Accession ID: MIRT004520 [miRNA, hsa-let-7a-5p :: IGF2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7a-1LinkOut: [miRBase ]
Synonyms LET7A1, MIRNLET7A1, let-7a-1, MIRLET7A1
Description Homo sapiens let-7a-1 stem-loop
Comment let-7a-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7a-5p
Mature Sequence 6| UGAGGUAGUAGGUUGUAUAGUU |27
Evidence Experimental
Experiments Cloned
Putative hsa-let-7a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7a-5p :: IGF2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Article - Lu, L. Katsaros, D. de la Longrais, I. A. et al.
- Cancer Res, 2007
MicroRNAs (miRNA) are endogenous noncoding small RNAs that regulate the activity of mRNAs. Many miRNA genes, including let-7a-3, are located in CpG islands, suggesting possible epigenetic regulation of their expression. Promoter CpG island methylation of tumor suppressor genes is involved in cancer development and progression. Using real-time methylation-specific PCR and real-time reverse transcription-PCR, we analyzed DNA methylation in the let-7a-3 gene and miRNA expression of let-7a in 214 patients with epithelial ovarian cancer to assess the effect of let-7a-3 methylation on the expressions of let-7a as well as a possible target of let-7 regulation, insulin-like growth factor-II (IGF-II). The association of let-7a-3 methylation with patient survival outcomes was also evaluated. let-7a-3 methylation was detected in epithelial ovarian cancer, and the expression of let-7a was slightly affected by the methylation, but the effect was not substantial. The methylation of let-7a-3, however, was inversely correlated with IGF-II expression and positively with insulin-like growth factor binding protein-3 (IGFBP-3) expression. Patients with methylated let-7a-3 seemed to have reduced risk for death compared with those without, and the association was independent of patient age at surgery, tumor grade, disease stage, and IGF-II or IGFBP-3 expression. No association was found for let-7a-3 methylation and disease progression. These results suggest that the let-7a-3 gene is methylated and the methylation may affect IGF-II expression and the survival of ovarian cancer patients. Further investigation of the role of miRNAs and their regulation in cancer is warranted.
LinkOut: [PMID: 17974952]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
606 hsa-let-7a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000415 CDK6 cyclin-dependent kinase 6 4 3
MIRT000416 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000417 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 6
MIRT000418 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT000463 NKIRAS2 NFKB inhibitor interacting Ras-like 2 4 1
MIRT000708 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 4 1
MIRT001853 NF2 neurofibromin 2 (merlin) 5 2
MIRT001854 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 4 2
MIRT001855 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 4
MIRT001936 PRDM1 PR domain containing 1, with ZNF domain 4 2
MIRT002027 lin-41 Protein LIN-41 2 1
MIRT002077 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 3 4
MIRT002078 FOXA1 forkhead box A1 2 1
MIRT002079 NR1I2 nuclear receptor subfamily 1, group I, member 2 2 1
MIRT002080 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 2 1
MIRT002305 RAVER2 ribonucleoprotein, PTB-binding 2 3 1
MIRT002323 HMGA2 high mobility group AT-hook 2 5 11
MIRT003152 HMGA1 high mobility group AT-hook 1 5 5
MIRT003522 EIF2C4 eukaryotic translation initiation factor 2C, 4 2 1
MIRT003752 trim71 tripartite motif-containing 71 2 1
MIRT003902 APP amyloid beta (A4) precursor protein 2 1
MIRT003904 E2F1 E2F transcription factor 1 2 1
MIRT003974 wech CG42396 gene product from transcript CG42396-RC 2 1
MIRT004321 UHRF2 ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase 4 1
MIRT004346 DICER1 dicer 1, ribonuclease type III 4 2
MIRT004471 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 4 4
MIRT004520 IGF2 insulin-like growth factor 2 (somatomedin A) 2 1
MIRT004801 LIN28A lin-28 homolog A (C. elegans) 3 2
MIRT004830 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT004957 ZFP36L1 zinc finger protein 36, C3H type-like 1 2 1
MIRT004958 THBS1 thrombospondin 1 3 2
MIRT004959 TUSC2 tumor suppressor candidate 2 2 1
MIRT004960 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 3 3
MIRT004961 NEFM neurofilament, medium polypeptide 2 1
MIRT004962 MEIS1 Meis homeobox 1 2 1
MIRT004963 EGR3 early growth response 3 2 1
