HIST2H3A histone cluster 2, H3a 1 1
MIRT025223 HIST1H4I histone cluster 1, H4i 1 1
MIRT025224 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT025225 CRYAA crystallin, alpha A 1 1
MIRT025226 RPIA ribose 5-phosphate isomerase A 1 1
MIRT025227 HIST1H4K histone cluster 1, H4k 1 1
MIRT025228 RNF40 ring finger protein 40 1 1
MIRT025229 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT025230 MST1 macrophage stimulating 1 (hepatocyte growth factor-like) 1 1
MIRT025231 CCNL1 cyclin L1 1 1
MIRT025232 MCM3 minichromosome maintenance complex component 3 1 1
MIRT025233 MTA2 metastasis associated 1 family, member 2 3 2
MIRT025234 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT025235 HIST2H4A histone cluster 2, H4a 1 1
MIRT025236 H1FX H1 histone family, member X 1 1
MIRT025237 KIF5B kinesin family member 5B 1 1
MIRT025238 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT025239 HIST2H2AB histone cluster 2, H2ab 1 1
MIRT025240 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 1
MIRT025241 HIST2H2AC histone cluster 2, H2ac 1 1
MIRT025242 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT025243 TOMM40 translocase of outer mitochondrial membrane 40 homolog (yeast) 1 1
MIRT025244 WBP11 WW domain binding protein 11 1 1
MIRT025245 MAP1B microtubule-associated protein 1B 1 1
MIRT025246 HIST1H2AE histone cluster 1, H2ae 1 1
MIRT025247 SETD3 SET domain containing 3 1 1
MIRT025248 PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 1 1
MIRT025249 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT025250 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT025251 DSP desmoplakin 1 1
MIRT025252 HIST1H4A histone cluster 1, H4a 1 1
MIRT025253 HIST1H2BO histone cluster 1, H2bo 1 1
MIRT025254 DHCR7 7-dehydrocholesterol reductase 1 1
MIRT025255 GRB2 growth factor receptor-bound protein 2 1 1
MIRT025256 LRRC40 leucine rich repeat containing 40 1 1
MIRT025257 GAS1 growth arrest-specific 1 1 1
MIRT025258 MTDH metadherin 1 1
MIRT025259 RRAS related RAS viral (r-ras) oncogene homolog 1 1
MIRT025260 SPTAN1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 1 1
MIRT025261 RALB v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) 1 1
MIRT025262 BAG6 HLA-B associated transcript 3 1 1
MIRT025263 BCLAF1 BCL2-associated transcription factor 1 1 1
MIRT025264 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT025265 ARF6 ADP-ribosylation factor 6 1 1
MIRT025266 RBM26 RNA binding motif protein 26 1 1
MIRT025267 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT025268 UHRF1 ubiquitin-like with PHD and ring finger domains 1 2 2
MIRT025269 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT025270 RRM2 ribonucleotide reductase M2 1 1
MIRT025271 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT025272 DDX56 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 1 1
MIRT025273 HIST1H2BB histone cluster 1, H2bb 1 1
MIRT025274 NUPL2 nucleoporin like 2 1 1
MIRT025275 WASF2 WAS protein family, member 2 1 1
MIRT025276 HIST3H2BB histone cluster 3, H2bb 1 1
MIRT025277 AHNAK AHNAK nucleoprotein 1 1
MIRT025278 STAT1 signal transducer and activator of transcription 1, 91kDa 1 1
MIRT025279 HIST1H4L histone cluster 1, H4l 1 1
MIRT025280 ARHGAP1 Rho GTPase activating protein 1 2 2
MIRT025281 ERLIN2 ER lipid raft associated 2 1 1
MIRT025282 HIST1H4D histone cluster 1, H4d 1 1
MIRT025283 CXCL9 chemokine (C-X-C motif) ligand 9 1 1
MIRT025284 NASP nuclear autoantigenic sperm protein (histone-binding) 1 1
MIRT025285 HIST1H1B histone cluster 1, H1b 1 1
MIRT025286 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT025287 HIST1H3G histone cluster 1, H3g 1 1
MIRT025288 AIMP2 aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 1 1
MIRT025289 EFNB1 ephrin-B1 1 1
MIRT025290 NT5C2 5'-nucleotidase, cytosolic II 1 1
MIRT025291 ITGA6 integrin, alpha 6 1 1
