Accession ID: MIRT004598 [miRNA, hsa-miR-301b :: DNMT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-301bLinkOut: [miRBase ]
Description Homo sapiens miR-301b stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-301b
Mature Sequence 45| CAGUGCAAUGAUAUUGUCAAAGC |67
Evidence Experimental
Experiments Cloned
Putative hsa-miR-301b Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DNMT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AIM, CXXC9, DNMT, FLJ16293, MCMT, MGC104992
Description DNA (cytosine-5-)-methyltransferase 1
Transcript NM_0011308    LinkOut: [ RefSeq ]
Other Transcripts NM_0013   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DNMT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DNMT1
(miRNA target sites are highlighted)
>DNMT1|NM_0011308|3'UTR
   1 GCCAAAGCCCGAGAGAGTGCCTCAGCTAAAATAAAGGAGGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCC
  81 TGTTTCTGGCACCAGGAATCCCCAACATGCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTA
 161 CATGGTGTTTGTGGCCTTGGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGT
 241 GCAGTACTTTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAATTA
 321 AGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTATAAACCAAAAAAAAAAAAAAAAAAAA
 401 AAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-301b :: DNMT1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions Mz-ChA-1
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... using luciferase reporter constructs containing the shared recognition sequence from the 3'-UTR of DNMT-1 inserted downstream of the luciferase gene//Transfection with precursors of miR-148a and miR-152 significantly modulated reporter activity in Mz-ChA-1 cells, whereas miR-301 precursor failed to show any effects ...

- Braconi, C. Huang, N. Patel, T., 2010, Hepatology.

Article - Braconi, C. Huang, N. Patel, T.
- Hepatology, 2010
Although the inflammation-associated cytokine interleukin-6 (IL-6) has been implicated in cholangiocarcinoma growth, the relationship between IL-6 and oncogenic changes is unknown. IL-6 can increase expression of DNA methyltransferase-1 (DNMT-1) and epigenetically regulate the expression of several genes, including microRNAs (miRNAs). DNMT-1 up-regulation occurs in hepatobiliary cancers and is associated with a poor prognosis. To understand the potential regulation of DNMT-1 by IL-6-dependent miRNAs, we examined the expression of a group of miRNAs which have sequence complementarity to the 3'-untranslated region of DNMT-1, namely miR-148a, miR-152, and miR-301. The expression of these miRNAs was decreased in cholangiocarcinoma cells. Moreover, the expression of all three miRNAs was decreased in IL-6-overexpressing malignant cholangiocytes in vitro and in tumor cell xenografts. There was a concomitant decrease in expression of the methylation-sensitive tumor suppressor genes Rassf1a and p16INK4a. Using luciferase reporter constructs, DNMT-1 was verified as a target for miR-148a and miR-152. Precursors to miR-148a and miR-152 decreased DNMT-1 protein expression, increased Rassf1a and p16INK4a expression, and reduced cell proliferation. Conclusion: These data indicate that IL-6 can regulate the activity of DNMT-1 and expression of methylation-dependent tumor suppressor genes by modulation of miR-148a and miR-152, and provide a link between this inflammation-associated cytokine and oncogenesis in cholangiocarcinoma. (HEPATOLOGY 2010.).
LinkOut: [PMID: 20146264]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
6 hsa-miR-301b Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004598 DNMT1 DNA (cytosine-5-)-methyltransferase 1 2 1
MIRT036700 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT036702 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT036703 R3HDM4 chromosome 19 open reading frame 22 1 1
MIRT036704 CNOT2 CCR4-NOT transcription complex, subunit 2 1 1
MIRT036705 CNIH4 cornichon homolog 4 (Drosophila) 1 1