MIRT004964 HNRPDL heterogeneous nuclear ribonucleoprotein D-like 2 1
MIRT004965 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 2 1
MIRT005292 CASP3 caspase 3, apoptosis-related cysteine peptidase 3 1
MIRT005293 CASP8 caspase 8, apoptosis-related cysteine peptidase 2 1
MIRT005294 CASP9 caspase 9, apoptosis-related cysteine peptidase 2 1
MIRT005420 IL6 interleukin 6 (interferon, beta 2) 4 1
MIRT005477 E2F2 E2F transcription factor 2 4 1
MIRT005478 CCND2 cyclin D2 4 1
MIRT006055 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 3 2
MIRT006056 CDC34 cell division cycle 34 homolog (S. cerevisiae) 2 1
MIRT006152 EWSR1 Ewing sarcoma breakpoint region 1 4 1
MIRT006405 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT006813 CCR7 chemokine (C-C motif) receptor 7 3 1
MIRT032499 ACP1 acid phosphatase 1, soluble 1 1
MIRT032500 MED28 mediator complex subunit 28 1 1
MIRT032501 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT032502 SMOX spermine oxidase 1 1
MIRT032503 DAD1 defender against cell death 1 1 1
MIRT032504 RTCA RNA 3'-terminal phosphate cyclase 1 1
MIRT032505 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT032506 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 2
MIRT035534 HAS2 hyaluronan synthase 2 1 1
MIRT035541 EGFR epidermal growth factor receptor 1 1
MIRT052360 RIOK3 RIO kinase 3 (yeast) 1 1
MIRT052361 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT052362 FAM105B family with sequence similarity 105, member B 1 1
MIRT052363 TMEM39A transmembrane protein 39A 1 1
MIRT052364 UPP2 uridine phosphorylase 2 1 1
MIRT052365 SYNPR synaptoporin 1 1
MIRT052366 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT052367 MEPCE methylphosphate capping enzyme 1 1
MIRT052368 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT052369 NDUFAF3 NADH dehydrogenase (ubiquinone) complex I, assembly factor 3 1 1
MIRT052370 GP5 glycoprotein V (platelet) 1 1
MIRT052371 GPN1 GPN-loop GTPase 1 1 1
MIRT052372 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT052373 ZNF555 zinc finger protein 555 1 1
MIRT052374 UBE3C ubiquitin protein ligase E3C 1 1
MIRT052375 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT052376 MRPL15 mitochondrial ribosomal protein L15 1 1
MIRT052377 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT052378 CEP170B KIAA0284 1 1
MIRT052379 SMPDL3B sphingomyelin phosphodiesterase, acid-like 3B 1 1
MIRT052380 HIST2H2BE histone cluster 2, H2be 1 1
MIRT052381 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT052382 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 3
MIRT052383 COX2 cytochrome c oxidase subunit II 1 1
MIRT052384 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 1
MIRT052385 RRM2 ribonucleotide reductase M2 4 3
MIRT052386 FNDC3A fibronectin type III domain containing 3A 1 2
MIRT052387 ZCCHC9 zinc finger, CCHC domain containing 9 1 1
MIRT052388 CD276 CD276 molecule 1 1
MIRT052389 PHF6 PHD finger protein 6 1 1
MIRT052390 FAM13C family with sequence similarity 13, member C 1 1
MIRT052391 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT052392 ACVR1B activin A receptor, type IB 1 1
MIRT052393 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT052394 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT052395 UBAP2 ubiquitin associated protein 2 1 1
MIRT052396 RPL9 ribosomal protein L9 1 1
MIRT052397 TRIM5 tripartite motif containing 5 1 1
MIRT052398 DNAJC6 DnaJ (Hsp40) homolog, subfamily C, member 6 1 1
MIRT052399 GLUL glutamate-ammonia ligase 1 1
MIRT052400 HIST1H4D histone cluster 1, H4d 1 1
MIRT052401 FOXJ3 forkhead box J3 1 1
MIRT052402 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT052403 ACTB actin, beta 1 1
MIRT052404 NID2 nidogen 2 (osteonidogen) 1 1
MIRT052405 ANO6 anoctamin 6 1 1
MIRT052406 CS citrate synthase 1 1
MIRT052407 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT052408 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT052409 LMNA lamin A/C 1 1
MIRT052410 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT052411 JAZF1 JAZF zinc finger 1 1 1
MIRT052412 RPS3A ribosomal protein S3A 1 1
MIRT052413 ZNF629 zinc finger protein 629 1 1
MIRT052414 SIK1 salt-inducible kinase 1 1 1
MIRT052415 HIST1H1D histone cluster 1, H1d 1 1
MIRT052416 SESN2 sestrin 2 1 1
MIRT052417 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT052418 GPM6B glycoprotein M6B 1 1
MIRT052419 RPL30 ribosomal protein L30 1 1
MIRT052420 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT052421 FBXW2 F-box and WD repeat domain containing 2 1 3