MIRT025293 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 1
MIRT025294 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT025295 KIF11 kinesin family member 11 1 1
MIRT025296 EHD1 EH-domain containing 1 1 1
MIRT025297 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 1 1
MIRT025298 RRBP1 ribosome binding protein 1 homolog 180kDa (dog) 1 1
MIRT025299 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT025300 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT025301 HIST1H2AC histone cluster 1, H2ac 1 1
MIRT025302 HSPA1A heat shock 70kDa protein 1A 1 1
MIRT025303 HIST1H1E histone cluster 1, H1e 1 1
MIRT025304 AP2B1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT025305 IMP3 IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT025306 CLTB clathrin, light chain B 1 1
MIRT025307 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT025309 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT025310 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT025311 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT025312 RBM12 RNA binding motif protein 12 1 1
MIRT025313 TSN translin 1 1
MIRT025314 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT025315 SNX12 sorting nexin 12 1 1
MIRT025316 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT025317 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT025318 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT025319 MTAP methylthioadenosine phosphorylase 2 2
MIRT025320 HIBADH 3-hydroxyisobutyrate dehydrogenase 1 1
MIRT025321 CALD1 caldesmon 1 1 1
MIRT025322 MCM4 minichromosome maintenance complex component 4 1 1
MIRT025324 HIST1H3E histone cluster 1, H3e 1 1
MIRT025325 BTF3L4 basic transcription factor 3-like 4 1 1
MIRT025326 ZSWIM7 zinc finger, SWIM-type containing 7 1 1
MIRT025327 THOC2 THO complex 2 1 1
MIRT025328 ECD ecdysoneless homolog (Drosophila) 1 1
MIRT025329 HIST1H4J histone cluster 1, H4j 1 1
MIRT025330 RRP1B ribosomal RNA processing 1 homolog B (S. cerevisiae) 1 1
MIRT025331 ANXA4 annexin A4 1 1
MIRT025332 STAG2 stromal antigen 2 1 1
MIRT025333 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT025334 CFL1 cofilin 1 (non-muscle) 1 1
MIRT025335 KIF2C kinesin family member 2C 1 1
MIRT025336 POLD1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa 1 1
MIRT025337 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT025338 CAPRIN1 cell cycle associated protein 1 1 1
MIRT025339 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT025340 EPS8L2 EPS8-like 2 1 1
MIRT025341 CAPN1 calpain 1, (mu/I) large subunit 1 1
MIRT025342 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT025343 AP2A2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT025344 ZFR zinc finger RNA binding protein 1 1
MIRT025345 GDI1 GDP dissociation inhibitor 1 1 1
MIRT025346 IRGQ immunity-related GTPase family, Q 1 1
MIRT025347 ESYT2 extended synaptotagmin-like protein 2 1 1
MIRT025348 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT025349 HIST1H2AL histone cluster 1, H2al 1 1
MIRT025350 KIF2A kinesin heavy chain member 2A 1 1
MIRT025351 AKR1A1 aldo-keto reductase family 1, member A1 (aldehyde reductase) 1 1
MIRT025352 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT025353 HIST1H4C histone cluster 1, H4c 1 1
MIRT025354 HIST1H4F histone cluster 1, H4f 1 1
MIRT025355 APOL2 apolipoprotein L, 2 1 1
MIRT025356 TJP2 tight junction protein 2 (zona occludens 2) 1 1
MIRT025357 NSUN5 NOP2/Sun domain family, member 5 1 1
MIRT025358 HDLBP high density lipoprotein binding protein 1 1
MIRT025359 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 1
MIRT025360 PYGB phosphorylase, glycogen; brain 1 1
MIRT025361 MKI67 antigen identified by monoclonal antibody Ki-67 1 1
MIRT025362 QDPR quinoid dihydropteridine reductase 1 1
