Accession ID: MIRT004496 [miRNA, hsa-miR-145-5p :: FLI1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-145LinkOut: [miRBase ]
Synonyms MIRN145, miR-145, miRNA145, MIR145
Description Homo sapiens miR-145 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-145-5p
Mature Sequence 16| GUCCAGUUUUCCCAGGAAUCCCU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-145-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FLI1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms EWSR2, SIC-1
Description Friend leukemia virus integration 1
Transcript NM_0011676    LinkOut: [ RefSeq ]
Other Transcripts NM_0020   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FLI1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FLI1
(miRNA target sites are highlighted)
>FLI1|NM_0011676|3'UTR
   1 TAGAAGCTTACTCATCAGTGGCCTTCTAGCTGAAGCCCATCCTGCACACTTACTGGATGCTTTGGACTCAACAGGACATA
  81 TGTGGCCTTGAAGGGAAGACAAAACTGGATGTTCTTTCTTGTTGGATAGAACCTTTGTATTTGTTCTTTAAAAACATTTT
 161 TTTTAATGTTGGTAACTTTTGCTTCCTCTACCTGAACAAAGAGATGAATAATTCCATGGGCCAGTATGCCAGTTTGAATT
 241 CTCAGTCTCCTAGCATCTTGTGAGTTGCATATTAAGATTACTGGAATGGTTAAGTCATGGTTCTGAGAAAGAAGCTGTAC
 321 GTTTTCTTTATGTTTTTATGACCAAAGCAGTTTCTTGTCAATACACGGGGTTCAGTATGACACAGAATCATGGACTTAAC
 401 CCGTCATGTTCTGGTTTGAGATTTAGTGACAAATAGAGGTGGGAAGCTTATAATCTAATTTTAGGAGGACCAAATTCAGT
 481 GGATGGCAACTGGAACATTGATTGTAAGGCCAGTGAAGTTTTCACCCAACTGGAATTTGATGGAAAGAAGGTTTGTGTGT
 561 TTAAGACGCCAAGGGCATTGCAGAATCCCTCTCAGTGGACAGTATGCACTCAGCTGACCACTCTCTCTAGAAATAGTCAA
 641 GATATGAACTAAGAAATTTTAATGCAAATACATACATTCCTGAAAGACGGGGAATTAAATTACTAATTTTTTTTTTTTTT
 721 TAAATGATGACAGTGGTCCCAGAACTTGGAAAAGTTGTAGGGATTTCTAAACTCAAGCAGATTCGCAAGTGCTGTGCGCT
 801 TGTCAGACCATCAGACCAGGGCCAACCAATCAGAAGGCAACTTACTGTATAAATTATGCAGAGTTATTTTCCTATATCTC
 881 ACAGTATTAAAAATAAATAATTAAAAATTAAGAATAAATAAACGAGTTGACCTCGGTCACAAAAGCAGTTTTACTATCGA
 961 ATCAATCGCTGTTATTTTTTTTAATGTAATTTGTACATCTTTTTTCAATCTGTACATTTGGGCTGTCTGTATGTTTTTAT
1041 AGCTGGTTTTTAAAAAGCATAATATGCCTATAGCTGAAAAGGAAACAGGGCTGTTTAAGTCACTGACTTATGAGAAAGCA
1121 AAGCACTGGTACAGTTATTTAACAGGCATACACAAGCAGGGAAAAGATAATCCATTTAGATCTTTAATGCTTTGGAAATG
1201 CGTGTAACAGTACTGCAATAATCACAGCTCTGGGAAAAACAACGAAACTTTCCCTTGTGGAGAGGAGGGATTTTCCTGCT
1281 CTATATAAGCAACATATTTTTAGACATTAAAATATATATAATTTTGCAGGTAATTGTTGACTTTTTTAACTATATTAAGT
1361 GTTAAGCTGACAACTGTCAAAGAAGACCATGTTGTAAAATAATTTGACTAAATAAATGGTTCCTTCTCTCAGTGCTGAGG
1441 ACAGTTTTCTTATTTACCGCCCCCGTTAGGTCAAAGGGTTTTCCCTGGGGAACTTTCCTATTTACTTCTTGCACTATCAA
1521 GAATTTTTCGAATGTACCTACTGCAGTACAGCAGAAGGTAAAAAATCAGTGTGGTTTTTCATTGTTGTTGATGATGTTTG
1601 TAGTGTTTTTGTGTGTGTTATTTAAATCTTCCTCCAGCCTAAAAGGGTTTTATAAAACAGCAGCTAAGGCCATGGATAAA
1681 CCTGTATGTAAGGACTGGAGCAAAGCGAGCTGGTCTATCCAGACTGGTCTGTGAGATTTAACTCTGCAGCCTCCCCTGGG
1761 CACTTCAGACCCAGACGGCCACCTTCTGCCACTCCAGCAAAGAATAAGCGCCCTGCTTCCTTCAGGTCTCAGACCAGGAC
1841 TTTATGGCTCATGCAGATTTTTAAGGTCATTTTTCTTCCCAAGGAAGAAACTTGCCTCCAGTTCCTTCACTGTTAGGTAG
1921 CTTATTTTCATTTTCTCTATTTTACAATGAAAAGAGTGAGACCTGGGAAGTCCTTGATTTGCAAGGAATTAGACTCACAG
2001 CATTGGTAACCCTAGAACCTTCTTAGGGTAACACTAAGTACCTTCTAGACAACATGTCTACCTAAATGAAATGGGATGTG