MIRT052422 POU3F2 POU class 3 homeobox 2 1 1
MIRT052423 TTC22 tetratricopeptide repeat domain 22 1 1
MIRT052424 LRRC37A2 leucine rich repeat containing 37, member A2 1 1
MIRT052425 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT052426 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT052427 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT052428 KIAA2026 KIAA2026 1 1
MIRT052429 COX1 cytochrome c oxidase subunit I 1 1
MIRT052430 NAA35 N(alpha)-acetyltransferase 35, NatC auxiliary subunit 1 1
MIRT052431 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT052432 ATP6 ATP synthase F0 subunit 6 1 1
MIRT052433 GTF2I general transcription factor IIi 1 1
MIRT052434 KRTAP19-1 keratin associated protein 19-1 1 1
MIRT052435 RPL4 ribosomal protein L4 1 1
MIRT052436 TMEM165 transmembrane protein 165 1 1
MIRT052437 GTF3C5 general transcription factor IIIC, polypeptide 5, 63kDa 1 1
MIRT052438 KIAA1147 KIAA1147 1 1
MIRT052439 C9orf37 chromosome 9 open reading frame 37 1 1
MIRT052440 C11orf57 chromosome 11 open reading frame 57 1 3
MIRT052441 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT052442 ZNF609 zinc finger protein 609 1 1
MIRT052443 TMEM64 transmembrane protein 64 1 1
MIRT052444 EXPH5 exophilin 5 1 1
MIRT052445 AKAP17A A kinase (PRKA) anchor protein 17A 1 1
MIRT052446 ATG4C autophagy related 4C, cysteine peptidase 1 1
MIRT052447 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT052448 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT052449 RPS15A ribosomal protein S15a 1 1
MIRT052450 RPS10 ribosomal protein S10 1 1
MIRT052451 AGO1 eukaryotic translation initiation factor 2C, 1 4 2
MIRT052452 AOC2 amine oxidase, copper containing 2 (retina-specific) 1 1
MIRT052453 SP1 Sp1 transcription factor 1 1
MIRT052454 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT052455 CAMK2D calcium/calmodulin-dependent protein kinase II delta 1 1
MIRT052456 CD2AP CD2-associated protein 1 1
MIRT052457 H1F0 H1 histone family, member 0 1 1
MIRT052458 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT052459 RPSA ribosomal protein SA 1 1
MIRT052460 NEU3 sialidase 3 (membrane sialidase) 1 1
MIRT052461 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT052462 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT052463 ANKRD17 ankyrin repeat domain 17 1 1
MIRT052464 IPO7 importin 7 1 1
MIRT052465 CFL2 cofilin 2 (muscle) 1 1
MIRT052466 ZMYM3 zinc finger, MYM-type 3 1 1
MIRT052467 RBM6 RNA binding motif protein 6 1 1
MIRT052468 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT052469 SKA3 spindle and kinetochore associated complex subunit 3 1 1
MIRT052470 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT052471 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT052472 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 1 1
MIRT052473 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT052474 BUD13 BUD13 homolog (S. cerevisiae) 1 1
MIRT052475 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT052476 NUDT4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1 1
MIRT052477 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT052478 SPATS2 spermatogenesis associated, serine-rich 2 1 1
MIRT052479 REPS1 RALBP1 associated Eps domain containing 1 1 1
MIRT052480 TRAF7 TNF receptor-associated factor 7, E3 ubiquitin protein ligase 1 1
MIRT052481 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT052482 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT052483 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT052484 ERN1 endoplasmic reticulum to nucleus signaling 1 1 1
MIRT052485 NDUFS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) 1 1
MIRT052486 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT052487 TARS threonyl-tRNA synthetase 1 1
MIRT052488 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT052489 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT052490 LIX1L Lix1 homolog (mouse)-like 1 1
MIRT052491 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT052492 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT052493 ZNF644 zinc finger protein 644 1 2
MIRT052494 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT052495 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT052496 ZNF746 zinc finger protein 746 1 1
MIRT052497 ND2 MTND2 1 1
MIRT052498 RPS4X ribosomal protein S4, X-linked 1 1
MIRT052499 NPC1 Niemann-Pick disease, type C1 1 1
MIRT052500 ITM2B integral membrane protein 2B 1 1