MIRT025363 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT025364 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT025365 UBAP2 ubiquitin associated protein 2 1 1
MIRT025366 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 1 1
MIRT025367 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT025368 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT025369 PLCG1 phospholipase C, gamma 1 1 1
MIRT025370 MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 1 1
MIRT025371 PROSER1 chromosome 13 open reading frame 23 1 1
MIRT025372 PUM2 pumilio homolog 2 (Drosophila) 1 1
MIRT025373 B4GALT3 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 1 1
MIRT025374 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT025375 TNRC18 trinucleotide repeat containing 18 1 1
MIRT025376 TSPAN14 tetraspanin 14 1 1
MIRT025377 NCBP2 nuclear cap binding protein subunit 2, 20kDa 1 1
MIRT025378 ZNF644 zinc finger protein 644 1 1
MIRT025379 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT025380 LEF1 lymphoid enhancer-binding factor 1 2 1
MIRT025381 ACSL1 acyl-CoA synthetase long-chain family member 1 2 1
MIRT025382 NCAPG non-SMC condensin I complex, subunit G 1 1
MIRT025383 ERLIN1 ER lipid raft associated 1 2 2
MIRT025384 PLIN3 perilipin 3 1 1
MIRT025385 CPT2 carnitine palmitoyltransferase 2 1 2
MIRT025386 MCMBP chromosome 10 open reading frame 119 1 1
MIRT025387 HIST2H2AA3 histone cluster 2, H2aa3 1 1
MIRT025388 HIST1H2AA histone cluster 1, H2aa 1 1
MIRT025389 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT025390 DHX38 DEAH (Asp-Glu-Ala-His) box polypeptide 38 1 1
MIRT025391 CDKN2AIP CDKN2A interacting protein 1 1
MIRT025392 RBCK1 RanBP-type and C3HC4-type zinc finger containing 1 1 1
MIRT025393 AKR7L aldo-keto reductase family 7-like 1 1
MIRT025394 C12orf5 chromosome 12 open reading frame 5 1 1
MIRT025395 CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1 1
MIRT025396 VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) 1 1
MIRT025397 HIST2H4B histone cluster 2, H4b 2 2
MIRT025398 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT025399 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT025400 MCM2 minichromosome maintenance complex component 2 1 1
MIRT025401 H3F3A H3 histone, family 3A 2 2
MIRT025402 HIST1H1D histone cluster 1, H1d 1 1
MIRT025403 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT025404 TCOF1 Treacher Collins-Franceschetti syndrome 1 1 1
MIRT025405 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT025406 HIST1H3I histone cluster 1, H3i 1 1
MIRT025407 HIST1H4E histone cluster 1, H4e 1 1
MIRT025408 SERPINB1 serpin peptidase inhibitor, clade B (ovalbumin), member 1 1 1
MIRT025409 NDRG1 N-myc downstream regulated 1 1 1
MIRT025410 HIST1H3H histone cluster 1, H3h 1 1
MIRT025411 UBQLN2 ubiquilin 2 1 1
MIRT025412 AFAP1L2 actin filament associated protein 1-like 2 1 1
MIRT025413 PUS7 pseudouridylate synthase 7 homolog (S. cerevisiae) 1 1
MIRT025414 CDC20 cell division cycle 20 homolog (S. cerevisiae) 2 2
MIRT025415 HIST2H2BE histone cluster 2, H2be 1 1
MIRT025416 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 1
MIRT025417 GEMIN5 gem (nuclear organelle) associated protein 5 1 1
MIRT025418 POP1 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT025419 FAM3C family with sequence similarity 3, member C 1 1
MIRT025420 EPHA2 EPH receptor A2 1 1
MIRT025421 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT025422 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT025423 HIST1H4H histone cluster 1, H4h 1 1
MIRT025424 SURF4 surfeit 4 1 2
MIRT025425 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025426 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT025427 FIGN fidgetin 1 1
MIRT025428 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT025429 TPPP tubulin polymerization promoting protein 1 1
MIRT025430 FAM76A family with sequence similarity 76, member A 1 2
