Accession ID: MIRT004598 [miRNA, hsa-miR-301b-3p :: DNMT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-301bLinkOut: [miRBase ]
Description Homo sapiens miR-301b stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-301b-3p
Mature Sequence 45| CAGUGCAAUGAUAUUGUCAAAGC |67
Evidence Experimental
Experiments Cloned
Putative hsa-miR-301b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DNMT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIM, CXXC9, DNMT, HSN1E, MCMT
Description DNA (cytosine-5-)-methyltransferase 1
Transcript NM_001130823    LinkOut: [ RefSeq ]
Other Transcripts NM_001379   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DNMT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DNMT1
(miRNA target sites are highlighted)
>DNMT1|NM_001130823|3'UTR
   1 GCCAAAGCCCGAGAGAGTGCCTCAGCTAAAATAAAGGAGGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCC
  81 TGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTA
 161 CATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGT
 241 GCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAATTA
 321 AGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgaaacuguuauaguaACGUGAc 5'
                          |||||| 
Target 5' ccaggaatccccaacaTGCACTg 3'
92 - 114 120.00 -11.10
2
miRNA  3' cgaAAC-UGUUAU-AGUAACGUGAc 5'
             ||| :||:|| |:  ||||:| 
Target 5' aaaTTGTGCAGTACTTTGTGCATTc 3'
234 - 258 116.00 -8.60
3
miRNA  3' cgAAACUGUU---AUAGU-A-ACGUGAc 5'
            ||| | ||   | |:| | ||||:| 
Target 5' gaTTTTAAAAGTTTTTTATTATGCATTa 3'
261 - 288 109.00 -5.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-301b-3p :: DNMT1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions Mz-ChA-1
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... using luciferase reporter constructs containing the shared recognition sequence from the 3'-UTR of DNMT-1 inserted downstream of the luciferase gene//Transfection with precursors of miR-148a and miR-152 significantly modulated reporter activity in Mz-ChA-1 cells, whereas miR-301 precursor failed to show any effects ...

- Braconi, C. Huang, N. Patel, T., 2010, Hepatology.

Article - Braconi, C. Huang, N. Patel, T.
- Hepatology, 2010
Although the inflammation-associated cytokine interleukin-6 (IL-6) has been implicated in cholangiocarcinoma growth, the relationship between IL-6 and oncogenic changes is unknown. IL-6 can increase expression of DNA methyltransferase-1 (DNMT-1) and epigenetically regulate the expression of several genes, including microRNAs (miRNAs). DNMT-1 up-regulation occurs in hepatobiliary cancers and is associated with a poor prognosis. To understand the potential regulation of DNMT-1 by IL-6-dependent miRNAs, we examined the expression of a group of miRNAs which have sequence complementarity to the 3'-untranslated region of DNMT-1, namely miR-148a, miR-152, and miR-301. The expression of these miRNAs was decreased in cholangiocarcinoma cells. Moreover, the expression of all three miRNAs was decreased in IL-6-overexpressing malignant cholangiocytes in vitro and in tumor cell xenografts. There was a concomitant decrease in expression of the methylation-sensitive tumor suppressor genes Rassf1a and p16INK4a. Using luciferase reporter constructs, DNMT-1 was verified as a target for miR-148a and miR-152. Precursors to miR-148a and miR-152 decreased DNMT-1 protein expression, increased Rassf1a and p16INK4a expression, and reduced cell proliferation. Conclusion: These data indicate that IL-6 can regulate the activity of DNMT-1 and expression of methylation-dependent tumor suppressor genes by modulation of miR-148a and miR-152, and provide a link between this inflammation-associated cytokine and oncogenesis in cholangiocarcinoma. (HEPATOLOGY 2010.).