MIRT052501 RPS13 ribosomal protein S13 1 1
MIRT052502 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT052503 CARHSP1 calcium regulated heat stable protein 1, 24kDa 1 1
MIRT052504 CNTRL centriolin 1 1
MIRT052505 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT052506 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 4
MIRT052507 LILRB4 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 1 1
MIRT052508 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 2
MIRT052509 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT052510 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT052511 DEGS1 delta(4)-desaturase, sphingolipid 1 1 1
MIRT052512 LTA4H leukotriene A4 hydrolase 1 1
MIRT052513 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT052514 HDAC5 histone deacetylase 5 1 1
MIRT052515 MTFR1L family with sequence similarity 54, member B 1 1
MIRT052516 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT052517 JPH4 junctophilin 4 1 1
MIRT052518 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT052519 MED13L mediator complex subunit 13-like 1 1
MIRT052520 FKBP8 FK506 binding protein 8, 38kDa 1 1
MIRT052521 ZNF780A zinc finger protein 780A 1 1
MIRT052522 BSDC1 BSD domain containing 1 1 1
MIRT052523 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT052524 SLC35A4 solute carrier family 35, member A4 1 1
MIRT052525 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT052526 B4GALNT3 beta-1,4-N-acetyl-galactosaminyl transferase 3 1 1
MIRT052527 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT052528 HOXC4 homeobox C4 1 1
MIRT052529 PTGES2 prostaglandin E synthase 2 1 1
MIRT052530 HSF2 heat shock transcription factor 2 1 1
MIRT052531 FAM171A2 family with sequence similarity 171, member A2 1 1
MIRT052532 CAND2 cullin-associated and neddylation-dissociated 2 (putative) 1 1
MIRT052533 TMEM241 transmembrane protein 241 1 1
MIRT052534 S100PBP S100P binding protein 1 1
MIRT052535 AIDA axin interactor, dorsalization associated 1 1
MIRT052536 RANBP2 RAN binding protein 2 1 1
MIRT052537 MAPK11 mitogen-activated protein kinase 11 1 1
MIRT052538 BMPR1B bone morphogenetic protein receptor, type IB 1 1
MIRT052539 ADSL adenylosuccinate lyase 1 1
MIRT052540 SNX2 sorting nexin 2 1 1
MIRT052541 MTUS1 microtubule associated tumor suppressor 1 1 4
MIRT052542 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT052543 HOXA6 homeobox A6 1 1
MIRT052544 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT052545 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 1
MIRT052546 PCIF1 PDX1 C-terminal inhibiting factor 1 1 1
MIRT052547 UBOX5 U-box domain containing 5 1 1
MIRT052548 PEX14 peroxisomal biogenesis factor 14 1 1
MIRT052549 TMX2 thioredoxin-related transmembrane protein 2 1 1
MIRT052550 RAVER1 ribonucleoprotein, PTB-binding 1 1 1
MIRT052551 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT052552 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
MIRT052553 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT052554 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 1 1
MIRT052555 CDC25B cell division cycle 25 homolog B (S. pombe) 1 1
MIRT052556 TTC26 tetratricopeptide repeat domain 26 1 1
MIRT052557 LRRC42 leucine rich repeat containing 42 1 1
MIRT052558 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT052559 GGPS1 geranylgeranyl diphosphate synthase 1 1 1
MIRT052560 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT052561 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT052562 WDR46 WD repeat domain 46 1 1
MIRT052563 TRRAP transformation/transcription domain-associated protein 1 1
MIRT052564 ARRDC3 arrestin domain containing 3 1 1
MIRT052565 MAP3K1 mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase 1 1
MIRT052566 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 2
MIRT052567 HOXB4 homeobox B4 1 1
MIRT052568 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT052569 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT052570 F2R coagulation factor II (thrombin) receptor 1 1
MIRT052571 SNX6 sorting nexin 6 1 1
MIRT052572 GADD45GIP1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 1 1
MIRT052573 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT052574 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT052575 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT052576 ANGEL2 angel homolog 2 (Drosophila) 1 1
MIRT052577 RPL35A ribosomal protein L35a 1 1
MIRT052578 FNIP1 folliculin interacting protein 1 1 1
