Accession ID: MIRT004540 [miRNA, hsa-miR-33a-5p :: NPC1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-33aLinkOut: [miRBase ]
Synonyms MIR33, MIRN33, MIRN33A, hsa-mir-33, hsa-mir-33a, miR-33, MIR33A
Description Homo sapiens miR-33a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-33a-5p
Mature Sequence 6| GUGCAUUGUAGUUGCAUUGCA |26
Evidence Experimental
Experiments Cloned
Putative hsa-miR-33a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NPC1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms NPC
Description Niemann-Pick disease, type C1
Transcript NM_000271    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NPC1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NPC1
(miRNA target sites are highlighted)
>NPC1|NM_000271|3'UTR
   1 CCCTCTCGCAGGGCATCCTGACTGAACTGTGTCTAAGGGTCGGTCGGTTTACCACTGGACGGGTGCTGCATCGGCAAGGC
  81 CAAGTTGAACACCGGATGGTGCCAACCATCGGTTGTTTGGCAGCAGCTTTGAACGTAGCGCCTGTGAACTCAGGAATGCA
 161 CAGTTGACTTGGGAAGCAGTATTACTAGATCTGGAGGCAACCACAGGACACTAAACTTCTCCCAGCCTCTTCAGGAAAGA
 241 AACCTCATTCTTTGGCAAGCAGGAGGTGACACTAGATGGCTGTGAATGTGATCCGCTCACTGACACTCTGTAAAGGCCAA
 321 TCAATGCACTGTCTGTCTCTCCTTTTAGGAGTAAGCCATCCCACAAGTTCTATACCATATTTTTAGTGACAGTTGAGGTT
 401 GTAGATACACTTTATAACATTTTATAGTTTAAAGAGCTTTATTAATGCAATAAATTAACTTTGTACACATTTTTATATAA
 481 AAAAACAGCAAGTGATTTCAGAATGTTGTAGGCCTCATTAGAGCTTGGTCTCCAAAAATCTGTTTGAAAAAAGCAACATG
 561 TTCTTCACAGTGTTCCCCTAGAAAGGAAGAGATTTAATTGCCAGTTAGATGTGGCATGAAATGAGGGACAAAGAAAGCAT
 641 CTCGTAGGTGTGTCTACTGGGTTTTAACTTATTTTTCTTTAATAAAATACATTGTTTTCCTAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' acgUUACGUUGAUGUUACGUg 5'
             || || | | ||||||| 
Target 5' gtaAAGGCCAAT-CAATGCAc 3'
310 - 329 153.00 -11.40
2
miRNA  3' acGUUACGUUG--AU-GUUACGUg 5'
            :|| | |:|  || :|||||| 
Target 5' ttTAAAG-AGCTTTATTAATGCAa 3'
428 - 450 132.00 -7.70
3
miRNA  3' acGUUACGUUGA--UGUUACGUg 5'
            | :|| ||||  : |||||| 
Target 5' gcCTGTG-AACTCAGGAATGCAc 3'
140 - 161 124.00 -12.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-33a-5p :: NPC1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HepG2
Location of target site 3'UTR
Original Description (Extracted from the article) ... Furthermore,consistent with species-conserved miR-33 target sites, miR-33 significantly inhibited hABCA1 and hNPC1 3a?UTR\r\nactivity. ...

- Rayner, K. J. Suarez, Y. Davalos, A. et al., 2010, Science.

Article - Rayner, K. J. Suarez, Y. Davalos, A. et al.
- Science, 2010
Cholesterol metabolism is tightly regulated at the cellular level. Here, we show that miR-33, an intronic miRNA located within the gene encoding sterol-regulatory element-binding factor-2 (SREBF-2), a transcriptional regulator of cholesterol synthesis, modulates the expression of genes involved in cellular cholesterol transport. In mouse and human cells, miR-33 inhibits the expression of the ATP-binding cassette (ABC) transporter, ABCA1, thereby attenuating cholesterol efflux to apolipoprotein A1. In mouse macrophages, miR-33 targets ABCG1, reducing cholesterol efflux to nascent high-density lipoprotein (HDL). Lentiviral delivery of miR-33 to mice represses ABCA1 expression in the liver, reducing circulating HDL levels. Conversely, silencing of miR-33 in vivo increases hepatic expression of ABCA1 and plasma HDL levels. Thus, miR-33 appears to regulate both HDL biogenesis in the liver and cellular cholesterol efflux.