LinkOut: [PMID: 20146264]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
346 hsa-miR-301b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004598 DNMT1 DNA (cytosine-5-)-methyltransferase 1 2 1
MIRT036700 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT036702 EGFR epidermal growth factor receptor 1 1
MIRT036703 R3HDM4 R3H domain containing 4 1 1
MIRT036704 CNOT2 CCR4-NOT transcription complex, subunit 2 1 1
MIRT036705 CNIH4 cornichon homolog 4 (Drosophila) 1 1
MIRT057501 CEP55 centrosomal protein 55kDa 1 2
MIRT060512 PPP6R3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT061521 OTUD3 OTU domain containing 3 1 1
MIRT061806 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 5
MIRT062716 MLEC malectin 1 2
MIRT063603 FBXO28 F-box protein 28 1 1
MIRT064812 ZBTB18 zinc finger protein 238 1 1
MIRT065627 CLIC4 chloride intracellular channel 4 1 2
MIRT065899 RAB5B RAB5B, member RAS oncogene family 1 4
MIRT071013 SMOC1 SPARC related modular calcium binding 1 1 1
MIRT071921 ZFYVE9 zinc finger, FYVE domain containing 9 1 1
MIRT075121 C16ORF70 chromosome 16 open reading frame 70 1 2
MIRT076032 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 3
MIRT079273 NPTX1 neuronal pentraxin I 1 1
MIRT079363 CCDC137 coiled-coil domain containing 137 1 1
MIRT080234 SMAD4 SMAD family member 4 1 3
MIRT081132 LDLR low density lipoprotein receptor 1 3
MIRT083131 BTBD3 BTB (POZ) domain containing 3 1 6
MIRT083158 SEC23B Sec23 homolog B (S. cerevisiae) 1 2
MIRT086443 NABP1 nucleic acid binding protein 1 1 3
MIRT087869 CBY1 chibby homolog 1 (Drosophila) 1 2
MIRT088349 MAPRE3 microtubule-associated protein, RP/EB family, member 3 1 4
MIRT090812 MBNL1 muscleblind-like splicing regulator 1 1 2
MIRT090905 ARHGEF26 Rho guanine nucleotide exchange factor (GEF) 26 1 1
MIRT091220 USP13 ubiquitin specific peptidase 13 (isopeptidase T-3) 1 1
MIRT091701 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 3
MIRT092496 PTPRG protein tyrosine phosphatase, receptor type, G 1 1
MIRT095389 UBE2D2 ubiquitin-conjugating enzyme E2D 2 1 1
MIRT096902 ERBB2IP erbb2 interacting protein 1 1
MIRT097423 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT097466 PAPD4 PAP associated domain containing 4 1 1
MIRT099326 QKI QKI, KH domain containing, RNA binding 1 2
MIRT099842 SOX4 SRY (sex determining region Y)-box 4 1 5
MIRT100783 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 1
MIRT101822 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT102156 POP7 processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) 1 2
MIRT102237 HBP1 HMG-box transcription factor 1 1 1
MIRT102625 UBN2 ubinuclein 2 1 4
MIRT105314 VPS37A vacuolar protein sorting 37 homolog A (S. cerevisiae) 1 1
MIRT105438 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 5
MIRT105808 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT107284 FAM73B family with sequence similarity 73, member B 1 1
MIRT108269 HABP4 hyaluronan binding protein 4 1 2
MIRT108886 HPRT1 hypoxanthine phosphoribosyltransferase 1 1 1
MIRT109832 MID1IP1 MID1 interacting protein 1 1 4
MIRT123868 FZD6 frizzled family receptor 6 1 4
MIRT126577 MASTL microtubule associated serine/threonine kinase-like 1 1
MIRT130152 TXNIP thioredoxin interacting protein 1 3
MIRT132503 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT134793 CCND2 cyclin D2 1 1
MIRT139887 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT142449 TNRC6A trinucleotide repeat containing 6A 1 3
MIRT154002 PRNP prion protein 1 1
MIRT162282 LMLN leishmanolysin-like (metallopeptidase M8 family) 1 2
MIRT164541 MSMO1 methylsterol monooxygenase 1 1 1
MIRT178077 SAMD8 sterile alpha motif domain containing 8 1 1
MIRT178936 C11ORF57 chromosome 11 open reading frame 57 1 1
MIRT179074 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 3
MIRT180852 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 2
MIRT182977 TROVE2 TROVE domain family, member 2 1 1