MIRT052579 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT052580 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT052581 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT052582 BPTF bromodomain PHD finger transcription factor 1 1
MIRT052583 PAQR5 progestin and adipoQ receptor family member V 1 1
MIRT052584 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT052585 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT052586 RPS24 ribosomal protein S24 1 1
MIRT052587 WDR6 WD repeat domain 6 1 1
MIRT052588 CYP2R1 cytochrome P450, family 2, subfamily R, polypeptide 1 1 1
MIRT052589 TCERG1 transcription elongation regulator 1 1 1
MIRT052590 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT052591 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT052592 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT052593 QKI QKI, KH domain containing, RNA binding 1 1
MIRT052594 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT052595 ALDH7A1 aldehyde dehydrogenase 7 family, member A1 1 1
MIRT052596 ILKAP integrin-linked kinase-associated serine/threonine phosphatase 1 1
MIRT052597 DPH5 DPH5 homolog (S. cerevisiae) 1 1
MIRT052598 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT052599 TRIO trio Rho guanine nucleotide exchange factor 1 1
MIRT052600 NDUFAF7 NADH dehydrogenase (ubiquinone) complex I, assembly factor 7 1 1
MIRT052601 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT052602 PREB prolactin regulatory element binding 1 1
MIRT052603 BIRC6 baculoviral IAP repeat containing 6 1 1
MIRT052604 MYO9A myosin IXA 1 1
MIRT052605 RAB13 RAB13, member RAS oncogene family 1 1
MIRT052606 SMG7 smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT052607 SLC35C1 solute carrier family 35, member C1 1 1
MIRT052608 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT052609 NPTX1 neuronal pentraxin I 1 1
MIRT052610 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT052611 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT052612 NUPL1 nucleoporin like 1 1 1
MIRT052613 UNK unkempt homolog (Drosophila) 1 1
MIRT052614 COPZ1 coatomer protein complex, subunit zeta 1 1 1
MIRT052615 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT052616 TSPAN3 tetraspanin 3 1 1
MIRT052617 KCTD1 potassium channel tetramerisation domain containing 1 1 1
MIRT052618 PLOD1 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT052619 RBFOX2 RNA binding protein, fox-1 homolog (C. elegans) 2 1 6
MIRT052620 COX14 cytochrome c oxidase assembly homolog 14 (S. cerevisiae) 1 1
MIRT052621 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT052622 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT052623 C2CD4A C2 calcium-dependent domain containing 4A 1 1
MIRT052624 DSC3 desmocollin 3 1 1
MIRT052625 PDE4DIP phosphodiesterase 4D interacting protein 1 1
MIRT052626 SEL1L3 sel-1 suppressor of lin-12-like 3 (C. elegans) 1 1
MIRT052627 PALD1 phosphatase domain containing, paladin 1 1 1
MIRT052628 METTL6 methyltransferase like 6 1 1
MIRT052629 CRYBG3 beta-gamma crystallin domain containing 3 1 1
MIRT052630 ZNF264 zinc finger protein 264 1 2
MIRT052631 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT052632 ATXN2L ataxin 2-like 1 1
MIRT052633 BCOR BCL6 corepressor 1 1
MIRT052634 IARS isoleucyl-tRNA synthetase 1 1
MIRT052635 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT052636 ZNF260 zinc finger protein 260 1 1
MIRT052637 CCNB2 cyclin B2 1 1
MIRT052638 SFSWAP splicing factor, suppressor of white-apricot homolog (Drosophila) 1 1
MIRT052639 ACAD8 acyl-CoA dehydrogenase family, member 8 1 1
MIRT052640 INTS12 integrator complex subunit 12 1 1
MIRT052641 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT052642 SESN1 sestrin 1 1 1
MIRT052643 CCNG1 cyclin G1 1 1
MIRT053026 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 3 1
MIRT053129 AURKB aurora kinase B 2 1
MIRT053472 RAB40C RAB40C, member RAS oncogene family 4 2
MIRT063192 ADIPOR2 adiponectin receptor 2 1 1
MIRT065684 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 2
MIRT067397 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT068151 TXLNA taxilin alpha 1 1
MIRT068525 NHLRC3 NHL repeat containing 3 1 3
MIRT073668 IGF1R insulin-like growth factor 1 receptor 1 4
MIRT076219 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT080395 ONECUT2 one cut homeobox 2 1 1
MIRT083296 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT084972 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT094159 PCGF3 polycomb group ring finger 3 1 3