LinkOut: [PMID: 20466885]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-33a-5p :: NPC1    [ Functional MTI ]
Validation Method Immunofluorescence , Luciferase reporter assay , Western blot
Conditions THP 1 , THP1
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... miR-33a* specifically targets the 3’UTR of human Npc1, Crot, Irs2, Src1, Src3, and Nyfc, while miR-33b* specifically targets the 3’UTR of human Nfyc. ...

- Goedeke, L. Vales-Lara, F. M. Fenstermaker, et al., 2013, Mol Cell Biol.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ugacccUGAAACAUCCGGUcaa 5'
                |:||| ||| ::|   
Target 5' -ataacATTTTATAGTTTAaa- 3'
1 - 20
Article - Goedeke, L. Vales-Lara, F. M. Fenstermaker, et al.
- Mol Cell Biol, 2013
Hsa-miR-33a and hsa-miR-33b, intronic microRNAs (miRNAs) located within the sterol regulatory element-binding protein (Srebp)-2 and -1 genes, respectively, have recently been shown to regulate lipid homeostasis in concert with their host genes. Although the functional role of miR-33a/b has been highly investigated, the role of their passenger strands, miR-33a*/b*, remains unclear. Here, we demonstrate that miR-33a*/b* accumulate to steady-state levels in human, mouse and non-human primate tissues and share a similar lipid metabolism target gene network as their sister strands. Analogous to miR-33, miR-33* represses key enzymes involved in cholesterol efflux (ABCA1, NPC1), fatty acid metabolism (CROT, CPT1a) and insulin signaling (IRS2). Moreover, miR-33* also targets key transcriptional regulators of lipid metabolism, including SRC1, SRC3, NFYC, and RIP140. Importantly, inhibition of either miR-33 or miR-33* rescues target gene expression in cells over-expressing pre-miR-33. Consistent with this, over-expression of miR-33* reduces fatty acid oxidation in human hepatic cells. Altogether, these data support a regulatory role for the miRNA* species and suggest that miR-33 regulates lipid metabolism through both arms of the miR-33/miR-33* duplex.
LinkOut: [PMID: 23547260]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
159 hsa-miR-33a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003672 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 2 3
MIRT004540 NPC1 Niemann-Pick disease, type C1 3 2
MIRT006901 ABCB11 ATP-binding cassette, sub-family B (MDR/TAP), member 11 2 1
MIRT007354 CROT carnitine O-octanoyltransferase 2 1
MIRT007355 IRS2 insulin receptor substrate 2 2 1
MIRT007356 NFYC nuclear transcription factor Y, gamma 2 1
MIRT007357 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 2 1
MIRT007358 NCOA3 nuclear receptor coactivator 3 2 1
MIRT028182 BMI1 BMI1 polycomb ring finger oncogene 1 1
MIRT028183 PCGF2 polycomb group ring finger 2 1 1
MIRT028184 TRIM23 tripartite motif containing 23 1 1
MIRT028185 BSDC1 BSD domain containing 1 1 1
MIRT028186 TMEM65 transmembrane protein 65 1 1
MIRT028187 IER5 immediate early response 5 1 1
MIRT028188 C19orf43 chromosome 19 open reading frame 43 1 1
MIRT028189 TSG101 tumor susceptibility gene 101 1 1
MIRT028190 ZNF217 zinc finger protein 217 1 1
MIRT028191 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 1 1
MIRT028192 NCOA6 nuclear receptor coactivator 6 1 1
MIRT028193 MLX MAX-like protein X 1 1
MIRT028194 GTF2H3 general transcription factor IIH, polypeptide 3, 34kDa 1 1
MIRT028195 RHBDD1 rhomboid domain containing 1 1 1
MIRT028196 ICT1 immature colon carcinoma transcript 1 1 1
MIRT028197 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT028198 TGOLN2 trans-golgi network protein 2 1 1
MIRT028199 BCL10 B-cell CLL/lymphoma 10 1 1
MIRT028200 ERO1LB ERO1-like beta (S. cerevisiae) 1 1