MIRT025431 LDHA lactate dehydrogenase A 2 1
MIRT025432 RSU1 Ras suppressor protein 1 1 1
MIRT025433 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT025434 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 1 1
MIRT025435 TMOD2 tropomodulin 2 (neuronal) 1 1
MIRT025436 SEPT1 septin 1 1 1
MIRT025437 GIGYF2 GRB10 interacting GYF protein 2 1 1
MIRT025438 H3F3AP6 H3 histone pseudogene 1 1
MIRT025439 KLC1 kinesin light chain 1 1 1
MIRT025440 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT025441 HIST1H2AG histone cluster 1, H2ag 1 1
MIRT025442 PPP6R3 SAPS domain family, member 3 1 1
MIRT025443 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 1 1
MIRT025444 UBE3C ubiquitin protein ligase E3C 1 1
MIRT025445 GFPT1 glutamine--fructose-6-phosphate transaminase 1 1 1
MIRT025446 HIST1H2AK histone cluster 1, H2ak 1 1
MIRT025447 TXNRD1 thioredoxin reductase 1 1 1
MIRT025448 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT025449 HIST1H3D histone cluster 1, H3d 1 1
MIRT025450 TFRC transferrin receptor (p90, CD71) 1 1
MIRT025451 HIST1H3C histone cluster 1, H3c 1 1
MIRT025452 CORO1B coronin, actin binding protein, 1B 1 1
MIRT025453 RCN1 reticulocalbin 1, EF-hand calcium binding domain 1 1
MIRT025454 ME1 malic enzyme 1, NADP(+)-dependent, cytosolic 1 1
MIRT025455 DUT deoxyuridine triphosphatase 1 1
MIRT025456 SAA1 serum amyloid A1 1 1
MIRT025457 CARF amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 1 1
MIRT025458 HIST2H3C histone cluster 2, H3c 1 1
MIRT025459 KTN1 kinectin 1 (kinesin receptor) 1 1
MIRT025460 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT025461 HIST1H4B histone cluster 1, H4b 1 1
MIRT025462 STRAP serine/threonine kinase receptor associated protein 1 1
MIRT025463 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT025464 EIF4G1 eukaryotic translation initiation factor 4 gamma, 1 1 1
MIRT025465 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT025466 TATDN2 TatD DNase domain containing 2 1 1
MIRT025467 POGZ pogo transposable element with ZNF domain 1 1
MIRT025469 MCM7 minichromosome maintenance complex component 7 1 1
MIRT025470 CKAP5 cytoskeleton associated protein 5 1 1
MIRT025471 SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3 1 1
MIRT025472 HIST1H2BA histone cluster 1, H2ba 1 1
MIRT025473 CTTN cortactin 1 1
MIRT025474 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT025475 RTN4 reticulon 4 2 2
MIRT025476 S100A2 S100 calcium binding protein A2 1 1
MIRT025477 HIST1H2AH histone cluster 1, H2ah 1 1
MIRT025478 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT025479 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT025480 TES testis derived transcript (3 LIM domains) 1 1
MIRT025481 FEN1 flap structure-specific endonuclease 1 1 1
MIRT025482 GPI glucose-6-phosphate isomerase 1 1
MIRT025483 DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 1 1
MIRT025484 NELFCD TH1-like (Drosophila) 1 1
MIRT025485 HIST1H3A histone cluster 1, H3a 1 1
MIRT025486 HIST2H2AA4 histone cluster 2, H2aa4 1 1
MIRT025487 TYMS thymidylate synthetase 1 1
MIRT025488 EFHD2 EF-hand domain family, member D2 1 1
MIRT025489 PKP2 plakophilin 2 1 1
MIRT025490 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT025491 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT025492 FAH fumarylacetoacetate hydrolase (fumarylacetoacetase) 1 1
MIRT025493 CAPG capping protein (actin filament), gelsolin-like 1 1
MIRT025494 GYG1 glycogenin 1 1 1
MIRT025495 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT025496 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT025497 FAM104A family with sequence similarity 104, member A 1 1
MIRT025498 MYOF myoferlin 1 1
MIRT025499 CMAS cytidine monophosphate N-acetylneuraminic acid synthetase 1 1
MIRT025500 MAP4 microtubule-associated protein 4 1 1