MIRT193031 TMOD3 tropomodulin 3 (ubiquitous) 1 4
MIRT195766 ATMIN ATM interactor 1 3
MIRT196629 TAOK1 TAO kinase 1 1 3
MIRT212154 CLCN3 chloride channel, voltage-sensitive 3 1 2
MIRT217616 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT220702 MTPN myotrophin 1 2
MIRT222279 CCT6A chaperonin containing TCP1, subunit 6A (zeta 1) 1 1
MIRT223642 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 2
MIRT224763 DPYSL2 dihydropyrimidinase-like 2 1 1
MIRT227999 NFIB nuclear factor I/B 1 2
MIRT230985 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT242672 SALL3 sal-like 3 (Drosophila) 1 2
MIRT243100 LCLAT1 lysocardiolipin acyltransferase 1 1 2
MIRT244081 EDN1 endothelin 1 1 1
MIRT246463 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT248080 SLC38A2 solute carrier family 38, member 2 1 2
MIRT270944 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT295183 ZNF317 zinc finger protein 317 1 2
MIRT296536 STX16 syntaxin 16 1 1
MIRT301579 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT316379 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT323698 PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) member 2 1 2
MIRT327915 CHIC1 cysteine-rich hydrophobic domain 1 1 1
MIRT367114 ZNF711 zinc finger protein 711 1 2
MIRT368760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT407343 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT437996 TP63 tumor protein p63 2 1
MIRT448323 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT448961 CDK19 cyclin-dependent kinase 19 1 2
MIRT449148 UQCRB ubiquinol-cytochrome c reductase binding protein 1 1
MIRT454120 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT459836 TPP1 tripeptidyl peptidase I 1 1
MIRT460421 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 2
MIRT461661 G6PC glucose-6-phosphatase, catalytic subunit 1 1
MIRT462953 ZNF800 zinc finger protein 800 1 6
MIRT463643 YY1 YY1 transcription factor 1 4
MIRT464857 RPS27A ribosomal protein S27a 1 6
MIRT464875 UBB ubiquitin B 1 4
MIRT466324 THRA thyroid hormone receptor, alpha 1 1
MIRT466831 STX6 syntaxin 6 1 3
MIRT467418 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 1 2
MIRT467459 SNAPIN SNAP-associated protein 1 1
MIRT468559 SERINC3 serine incorporator 3 1 5
MIRT469814 RAB14 RAB14, member RAS oncogene family 1 1
MIRT469866 PXK PX domain containing serine/threonine kinase 1 4
MIRT470336 PPP6R1 protein phosphatase 6, regulatory subunit 1 1 1
MIRT473775 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT474743 KIF13A kinesin family member 13A 1 3
MIRT474960 KCTD10 potassium channel tetramerisation domain containing 10 1 2
MIRT475483 HSPA8 heat shock 70kDa protein 8 1 3
MIRT476299 GMFB glia maturation factor, beta 1 5
MIRT477370 EOGT EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase 1 2
MIRT477494 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT478110 DLG5 discs, large homolog 5 (Drosophila) 1 3
MIRT479817 CCNA2 cyclin A2 1 3
MIRT480017 CAPRIN2 caprin family member 2 1 2
MIRT480842 BLCAP bladder cancer associated protein 1 5
MIRT481609 ARHGAP1 Rho GTPase activating protein 1 1 3
MIRT481873 ANKRD50 ankyrin repeat domain 50 1 1
MIRT484944 ZFYVE26 zinc finger, FYVE domain containing 26 1 2
MIRT485127 SECISBP2L SECIS binding protein 2-like 1 2
MIRT485436 KLF6 Kruppel-like factor 6 1 1
MIRT485575 FOXQ1 forkhead box Q1 1 1
MIRT485648 DICER1 dicer 1, ribonuclease type III 1 4
MIRT486747 CNOT4 CCR4-NOT transcription complex, subunit 4 1 3
MIRT490888 OSBP oxysterol binding protein 1 1
MIRT491427 PDZD11 PDZ domain containing 11 1 2
MIRT491649 PDRG1 p53 and DNA-damage regulated 1 1 5
MIRT491795 ZNF24 zinc finger protein 24 1 1
MIRT492266 SIK1 salt-inducible kinase 1 1 3
MIRT493098 MMGT1 membrane magnesium transporter 1 1 6
MIRT498067 SNX5 sorting nexin 5 1 3
MIRT498878 ZNF12 zinc finger protein 12 1 5
MIRT499897 KIAA1191 KIAA1191 1 2
MIRT500403 ZMAT3 zinc finger, matrin-type 3 1 5