2081 TTTCGGAACATTTGTCTCCAGTTTTTTTTTAATCTTGCACCCTGCCATTTAAAAAGATGTGTAAAGCACATATTCTCAAC
2161 ATATGCACATTGATTTATAAATCATATATACAAACTGTTACATTATTCTTCATATTAGAAAACAAATACAAAATAGAACA
2241 TTTTAAATGGTGATATAAAAATAAATTGAAACTGAAATTCTAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucccUAAG-GACC--CUUUUGACCUg 5'
              ||||  |||  |: ||||||| 
Target 5' ccaaATTCAGTGGATGGCAACTGGAa 3'
470 - 495 157.00 -14.20
2
miRNA  3' ucccuaaggacccUUUUGACCUg 5'
                       ||||||||| 
Target 5' ttgaagggaagacAAAACTGGAt 3'
88 - 110 150.00 -15.90
3
miRNA  3' ucCCUA--AGGAC---CCUU-UUGACCUg 5'
            ||||   ||||   | || :|||||| 
Target 5' atGGATAAACCTGTATGTAAGGACTGGAg 3'
1672 - 1700 143.00 -15.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145-5p :: FLI1    [ Functional MTI ]
Validation Method qRT-PCR , Luciferase reporter assay , Western blot , Other
Conditions HEK293T , A673
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... (F, left panels) miRNA145 specifically represses its target gene, FLI-1, in a luciferase assay performed in HEK-293 cells engineered to express a luciferase reporter vector containing the human wild-type FLI-1 3'UTR.//Among genes found to be modulated by miRNA145 in ESFT cells, SOX2, a core reprogramming factor and EWS-FLI-1 target gene, was induced more than a thousand-fold during the emergence of a NCSC phenotype in hpMSCEWS-FLI-1s. ...

- Riggi, N. Suva, M. L. De Vito, C. Provero, et al., 2010, Genes Dev.

Article - Riggi, N. Suva, M. L. De Vito, C. Provero, et al.
- Genes Dev, 2010
Cancer stem cells (CSCs) display plasticity and self-renewal properties reminiscent of normal tissue stem cells, but the events responsible for their emergence remain obscure. We recently identified CSCs in Ewing sarcoma family tumors (ESFTs) and showed that they retain mesenchymal stem cell (MSC) plasticity. In the present study, we addressed the mechanisms that underlie ESFT CSC development. We show that the EWS-FLI-1 fusion gene, associated with 85%-90% of ESFTs and believed to initiate their pathogenesis, induces expression of the embryonic stem cell (ESC) genes OCT4, SOX2, and NANOG in human pediatric MSCs (hpMSCs) but not in their adult counterparts. Moreover, under appropriate culture conditions, hpMSCs expressing EWS-FLI-1 generate a cell subpopulation displaying ESFT CSC features in vitro. We further demonstrate that induction of the ESFT CSC phenotype is the result of the combined effect of EWS-FLI-1 on its target gene expression and repression of microRNA-145 (miRNA145) promoter activity. Finally, we provide evidence that EWS-FLI-1 and miRNA-145 function in a mutually repressive feedback loop and identify their common target gene, SOX2, in addition to miRNA145 itself, as key players in ESFT cell differentiation and tumorigenicity. Our observations provide insight for the first time into the mechanisms whereby a single oncogene can reprogram primary cells to display a CSC phenotype.