MIRT025501 HIST1H2AD histone cluster 1, H2ad 1 1
MIRT025502 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT025503 HIST2H3D histone cluster 2, H3d 1 1
MIRT025504 ACSL6 acyl-CoA synthetase long-chain family member 6 1 1
MIRT025505 CDC5L CDC5 cell division cycle 5-like (S. pombe) 1 1
MIRT025507 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT025508 SLC6A16 solute carrier family 6, member 16 1 1
MIRT025509 NT5E 5'-nucleotidase, ecto (CD73) 1 1
MIRT025510 IMMT inner membrane protein, mitochondrial 1 1
MIRT025511 NUP98 nucleoporin 98kDa 1 1
MIRT025513 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 1 1
MIRT025514 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT025515 DTYMK deoxythymidylate kinase (thymidylate kinase) 1 1
MIRT025516 TMOD3 tropomodulin 3 (ubiquitous) 1 1
MIRT025517 PTMS parathymosin 1 1
MIRT025518 HIST1H2AM histone cluster 1, H2am 1 1
MIRT025519 HIST1H2AJ histone cluster 1, H2aj 1 1
MIRT025520 USP47 ubiquitin specific peptidase 47 1 1
MIRT025521 MCM5 minichromosome maintenance complex component 5 1 1
MIRT025522 VCL vinculin 1 1
MIRT025523 MYO1C myosin IC 1 1
MIRT025524 TMEM109 transmembrane protein 109 1 1
MIRT025525 HIST4H4 histone cluster 4, H4 1 1
MIRT025526 PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) 1 1
MIRT025527 KIAA0196 KIAA0196 1 1
MIRT025528 HSD17B10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT025529 LLPH LLP homolog, long-term synaptic facilitation (Aplysia) 1 1
MIRT025530 MTMR9 myotubularin related protein 9 1 1
MIRT025531 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT025532 SATB2 SATB homeobox 2 1 1
MIRT025533 ACSS1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT025534 DRG1 developmentally regulated GTP binding protein 1 1 1
MIRT025535 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT025536 HIST1H1C histone cluster 1, H1c 1 1
MIRT025537 HIST1H2AI histone cluster 1, H2ai 1 1
MIRT025538 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT025539 IK IK cytokine, down-regulator of HLA II 1 1
MIRT025540 HIST3H2A histone cluster 3, H2a 1 1
MIRT025541 HIST1H1A histone cluster 1, H1a 1 1
MIRT025542 TTLL12 tubulin tyrosine ligase-like family, member 12 1 1
MIRT025543 PWP2 PWP2 periodic tryptophan protein homolog (yeast) 1 1
MIRT025544 GTF3C3 general transcription factor IIIC, polypeptide 3, 102kDa 1 1
MIRT025545 MCM6 minichromosome maintenance complex component 6 1 1
MIRT025546 XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 1 1
MIRT025547 AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 1 1
MIRT025548 TBL3 transducin (beta)-like 3 1 1
MIRT025549 HIST1H3B histone cluster 1, H3b 1 1
MIRT025550 SORT1 sortilin 1 1 1
MIRT025551 GNPDA1 glucosamine-6-phosphate deaminase 1 1 1
MIRT025552 HOXB8 homeobox B8 1 1
MIRT025553 REEP3 receptor accessory protein 3 1 1
MIRT025554 TXNIP thioredoxin interacting protein 1 1
MIRT025555 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 1
MIRT025556 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 1 1
MIRT025557 HDAC1 histone deacetylase 1 2 1
MIRT025558 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 1
MIRT025559 HIST1H3F histone cluster 1, H3f 1 1
MIRT025560 TPM1 tropomyosin 1 (alpha) 1 1
MIRT025561 SNAP23 synaptosomal-associated protein, 23kDa 1 1
MIRT025562 STAG3L3 stromal antigen 3-like 3 1 1
MIRT025563 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT025564 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) 1 1
MIRT025565 DDAH2 dimethylarginine dimethylaminohydrolase 2 1 1
MIRT025566 RAB3GAP2 RAB3 GTPase activating protein subunit 2 (non-catalytic) 1 1
MIRT025567 UCK2 uridine-cytidine kinase 2 1 1
MIRT025568 U2SURP U2-associated SR140 protein 1 1
MIRT025569 SFN stratifin 1 1
MIRT025570 TRAIP TRAF interacting protein 1 1
MIRT025572 EPB41L2 erythrocyte membrane protein band 4.1-like 2 1 1
