Accession ID: MIRT004559 [miRNA, hsa-miR-296-5p :: WNK4, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-296LinkOut: [miRBase ]
Description Homo sapiens miR-296 stem-loop
Comment This sequence is the predicted human homologue of mouse miR-296 cloned from mouse embryonic stem cells .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-296-5p
Mature Sequence 14| AGGGCCCCCCCUCAAUCCUGU |34
Evidence Experimental
Experiments Cloned
Putative hsa-miR-296-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol WNK4 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms PHA2B, PRKWNK4
Description WNK lysine deficient protein kinase 4
Transcript NM_0323    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on WNK4 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of WNK4
(miRNA target sites are highlighted)
>WNK4|NM_0323|3'UTR
   1 TGAATTCAGAACAGAAGCCATGTATCTCCCCCACACCAGGGCCCACCATGGAGCTTGTGTTCTCAGAATCTGATGCTTTC
  81 TGATCAACAAAACTGAGCAAGGAAGATCCCAACACTGAAGGGGTAGAAGGCCAGGGGGGCATGGAGAGTGCAGCTCCATT
 161 ATAGTGAAGAGCCAAACATATGTGAACTGTTTGCTGTGTGGAGGTGTTAGTTCTGCTGCCTACCATCTTCATCTCTAGCA
 241 CCTCCCCTGCCAAGAGTCAACCACTAAGCAATCCCACCCAAGCCTGGATGCTTCTAGAGGGGCCCACTCCCAGCTGGGAG
 321 AGTGTAGGGGATATGCTCACACCACATTAGCAGCAACCAATAAAAATGCTGGAAACAAGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugUCCUAACUCCCCCCCGGGa 5'
            | | ||   | ||||||| 
Target 5' ggATGCTTCTAGAGGGGCCCa 3'
286 - 306 147.00 -16.60
2
miRNA  3' uguccuaacuccccCCCGGGa 5'
                        |||||| 
Target 5' tctcccccacaccaGGGCCCa 3'
25 - 45 120.00 -11.70
3
miRNA  3' ugUCCUAACU--C---CCCCCCGgga 5'
            :||:| ||  |   |||||||   
Target 5' aaGGGGTAGAAGGCCAGGGGGGCatg 3'
118 - 143 117.00 -21.22
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-296-5p :: WNK4    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions HEK293
Location of target site 3'UTR
Original Description (Extracted from the article) ... hWNK4 3 -UTR was the direct target of miR-296 ...

- Mao, J. Li, C. Zhang, Y. Li, Y. Zhao, Y., 2010, Int J Biochem Cell Biol.

Article - Mao, J. Li, C. Zhang, Y. Li, Y. Zhao, Y.
- Int J Biochem Cell Biol, 2010
Human with-no-lysine kinase-4 (hWNK4) is a member of the serine-threonine protein kinase family and may be involved in pathophysiological processes of hypertension through regulating diverse ion transporters. We are interested in the molecular mechanism of regulating hWNK4 expression. The 3'-untranslated region (3'-UTR) is an important area for gene regulation. Here, we focused on the 3'-UTR of hWNK4 to investigate how it regulates hWNK4 expression. A luciferase assay showed that the hWNK4 3'-UTR obviously enhanced the transcriptional activity of the promoter, whether homologous or heterologous. Chromosome conformation capture assay further demonstrated that the 3'-UTR enhancer functioned through distant crosstalking with the hWNK4 promoter in a cell-specific manner. Following the deletion of the promoter, the enhancer action of the hWNK4 3'-UTR fell away, indicating that the motifs within the promoter could be essential for the function of the hWNK4 3'-UTR. The hWNK4 3'-UTR, meanwhile, contained a miR-296 binding site, predicted by bioinformatics algorithms and verified as a true target using a reporter assay. Expression of hWNK4 can be downregulated by miR-296 at the posttranscriptional level in cell-specific pattern, shown by real-time quantitative PCR and Western blot assays. These data demonstrate the hWNK4 3'-UTR plays an enhancer role by crosstalking with the promoter, and miR-296 suppresses hWNK4 expression through targeting on its 3'-UTR in a cell-specific fashion. The coordinated modulation of miR-296 and cofactors on the 3'-UTR may be attributed to hWNK4 physiopathological function.
LinkOut: [PMID: 20561597]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
10 hsa-miR-296-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004559 WNK4 WNK lysine deficient protein kinase 4 4 1
MIRT004900 HGS hepatocyte growth factor-regulated tyrosine kinase substrate 3 1
MIRT006438 SCRIB scribbled homolog (Drosophila) 1 1
MIRT006572 IKBKE inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon 1 1
MIRT006683 BBC3 BCL2 binding component 3 3 1
MIRT035568 CCND1 cyclin D1 1 1
MIRT035569 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 1 1
MIRT035570 BAX BCL2-associated X protein 1 1
MIRT035571 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT035572 BCL2 B-cell CLL/lymphoma 2 1 1