MIRT095763 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT100091 ABT1 activator of basal transcription 1 1 4
MIRT112239 MDM4 Mdm4 p53 binding protein homolog (mouse) 1 2
MIRT118582 STK4 serine/threonine kinase 4 1 1
MIRT120918 PDE12 phosphodiesterase 12 1 4
MIRT123313 CALU calumenin 1 1
MIRT123972 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT152268 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153843 NCOA3 nuclear receptor coactivator 3 1 1
MIRT180599 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT187713 SUOX sulfite oxidase 1 1
MIRT191400 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT193097 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT215716 C5ORF51 chromosome 5 open reading frame 51 1 5
MIRT240326 UBXN2B UBX domain protein 2B 1 1
MIRT244065 EDN1 endothelin 1 1 1
MIRT252326 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255310 CDV3 CDV3 homolog (mouse) 1 1
MIRT259274 PGRMC1 progesterone receptor membrane component 1 1 1
MIRT259475 TXLNG taxilin gamma 1 1
MIRT260703 CLDN12 claudin 12 1 3
MIRT266209 PEX11B peroxisomal biogenesis factor 11 beta 1 1
MIRT266622 CHTOP chromatin target of PRMT1 1 1
MIRT268835 C1ORF21 chromosome 1 open reading frame 21 1 1
MIRT284525 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT300033 BZW1 basic leucine zipper and W2 domains 1 1 2
MIRT300889 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT303316 MXD1 MAX dimerization protein 1 1 1
MIRT309842 NAT8L N-acetyltransferase 8-like (GCN5-related, putative) 1 1
MIRT324727 ACER2 alkaline ceramidase 2 1 1
MIRT402054 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT438540 DIS3L2 DIS3 mitotic control homolog (S. cerevisiae)-like 2 0 1
MIRT438636 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT442024 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT445662 ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 1 3
MIRT447140 KIF27 kinesin family member 27 1 1
MIRT448260 ZNF774 zinc finger protein 774 1 1
MIRT448999 ANKRD46 ankyrin repeat domain 46 1 1
MIRT449957 FMNL3 formin-like 3 1 1
MIRT451159 C19orf53 chromosome 19 open reading frame 53 1 1
MIRT451629 MEIS3P1 Meis homeobox 3 pseudogene 1 1 1
MIRT451698 C1RL complement component 1, r subcomponent-like 1 1
MIRT452096 NUCB2 nucleobindin 2 1 1
MIRT452435 QDPR quinoid dihydropteridine reductase 1 1
MIRT452947 DISC1 disrupted in schizophrenia 1 1 1
MIRT453406 RHD Rh blood group, D antigen 1 3
MIRT454168 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT454284 FXN frataxin 1 1
MIRT454543 RABL2A RAB, member of RAS oncogene family-like 2A 1 1
MIRT454858 ACOT9 acyl-CoA thioesterase 9 1 2
MIRT455679 GLO1 glyoxalase I 1 1
MIRT457252 RABL2B RAB, member of RAS oncogene family-like 2B 1 1
MIRT457681 ZNF587 zinc finger protein 587 1 1
MIRT457891 THEM6 thioesterase superfamily member 6 1 2
MIRT458021 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458282 FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) 1 1
MIRT459740 RRM1 ribonucleotide reductase M1 1 1
MIRT460456 NOM1 nucleolar protein with MIF4G domain 1 1 2
MIRT460503 FAM105A family with sequence similarity 105, member A 1 3
MIRT460942 NOA1 nitric oxide associated 1 1 2
MIRT461096 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461172 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 2
MIRT461368 COL8A1 collagen, type VIII, alpha 1 1 1
MIRT462386 YAE1D1 Yae1 domain containing 1 1 1
MIRT462784 ZNF8 zinc finger protein 8 1 1
MIRT463423 ZC3HAV1L zinc finger CCCH-type, antiviral 1-like 1 1
MIRT463665 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT464269 VCL vinculin 1 1
MIRT465126 TSC22D2 TSC22 domain family, member 2 1 2
MIRT466192 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466730 SYNJ2BP synaptojanin 2 binding protein 1 1
MIRT469106 RNF144B ring finger protein 144B 1 1
MIRT470415 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT470685 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 2
MIRT470857 PLXND1 plexin D1 1 1
MIRT471279 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471962 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472671 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 1 1
MIRT473139 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT473239 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT473832 MAP2K7 mitogen-activated protein kinase kinase 7 1 1
MIRT473944 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 1 1
MIRT474018 LRRC20 leucine rich repeat containing 20 1 1