LinkOut: [PMID: 20382729]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145-5p :: FLI1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Northern blot , qRT-PCR , Western blot
Conditions SW620 , HCT116 , 293T
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... The authors demonstrated that miR-145 targets a putative microRNA regulatory element in the 3'- untranslated region (UTR) of FLI1// ...

- Zhang, J. Guo, H. Zhang, H. Wang, H. Qian, et al., 2011, Cancer.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ucCCUAAGGACCCUUUUGACCUg 5'
            | | |::|     ||||||| 
Target 5' guGAAGUUUUCACCCAACUGGAa 3'
1 - 23
Article - Zhang, J. Guo, H. Zhang, H. Wang, H. Qian, et al.
- Cancer, 2011
BACKGROUND: Tumor suppressor microRNA miR-145 is commonly down-regulated in colon carcinoma tissues, but its specific role in tumors remains unknown. METHODS: In this study, the authors identified the Friend leukemia virus integration 1 gene (FLI1) as a novel target of miR-145. FLI1 is involved in t(11;22)(q24:q12) reciprocal chromosomal translocation in Ewing sarcoma, and its expression appears to be associated with biologically more aggressive tumors. RESULTS: The authors demonstrated that miR-145 targets a putative microRNA regulatory element in the 3'-untranslated region (UTR) of FLI1, and its abundance is reversely associated with FLI1 expression in colon cancer tissues and cell lines. By using a luciferase/FLI1 3'-UTR reporter system, they found that miR-145 down-regulated the reporter activity, and this down-regulation was reversed by anti-miR-145. Mutation of the miR-145 microRNA regulatory element sequence in the FLI1 3'-UTR abolished the activity of miR-145. miR-145 decreased FLI1 protein but not FLI1 mRNA, suggesting a mechanism of translational regulation. Furthermore, the authors demonstrated that miR-145 inhibited cell proliferation and sensitized LS174T cells to 5-fluorouracil-induced apoptosis. CONCLUSIONS: Taken together, these results suggest that miR-145 functions as a tumor suppressor by down-regulating oncogenic FLI1 in colon cancer. Cancer 2011. (c) 2010 American Cancer Society.
LinkOut: [PMID: 20737575]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145-5p :: FLI1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot
Conditions TC252
Disease Ewing’s sarcoma
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Co-transfection of the anti-mir-145 oligo- nucleotide with pri-mir-145 or with the mature mir-145 fully rescued luciferase activity, confirming the specifi- city of the suppressive pri-mir-145 effect on the FLI1 3'-untranslated region. ...

- Ban, J. Jug, G. Mestdagh, P. Schwentner, R. et al., 2011, Oncogene.

Article - Ban, J. Jug, G. Mestdagh, P. Schwentner, R. et al.