MIRT025573 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT025574 NUP62 nucleoporin 62kDa 1 1
MIRT025575 TNPO1 transportin 1 1 1
MIRT025576 MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) 1 1
MIRT025577 YIPF2 Yip1 domain family, member 2 1 1
MIRT025578 METAP1 methionyl aminopeptidase 1 1 1
MIRT025579 SOCS4 suppressor of cytokine signaling 4 1 1
MIRT025580 CDON Cdon homolog (mouse) 1 1
MIRT025581 POU2F1 POU class 2 homeobox 1 1 1
MIRT025582 PHF19 PHD finger protein 19 1 1
MIRT025583 UBP1 upstream binding protein 1 (LBP-1a) 1 1
MIRT025584 TPD52 tumor protein D52 2 2
MIRT025585 CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) 2 1
MIRT047341 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 1 1
MIRT047342 CYTH1 cytohesin 1 1 1
MIRT047343 YBX1 Y box binding protein 1 1 1
MIRT047344 PRRC2B HLA-B associated transcript 2-like 1 1 1
MIRT047345 SNX3 sorting nexin 3 1 1
MIRT047346 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT047347 OPA1 optic atrophy 1 (autosomal dominant) 1 1
MIRT047348 MTMR2 myotubularin related protein 2 1 1
MIRT047349 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT047350 ACTG1 actin, gamma 1 1 1
MIRT047351 CCT3 chaperonin containing TCP1, subunit 3 (gamma) 1 1
MIRT047352 EXT2 exostosin 2 1 1
MIRT047353 RPL37 ribosomal protein L37 1 1
MIRT047354 MCM10 minichromosome maintenance complex component 10 1 1
MIRT047355 CEP170 centrosomal protein 170kDa 1 1
MIRT047356 WDR77 WD repeat domain 77 1 1
MIRT047357 KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 1 1
MIRT047358 FAM208A chromosome 3 open reading frame 63 1 1
MIRT047359 RBM33 RNA binding motif protein 33 1 1
MIRT047360 GANAB glucosidase, alpha; neutral AB 1 1
MIRT047361 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT047362 ALS2 amyotrophic lateral sclerosis 2 (juvenile) 1 1
MIRT047363 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 'protein-coding 1 1
MIRT047364 RPS2 ribosomal protein S2 1 1
MIRT047365 RNF167 ring finger protein 167 1 1
MIRT047366 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT047367 PRR3 proline rich 3 1 1
MIRT047368 RBM15B RNA binding motif protein 15B 1 1
MIRT047369 MAPK3 mitogen-activated protein kinase 3 1 1
MIRT047370 INTS10 integrator complex subunit 10 1 1
MIRT047371 MED15 mediator complex subunit 15 1 1
MIRT047372 ZNF598 zinc finger protein 598 1 1
MIRT047373 PTCD3 Pentatricopeptide repeat domain 3 1 1
MIRT047374 BIRC6 baculoviral IAP repeat-containing 6 1 1
MIRT047375 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT047376 D2HGDH D-2-hydroxyglutarate dehydrogenase 1 1
MIRT047377 DIABLO diablo homolog (Drosophila) 1 1
MIRT047378 RRAGA Ras-related GTP binding A 1 1
MIRT047379 RPS7 ribosomal protein S7 1 1
MIRT047380 PIGT phosphatidylinositol glycan anchor biosynthesis, class T 1 1
MIRT047381 RAP2A RAP2A, member of RAS oncogene family 1 1
MIRT047382 PRR12 proline rich 12 1 1
MIRT047383 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT047384 SON SON DNA binding protein 1 1
MIRT047385 CDAN1 congenital dyserythropoietic anemia, type I 1 1
MIRT047386 KANSL2 chromosome 12 open reading frame 41 1 1
MIRT047387 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT047388 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT047389 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047390 SEPT7 septin 7 1 1
MIRT047391 TFAM transcription factor A, mitochondrial 1 1
MIRT047392 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT047393 FH fumarate hydratase 1 1
MIRT047394 GATA4 GATA binding protein 4 1 1
MIRT047395 FAM46A family with sequence similarity 46, member A 1 1
MIRT047396 LRRC28 leucine rich repeat containing 28 1 1
MIRT047397 UBA2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT047398 MFN2 mitofusin 2 1 1
MIRT047399 CSE1L CSE1 chromosome segregation 1-like (yeast) 1 1