MIRT500499 ZBTB4 zinc finger and BTB domain containing 4 1 3
MIRT500729 TRIM37 tripartite motif containing 37 1 1
MIRT500919 STARD13 StAR-related lipid transfer (START) domain containing 13 1 2
MIRT501475 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 4
MIRT501555 POC1B-GALNT4 POC1B-GALNT4 readthrough 1 1
MIRT501788 NRBF2 nuclear receptor binding factor 2 1 3
MIRT501990 MAPK1 mitogen-activated protein kinase 1 1 5
MIRT502014 MAP7 microtubule-associated protein 7 1 4
MIRT502419 GALNT4 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) 1 1
MIRT502520 ESR1 estrogen receptor 1 1 1
MIRT502761 CLIP1 CAP-GLY domain containing linker protein 1 1 4
MIRT503047 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT503476 ZNF154 zinc finger protein 154 1 3
MIRT503679 SLC46A1 solute carrier family 46 (folate transporter), member 1 1 1
MIRT504273 PARP1 poly (ADP-ribose) polymerase 1 1 3
MIRT504557 ZNF417 zinc finger protein 417 1 3
MIRT504686 ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 1 3
MIRT505245 UBE2D3 ubiquitin-conjugating enzyme E2D 3 1 1
MIRT505874 POLR1B polymerase (RNA) I polypeptide B, 128kDa 1 2
MIRT506223 PHF12 PHD finger protein 12 1 1
MIRT506466 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 2
MIRT506509 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT506693 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT507907 CALM2 calmodulin 2 (phosphorylase kinase, delta) 1 3
MIRT509662 ZNF354B zinc finger protein 354B 1 5
MIRT510721 SPG20 spastic paraplegia 20 (Troyer syndrome) 1 3
MIRT510866 RAN RAN, member RAS oncogene family 1 4
MIRT511096 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 1 2
MIRT511250 KLHL36 kelch-like 36 (Drosophila) 1 3
MIRT513215 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT513621 VPS37B vacuolar protein sorting 37 homolog B (S. cerevisiae) 1 1
MIRT513712 RBM20 RNA binding motif protein 20 1 2
MIRT513911 GRB10 growth factor receptor-bound protein 10 1 3
MIRT514369 UBBP4 ubiquitin B pseudogene 4 1 3
MIRT517868 NCAPD2 non-SMC condensin I complex, subunit D2 1 2
MIRT521311 RRAGD Ras-related GTP binding D 1 2
MIRT521696 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 4
MIRT521774 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 4
MIRT524504 CEP170 centrosomal protein 170kDa 1 2
MIRT527462 CLEC12B C-type lectin domain family 12, member B 1 1
MIRT530128 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT530847 RAG1 recombination activating gene 1 1 2
MIRT531102 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT533493 TRIM71 tripartite motif containing 71, E3 ubiquitin protein ligase 1 1
MIRT534270 SLC12A7 solute carrier family 12 (potassium/chloride transporters), member 7 1 1
MIRT534721 RFX7 regulatory factor X, 7 1 1
MIRT535267 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 2
MIRT536340 LEFTY1 left-right determination factor 1 1 1
MIRT536408 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT538276 CUL3 cullin 3 1 2
MIRT538414 COX20 COX20 Cox2 chaperone homolog (S. cerevisiae) 1 1
MIRT539458 ADARB2 adenosine deaminase, RNA-specific, B2 1 1
MIRT540448 RBM43 RNA binding motif protein 43 1 1
MIRT541136 RAB34 RAB34, member RAS oncogene family 1 1
MIRT543571 RPF2 ribosome production factor 2 homolog (S. cerevisiae) 1 2
MIRT544108 IPMK inositol polyphosphate multikinase 1 1
MIRT544489 TRIM4 tripartite motif containing 4 1 1
MIRT544693 ZNF224 zinc finger protein 224 1 2
MIRT544988 MFF mitochondrial fission factor 1 2
MIRT546276 TMEM30A transmembrane protein 30A 1 2
MIRT546566 SATB2 SATB homeobox 2 1 1
MIRT546653 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT546771 RLIM ring finger protein, LIM domain interacting 1 1
MIRT546952 SFTPA1 surfactant protein A1 1 1
MIRT547043 POGZ pogo transposable element with ZNF domain 1 1
MIRT547491 MBNL3 muscleblind-like splicing regulator 3 1 2
MIRT547912 HOXA5 homeobox A5 1 1