MIRT474505 KLHDC8B kelch domain containing 8B 1 1
MIRT474769 KIAA0930 KIAA0930 1 1
MIRT474914 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT475335 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT475383 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT475737 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 2
MIRT476552 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT476975 FAM83G family with sequence similarity 83, member G 1 2
MIRT477536 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 2
MIRT477684 EFHD2 EF-hand domain family, member D2 1 1
MIRT479749 CCND1 cyclin D1 1 1
MIRT481192 ATXN7L3B ataxin 7-like 3B 1 2
MIRT481243 ATXN7L3 ataxin 7-like 3 1 1
MIRT481366 ATG9A autophagy related 9A 1 1
MIRT481392 ATG12 autophagy related 12 1 1
MIRT481656 AREL1 KIAA0317 1 1
MIRT481844 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 1 1
MIRT482188 AHR aryl hydrocarbon receptor 1 1
MIRT482224 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT485298 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT486663 ZNF28 zinc finger protein 28 1 1
MIRT489417 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT491866 ZBTB5 zinc finger and BTB domain containing 5 1 4
MIRT492220 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT492623 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT493329 LIMD2 LIM domain containing 2 1 1
MIRT493906 FAM43A family with sequence similarity 43, member A 1 2
MIRT494266 CEP120 centrosomal protein 120kDa 1 1
MIRT494686 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 1
MIRT495972 TBC1D19 TBC1 domain family, member 19 1 1
MIRT496116 SNX17 sorting nexin 17 1 1
MIRT497879 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT498123 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT499409 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499497 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT499658 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 1 1
MIRT499946 MFSD8 major facilitator superfamily domain containing 8 1 1
MIRT500001 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500901 STRN striatin, calmodulin binding protein 1 2
MIRT501115 SLC5A6 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1 2
MIRT501175 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 3
MIRT501205 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 1
MIRT501243 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT501325 RNFT1 ring finger protein, transmembrane 1 1 1
MIRT501348 RNF44 ring finger protein 44 1 2
MIRT501443 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT501754 NSD1 nuclear receptor binding SET domain protein 1 1 1
MIRT501942 MBD2 methyl-CpG binding domain protein 2 1 4
MIRT502102 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 4
MIRT502125 KMT2D myeloid/lymphoid or mixed-lineage leukemia 2 1 2
MIRT502781 CEP135 centrosomal protein 135kDa 1 1
MIRT502848 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT504792 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT505580 SMC1A structural maintenance of chromosomes 1A 1 3
MIRT506367 NUP155 nucleoporin 155kDa 1 3
MIRT506940 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT507246 FIGN fidgetin 1 4
MIRT507693 COIL coilin 1 3
MIRT508406 C1orf210 chromosome 1 open reading frame 210 1 3
MIRT508669 DIABLO diablo, IAP-binding mitochondrial protein 1 2
MIRT508936 AK4 adenylate kinase 4 1 2
MIRT510389 ZNF566 zinc finger protein 566 1 3
MIRT510515 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT511390 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT512749 CD59 CD59 molecule, complement regulatory protein 1 2
MIRT515958 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT516087 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 1 2
MIRT521389 RDX radixin 1 2
MIRT522352 NCKIPSD NCK interacting protein with SH3 domain 1 2
MIRT523621 FZD9 frizzled family receptor 9 1 2
MIRT523984 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT524110 DNA2 DNA replication helicase 2 homolog (yeast) 1 1
MIRT525732 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT527767 RRAD Ras-related associated with diabetes 1 1
MIRT529731 OPRL1 opiate receptor-like 1 1 1
MIRT533190 WASL Wiskott-Aldrich syndrome-like 1 3
MIRT536382 LEFTY1 left-right determination factor 1 1 1
MIRT543788 RBM12B RNA binding motif protein 12B 1 2
MIRT543872 SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1
MIRT545391 PM20D2 peptidase M20 domain containing 2 1 1
MIRT545892 ZNF200 zinc finger protein 200 1 2