MIRT028201 ERBB2IP erbb2 interacting protein 1 1
MIRT028202 KCNK1 potassium channel, subfamily K, member 1 1 1
MIRT028203 HMGB2 high mobility group box 2 1 1
MIRT028204 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT028205 CEBPG CCAAT/enhancer binding protein (C/EBP), gamma 1 1
MIRT028206 ZFYVE20 zinc finger, FYVE domain containing 20 1 1
MIRT028207 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT028208 NR2C2AP nuclear receptor 2C2-associated protein 1 1
MIRT028209 CMIP c-Maf inducing protein 1 1
MIRT028210 PIM3 pim-3 oncogene 1 1
MIRT028211 GLE1 GLE1 RNA export mediator homolog (yeast) 1 1
MIRT028212 LDHA lactate dehydrogenase A 1 1
MIRT028213 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT028214 GPR137C G protein-coupled receptor 137C 1 1
MIRT028215 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT028216 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 1
MIRT028217 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT028218 RNF19A ring finger protein 19A, E3 ubiquitin protein ligase 1 1
MIRT028219 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT028220 FBXO30 F-box protein 30 1 1
MIRT028221 STRBP spermatid perinuclear RNA binding protein 1 1
MIRT028222 LRRC8A leucine rich repeat containing 8 family, member A 1 1
MIRT028223 CSNK1G3 casein kinase 1, gamma 3 1 1
MIRT028224 RTN4 reticulon 4 1 1
MIRT028225 HOXA9 homeobox A9 1 1
MIRT028226 VTI1B vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 1 1
MIRT028227 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT028228 ANKRD29 ankyrin repeat domain 29 1 1
MIRT028229 DSC3 desmocollin 3 1 1
MIRT028230 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT028231 SERTAD2 SERTA domain containing 2 1 1
MIRT028232 EXOC4 exocyst complex component 4 1 1
MIRT028233 SGMS1 sphingomyelin synthase 1 1 1
MIRT028234 LIMA1 LIM domain and actin binding 1 1 1
MIRT028235 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT028236 BTBD2 BTB (POZ) domain containing 2 1 1
MIRT028237 PAPOLG poly(A) polymerase gamma 1 2
MIRT028238 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT028239 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT028240 KLF9 Kruppel-like factor 9 1 1
MIRT028241 RAB5A RAB5A, member RAS oncogene family 1 1
MIRT028242 FOXP1 forkhead box P1 1 1
MIRT028243 STYX serine/threonine/tyrosine interacting protein 1 1
MIRT028244 SLC39A14 solute carrier family 39 (zinc transporter), member 14 1 1
MIRT028245 PPP1R9A protein phosphatase 1, regulatory subunit 9A 1 1
MIRT028246 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT028247 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 2
MIRT028248 PIM1 pim-1 oncogene 1 1
MIRT035547 PTHLH parathyroid hormone-like hormone 1 1
MIRT049850 RUNDC3B RUN domain containing 3B 1 1
MIRT049851 RPS23 ribosomal protein S23 1 1
MIRT049852 PCM1 pericentriolar material 1 1 1
MIRT049853 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT054238 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 2
MIRT054239 FOSL1 FOS-like antigen 1 3 1
MIRT054666 SREBF1 sterol regulatory element binding transcription factor 1 2 1
MIRT054879 TWIST1 twist homolog 1 (Drosophila) 3 1
MIRT058929 FAM46C family with sequence similarity 46, member C 1 1
MIRT066499 HMGA2 high mobility group AT-hook 2 2 1
MIRT102991 RBM33 RNA binding motif protein 33 1 4
MIRT124983 XIAP X-linked inhibitor of apoptosis 1 1
MIRT207447 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT245463 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT246960 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT265218 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT282409 ABHD2 abhydrolase domain containing 2 1 1