MIRT548404 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 1 2
MIRT548476 EGLN3 egl nine homolog 3 (C. elegans) 1 1
MIRT548648 DAPK1 death-associated protein kinase 1 1 1
MIRT548854 CERCAM cerebral endothelial cell adhesion molecule 1 1
MIRT548892 CHEK2 checkpoint kinase 2 1 2
MIRT549139 BRWD1 bromodomain and WD repeat domain containing 1 1 2
MIRT549179 BMP3 bone morphogenetic protein 3 1 1
MIRT549331 ARHGAP12 Rho GTPase activating protein 12 1 2
MIRT549434 ACVR1 activin A receptor, type I 1 1
MIRT549458 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT549488 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT550215 MAVS mitochondrial antiviral signaling protein 1 2
MIRT551705 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT552155 DAD1 defender against cell death 1 1 1
MIRT552361 ZNF620 zinc finger protein 620 1 1
MIRT552520 ZIC5 Zic family member 5 1 1
MIRT552851 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT552888 WASL Wiskott-Aldrich syndrome-like 1 2
MIRT553310 TSPAN3 tetraspanin 3 1 1
MIRT553351 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 2
MIRT553711 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1
MIRT553898 SUN2 Sad1 and UNC84 domain containing 2 1 2
MIRT554854 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT555081 PURG purine-rich element binding protein G 1 1
MIRT555199 PRUNE2 prune homolog 2 (Drosophila) 1 1
MIRT556192 MCC mutated in colorectal cancers 1 1
MIRT556226 MB21D2 Mab-21 domain containing 2 1 1
MIRT556485 LIPA lipase A, lysosomal acid, cholesterol esterase 1 1
MIRT556968 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT557025 HOXD11 homeobox D11 1 1
MIRT557079 HOXB3 homeobox B3 1 1
MIRT557583 GNPTAB N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT558275 DYNC1LI2 dynein, cytoplasmic 1, light intermediate chain 2 1 1
MIRT558416 DEPDC1 DEP domain containing 1 1 1
MIRT558772 CFL2 cofilin 2 (muscle) 1 1
MIRT559628 AKIRIN2 akirin 2 1 1
MIRT560232 KLHL21 kelch-like 21 (Drosophila) 1 2
MIRT560652 ZNF107 zinc finger protein 107 1 1
MIRT560934 CDK2AP2 cyclin-dependent kinase 2 associated protein 2 1 1
MIRT563757 ZNF678 zinc finger protein 678 1 1
MIRT564828 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT566003 RNF11 ring finger protein 11 1 1
MIRT566153 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT566695 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT567063 KCNB1 potassium voltage-gated channel, Shab-related subfamily, member 1 1 1
MIRT567535 FGFR1OP FGFR1 oncogene partner 1 1
MIRT567768 DLC1 deleted in liver cancer 1 1 1
MIRT567830 DCUN1D3 DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) 1 1
MIRT571622 SRSF2 serine/arginine-rich splicing factor 2 1 1
MIRT573080 ABCD2 ATP-binding cassette, sub-family D (ALD), member 2 1 1
MIRT610911 NF2 neurofibromin 2 (merlin) 1 1
MIRT620059 ODF4 outer dense fiber of sperm tails 4 1 1
MIRT623180 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT627019 FIG4 FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) 1 1
MIRT627085 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT628283 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629102 F2RL1 coagulation factor II (thrombin) receptor-like 1 1 1
MIRT629242 CINP cyclin-dependent kinase 2 interacting protein 1 1
MIRT629418 ADM2 adrenomedullin 2 1 1
MIRT629593 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT629646 WDR31 WD repeat domain 31 1 1
MIRT629807 GPR82 G protein-coupled receptor 82 1 1
MIRT629881 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629925 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 1
MIRT629990 NARS asparaginyl-tRNA synthetase 1 1
MIRT630051 TERF2 telomeric repeat binding factor 2 1 1
MIRT630069 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT630164 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630259 SMTNL2 smoothelin-like 2 1 1