- Oncogene, 2011
EWS-FLI1 is a chromosome translocation-derived chimeric transcription factor that has a central and rate-limiting role in the pathogenesis of Ewing's sarcoma. Although the EWS-FLI1 transcriptomic signature has been extensively characterized on the mRNA level, information on its impact on non-coding RNA expression is lacking. We have performed a genome-wide analysis of microRNAs affected by RNAi-mediated silencing of EWS-FLI1 in Ewing's sarcoma cell lines, and differentially expressed between primary Ewing's sarcoma and mesenchymal progenitor cells. Here, we report on the identification of hsa-mir-145 as the top EWS-FLI1-repressed microRNA. Upon knockdown of EWS-FLI1, hsa-mir-145 expression dramatically increases in all Ewing's sarcoma cell lines tested. Vice versa, ectopic expression of the microRNA in Ewing's sarcoma cell lines strongly reduced EWS-FLI1 protein, whereas transfection of an anti-mir to hsa-mir-145 increased the EWS-FLI1 levels. Reporter gene assays revealed that this modulation of EWS-FLI1 protein was mediated by the microRNA targeting the FLI1 3'-untranslated region. Mutual regulations of EWS-FLI1 and hsa-mir-145 were mirrored by an inverse correlation between their expression levels in four of the Ewing's sarcoma cell lines tested. Consistent with the role of EWS-FLI1 in Ewing's sarcoma growth regulation, forced hsa-mir-145 expression halted Ewing's sarcoma cell line growth. These results identify feedback regulation between EWS-FLI1 and hsa-mir-145 as an important component of the EWS-FLI1-mediated Ewing's sarcomagenesis that may open a new avenue to future microRNA-mediated therapy of this devastating malignant disease.Oncogene advance online publication, 10 January 2011; doi:10.1038/onc.2010.581.
LinkOut: [PMID: 21217773]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
104 hsa-miR-145-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000305 BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 4 1
MIRT000306 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT000307 SOX2 SRY (sex determining region Y)-box 2 4 2
MIRT000308 KLF4 Kruppel-like factor 4 (gut) 4 2
MIRT000426 MUC1 mucin 1, cell surface associated 4 2
MIRT000457 MYO6 myosin VI 4 1
MIRT000575 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 4 1
MIRT000626 STAT1 signal transducer and activator of transcription 1, 91kDa 5 1
MIRT000627 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 5 3
MIRT000676 CBFB core-binding factor, beta subunit 4 2
MIRT000677 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 4 1
MIRT000678 CLINT1 clathrin interactor 1 4 1
MIRT000731 IRS1 insulin receptor substrate 1 4 5
MIRT000732 PARP8 poly (ADP-ribose) polymerase family, member 8 2 2
MIRT001811 TMOD3 tropomodulin 3 (ubiquitous) 2 1
MIRT001917 HOXA9 homeobox A9 4 1
MIRT003325 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 3 2
MIRT003543 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 5 5
MIRT004290 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 4 2
MIRT004496 FLI1 Friend leukemia virus integration 1 4 3
MIRT004580 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 4 1
MIRT004616 IFNB1 interferon, beta 1, fibroblast 3 1
MIRT004748 TIRAP toll-interleukin 1 receptor (TIR) domain containing adaptor protein 2 1
MIRT004904 POU5F1 POU class 5 homeobox 1 3 4
MIRT004931 IGF1R insulin-like growth factor 1 receptor 3 2
MIRT004938 KRT7 keratin 7 2 1
MIRT005683 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT005688 C11orf9 chromosome 11 open reading frame 9 1 1
MIRT005689 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT005690 FZD7 frizzled homolog 7 (Drosophila) 1 1
MIRT005809 ROBO2 roundabout, axon guidance receptor, homolog 2 (Drosophila) 3 1
MIRT005810 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 3 1
MIRT005878 EIF4E eukaryotic translation initiation factor 4E 3 1
MIRT005879 CDK4 cyclin-dependent kinase 4 3 1
MIRT006215 VEGFA vascular endothelial growth factor A 3 1