MIRT437434 PPARA peroxisome proliferator-activated receptor alpha 2 1
MIRT437803 SP1 Sp1 transcription factor 2 1
MIRT438309 UVRAG UV radiation resistance associated gene 2 1
MIRT438310 PDE8A phosphodiesterase 8A 2 1
MIRT438436 Nsf N-ethylmaleimide sensitive fusion protein 2 1
MIRT443489 ZNF583 zinc finger protein 583 1 1
MIRT443575 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT446319 GM2A GM2 ganglioside activator 1 1
MIRT453157 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT463699 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT485085 SLC30A1 solute carrier family 30 (zinc transporter), member 1 1 2
MIRT492383 SEMA7A semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) 1 1
MIRT498233 ARHGAP15 Rho GTPase activating protein 15 1 1
MIRT500039 PABPC3 poly(A) binding protein, cytoplasmic 3 1 4
MIRT500394 ZNF281 zinc finger protein 281 1 3
MIRT501258 SECISBP2L SECIS binding protein 2-like 1 1
MIRT507144 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT511898 GAS1 growth arrest-specific 1 1 3
MIRT514071 MTRNR2L6 MT-RNR2-like 6 1 1
MIRT521018 SOCS5 suppressor of cytokine signaling 5 1 4
MIRT521426 RBBP9 retinoblastoma binding protein 9 1 1
MIRT521615 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT522805 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT533452 TRPC4 transient receptor potential cation channel, subfamily C, member 4 1 1
MIRT534135 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT534297 SKIL SKI-like oncogene 1 1
MIRT535188 PLEKHA8 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 1 1
MIRT539346 AGO2 eukaryotic translation initiation factor 2C, 2 1 2
MIRT543270 STXBP2 syntaxin binding protein 2 1 1
MIRT549443 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT550154 ZNF223 zinc finger protein 223 1 2
MIRT555658 PGM3 phosphoglucomutase 3 1 1
MIRT558285 DUSP8 dual specificity phosphatase 8 1 1
MIRT559788 ZNF415 zinc finger protein 415 1 1
MIRT560518 TMEM98 transmembrane protein 98 1 1
MIRT560766 RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 1 1
MIRT562546 CCDC71L coiled-coil domain containing 71-like 1 2
MIRT564789 ZCCHC14 zinc finger, CCHC domain containing 14 1 1
MIRT565659 SIX1 SIX homeobox 1 1 1
MIRT568642 ACTB actin, beta 1 1
MIRT611169 ZNF347 zinc finger protein 347 1 1
MIRT613981 LRRC40 leucine rich repeat containing 40 1 1
MIRT615482 EDN1 endothelin 1 1 1
MIRT615653 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT621804 TMEM170B transmembrane protein 170B 1 1
MIRT622990 ONECUT3 one cut homeobox 3 1 1
MIRT626654 FER fer (fps/fes related) tyrosine kinase 1 1
MIRT627392 TMEM170A transmembrane protein 170A 1 1
MIRT634910 RAET1E retinoic acid early transcript 1E 1 1
MIRT635904 ARPC1B actin related protein 2/3 complex, subunit 1B, 41kDa 1 1
MIRT636031 REEP1 receptor accessory protein 1 1 1
MIRT636264 RNF157 ring finger protein 157 1 1
MIRT646709 OSCP1 organic solute carrier partner 1 1 1
MIRT647693 NADSYN1 NAD synthetase 1 1 1
MIRT649750 PALLD palladin, cytoskeletal associated protein 1 1
MIRT659750 CCDC171 coiled-coil domain containing 171 1 1
MIRT660538 ARHGAP31 Rho GTPase activating protein 31 1 1
MIRT669111 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 1 1
MIRT683848 ZNF208 zinc finger protein 208 1 1
MIRT692503 SPIN4 spindlin family, member 4 1 1
MIRT698833 SSR2 signal sequence receptor, beta (translocon-associated protein beta) 1 1
MIRT699944 RTN3 reticulon 3 1 1
MIRT702627 ITGBL1 integrin, beta-like 1 (with EGF-like repeat domains) 1 1
MIRT710496 CAPRIN1 cell cycle associated protein 1 1 1
MIRT711679 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT715517 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*