MIRT630289 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT630353 NKAP NFKB activating protein 1 1
MIRT630503 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT632054 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT632479 RPS15A ribosomal protein S15a 1 1
MIRT632606 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT633002 DUSP18 dual specificity phosphatase 18 1 1
MIRT633089 CXorf21 chromosome X open reading frame 21 1 1
MIRT635059 MYH11 myosin, heavy chain 11, smooth muscle 1 1
MIRT635952 PLA2G12A phospholipase A2, group XIIA 1 1
MIRT636663 CDK4 cyclin-dependent kinase 4 1 1
MIRT637194 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637933 LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 1 1
MIRT641809 USP32 ubiquitin specific peptidase 32 1 1
MIRT642651 PTGR2 prostaglandin reductase 2 1 1
MIRT644243 SLC35E3 solute carrier family 35, member E3 1 1
MIRT644672 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645100 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT646000 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646515 FAM217B family with sequence similarity 217, member B 1 1
MIRT646781 IL23R interleukin 23 receptor 1 1
MIRT648522 PIGG phosphatidylinositol glycan anchor biosynthesis, class G 1 1
MIRT651472 XIAP X-linked inhibitor of apoptosis 1 1
MIRT654356 RBM27 RNA binding motif protein 27 1 1
MIRT660834 AGO3 eukaryotic translation initiation factor 2C, 3 1 1
MIRT661186 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT661247 ARL17B ADP-ribosylation factor-like 17B 1 1
MIRT662850 OMD osteomodulin 1 1
MIRT662925 MED18 mediator complex subunit 18 1 1
MIRT663553 CCR6 chemokine (C-C motif) receptor 6 1 1
MIRT664363 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT666088 SSTR2 somatostatin receptor 2 1 1
MIRT666264 SLC31A1 solute carrier family 31 (copper transporters), member 1 1 1
MIRT666684 RBM23 RNA binding motif protein 23 1 1
MIRT667236 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT667763 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 1 1
MIRT669261 C4orf36 chromosome 4 open reading frame 36 1 1
MIRT671483 FLYWCH2 FLYWCH family member 2 1 1
MIRT671505 SLC38A9 solute carrier family 38, member 9 1 1
MIRT671933 PLEKHS1 pleckstrin homology domain containing, family S member 1 1 2
MIRT672300 GP2 glycoprotein 2 (zymogen granule membrane) 1 1
MIRT672611 IRF1 interferon regulatory factor 1 1 1
MIRT674036 ANKRD9 ankyrin repeat domain 9 1 1
MIRT674228 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674538 PRR23A proline rich 23A 1 1
MIRT675110 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 1
MIRT675276 ZNF431 zinc finger protein 431 1 1
MIRT684273 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 1 1
MIRT694283 ZNF529 zinc finger protein 529 1 2
MIRT698256 TMEM2 transmembrane protein 2 1 1
MIRT699915 RUNDC1 RUN domain containing 1 1 1
MIRT702595 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT705202 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT706930 THAP6 THAP domain containing 6 1 1
MIRT708881 MOCS2 molybdenum cofactor synthesis 2 1 1
MIRT709118 C3orf18 chromosome 3 open reading frame 18 1 1
MIRT709618 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT710592 CDCA4 cell division cycle associated 4 1 1
MIRT710796 IFNLR1 interleukin 28 receptor, alpha (interferon, lambda receptor) 1 1
MIRT711778 RFXAP regulatory factor X-associated protein 1 1
MIRT713339 KLRD1 killer cell lectin-like receptor subfamily D, member 1 1 1
MIRT713636 MED8 mediator complex subunit 8 1 1
MIRT713910 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT715064 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT715181 DTX4 deltex homolog 4 (Drosophila) 1 1
MIRT715199 FKTN fukutin 1 1
MIRT715275 RNF125 ring finger protein 125, E3 ubiquitin protein ligase 1 1
MIRT717803 FAM114A1 family with sequence similarity 114, member A1 1 1
MIRT720539 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*