MIRT006317 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 3 1
MIRT006332 IRS2 insulin receptor substrate 2 1 1
MIRT006494 ITGB8 integrin, beta 8 4 1
MIRT006747 SWAP70 SWAP switching B-cell complex 70kDa subunit 4 2
MIRT006774 ESR1 estrogen receptor 1 1 1
MIRT006788 NUDT1 nudix (nucleoside diphosphate linked moiety X)-type motif 1 3 1
MIRT006847 JAG1 jagged 1 (Alagille syndrome) 4 1
MIRT006889 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 3 2
MIRT006899 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 3 1
MIRT006903 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 3 1
MIRT007094 ERG v-ets erythroblastosis virus E26 oncogene homolog (avian) 1 1
MIRT007107 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 2 1
MIRT007180 ILK integrin-linked kinase 3 1
MIRT007247 CTGF connective tissue growth factor 1 1
MIRT007248 SOCS7 suppressor of cytokine signaling 7 1 1
MIRT007257 MDM2 Mdm2 p53 binding protein homolog (mouse) 1 1
MIRT007275 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT007288 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 2 1
MIRT007307 HDAC2 histone deacetylase 2 1 1
MIRT021492 FBXO28 F-box protein 28 1 1
MIRT021493 USP46 ubiquitin specific peptidase 46 1 1
MIRT021494 ACBD3 acyl-CoA binding domain containing 3 1 1
MIRT021495 ELK1 ELK1, member of ETS oncogene family 1 1
MIRT021496 CCNA2 cyclin A2 1 1
MIRT021497 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT021498 CCDC25 coiled-coil domain containing 25 1 1
MIRT021499 RTKN rhotekin 4 1
MIRT021500 RASA1 RAS p21 protein activator (GTPase activating protein) 1 1 1
MIRT021501 F11R F11 receptor 2 2
MIRT021502 ARL6IP5 ADP-ribosylation-like factor 6 interacting protein 5 2 1
MIRT021503 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 2 1
MIRT021504 C11orf65 chromosome 11 open reading frame 65 2 1
MIRT021505 HLTF helicase-like transcription factor 2 1
MIRT021506 GMFB glia maturation factor, beta 2 1
MIRT021507 SERINC5 serine incorporator 5 2 1
MIRT021508 MEST mesoderm specific transcript homolog (mouse) 2 1
MIRT021509 ALPPL2 alkaline phosphatase, placental-like 2 2 1
MIRT021510 NDRG2 NDRG family member 2 2 1
MIRT021511 DTD1 D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) 2 1
MIRT021512 TPM3 tropomyosin 3 2 1
MIRT021513 MAP2K6 mitogen-activated protein kinase kinase 6 2 1
MIRT021514 CEP19 chromosome 3 open reading frame 34 2 1
MIRT021515 TPRG1 tumor protein p63 regulated 1 2 1
MIRT021516 GOLM1 golgi membrane protein 1 2 1
MIRT021517 CCDC43 coiled-coil domain containing 43 2 1
MIRT021518 MMP1 matrix metallopeptidase 1 (interstitial collagenase) 2 1
MIRT021519 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 1
MIRT021520 TMEM9B TMEM9 domain family, member B 2 1
MIRT021521 MMP12 matrix metallopeptidase 12 (macrophage elastase) 2 1
MIRT021522 MTMR14 myotubularin related protein 14 2 1
MIRT021523 ALDH3A1 aldehyde dehydrogenase 3 family, member A1 2 1
MIRT021524 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa 2 1
MIRT021525 FAM3C family with sequence similarity 3, member C 2 1
MIRT021526 LYPLA2 lysophospholipase II 2 1
MIRT021527 FAM45A family with sequence similarity 45, member A 2 1
MIRT021528 PIGF phosphatidylinositol glycan anchor biosynthesis, class F 2 1
MIRT021529 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 2 1
MIRT021530 PHF17 PHD finger protein 17 2 1
MIRT021531 NIPSNAP1 nipsnap homolog 1 (C. elegans) 2 1
MIRT021532 KREMEN1 kringle containing transmembrane protein 1 2 1
MIRT021533 MMP14 matrix metallopeptidase 14 (membrane-inserted) 2 1
MIRT021534 ABRACL chromosome 6 open reading frame 115 2 1
MIRT021535 MIXL1 Mix1 homeobox-like 1 (Xenopus laevis) 2 1
MIRT021536 TSPAN6 tetraspanin 6 2 1
MIRT021537 PODXL podocalyxin-like 2 1
MIRT021538 APH1A anterior pharynx defective 1 homolog A (C. elegans) 2 1
MIRT021539 ABHD17C family with sequence similarity 108, member C1 2 1
MIRT035522 NANOG Nanog homeobox 1 1
MIRT035535 MYO5A myosin VA (heavy chain 12, myoxin) 1 1