MIRT546325 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547378 MSI2 musashi homolog 2 (Drosophila) 1 1
MIRT547570 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT547838 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT548270 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548350 EPHA4 EPH receptor A4 1 1
MIRT548538 DUSP1 dual specificity phosphatase 1 1 1
MIRT548561 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT548785 COLEC12 collectin sub-family member 12 1 1
MIRT548977 CCNT2 cyclin T2 1 1
MIRT549020 CBX5 chromobox homolog 5 1 1
MIRT549215 BEND4 BEN domain containing 4 1 2
MIRT549767 ZNF611 zinc finger protein 611 1 3
MIRT549803 KIAA0391 KIAA0391 1 1
MIRT549851 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT550730 PMPCA peptidase (mitochondrial processing) alpha 1 2
MIRT550902 ACTA1 actin, alpha 1, skeletal muscle 1 1
MIRT551287 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT551322 GSG2 germ cell associated 2 (haspin) 1 3
MIRT551934 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT552007 RAD18 RAD18 homolog (S. cerevisiae) 1 1
MIRT552414 ZNF460 zinc finger protein 460 1 2
MIRT553021 USP38 ubiquitin specific peptidase 38 1 1
MIRT555546 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT555720 PDZD8 PDZ domain containing 8 1 1
MIRT557371 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT557959 FAM222B family with sequence similarity 222, member B 1 1
MIRT559085 C19orf47 chromosome 19 open reading frame 47 1 2
MIRT559501 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 1
MIRT561771 PEG10 paternally expressed 10 1 1
MIRT564407 EMILIN2 elastin microfibril interfacer 2 1 2
MIRT565453 SURF4 surfeit 4 1 1
MIRT566522 PARP16 poly (ADP-ribose) polymerase family, member 16 1 1
MIRT567436 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT567716 E2F6 E2F transcription factor 6 1 1
MIRT568658 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT569502 THYN1 thymocyte nuclear protein 1 1 1
MIRT573824 TGOLN2 trans-golgi network protein 2 1 1
MIRT574367 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT574746 GOLGA4 golgin A4 1 1
MIRT574790 FAM104A family with sequence similarity 104, member A 1 1
MIRT576085 Poteg POTE ankyrin domain family, member G 1 1
MIRT576805 Thbs1 thrombospondin 1 1 1
MIRT616374 RWDD1 RWD domain containing 1 1 1
MIRT617855 FMO4 flavin containing monooxygenase 4 1 1
MIRT642398 ZNF556 zinc finger protein 556 1 1
MIRT680523 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680551 ZNF584 zinc finger protein 584 1 1
MIRT680804 ZNF578 zinc finger protein 578 1 1
MIRT680842 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT681144 INTS7 integrator complex subunit 7 1 1
MIRT681275 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT681327 ZFAND4 zinc finger, AN1-type domain 4 1 2
MIRT681363 BRI3BP BRI3 binding protein 1 1
MIRT681509 STAT2 signal transducer and activator of transcription 2, 113kDa 1 1
MIRT681540 ZNF738 zinc finger protein 738 1 1
MIRT681662 DTX3L deltex 3-like (Drosophila) 1 1
MIRT681742 RAB19 RAB19, member RAS oncogene family 1 2
MIRT681763 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 1
MIRT681801 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681873 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT681945 SLC19A3 solute carrier family 19, member 3 1 1
MIRT682106 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682186 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682242 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682388 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682448 MTX3 metaxin 3 1 1
MIRT682607 CPA4 carboxypeptidase A4 1 1
MIRT682644 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT689331 FPR1 formyl peptide receptor 1 1 1
MIRT689733 ATXN2 ataxin 2 1 1
MIRT691040 ZNF799 zinc finger protein 799 1 1
MIRT691939 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT694888 ZNF417 zinc finger protein 417 1 1
MIRT695259 ZNF443 zinc finger protein 443 1 1
MIRT695417 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT700586 PRSS22 protease, serine, 22 1 1
MIRT701426 NHLRC2 NHL repeat containing 2 1 1
MIRT702488 KIAA1328 KIAA1328 1 1
MIRT702711 IPO9 importin 9 1 1
MIRT704031 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704420 CTPS1 CTP synthase 1 1 1
MIRT705754 AMD1 adenosylmethionine decarboxylase 1 1 1
MIRT712374 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT713524 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*