Accession ID: MIRT004620 [miRNA, hsa-miR-486-5p :: CD40, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-486LinkOut: [miRBase ]
Synonyms MIRN486, hsa-mir-486, MIR486
Description Homo sapiens miR-486 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-486-5p
Mature Sequence 4| UCCUGUACUGAGCUGCCCCGAG |25
Evidence Experimental
Experiments Solexa
Putative hsa-miR-486-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CD40 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bp50, CDW40, MGC9013, TNFRSF5, p50
Description CD40 molecule, TNF receptor superfamily member 5
Transcript NM_1528    LinkOut: [ RefSeq ]
Other Transcripts NM_0012   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CD40 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CD40
(miRNA target sites are highlighted)
>CD40|NM_1528|3'UTR
   1 GGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGA
  81 GGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTGCTACAGGGGTTTCTGATA
 161 CCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTTGGACAAGGTCC
 241 CCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTA
 321 TCAAAAAGGTGGCCAAGAAGCCAACCAATAAGGCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGAT
 401 CTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGGTCACCCAGGAGGATGGCAAAGA
 481 GAGTCGCATCTCAGTGCAGGAGAGACAGTGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAACAGGCAGTTGGC
 561 CAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGTGAGGGGCTGGCACTGACTGGGCATAGCTCCCCGCTTCTGCCT
 641 GCACCCCTGCAGTTTGAGACAGGAGACCTGGCACTGGATGCAGAAACAGTTCACCTTGAAGAACCTCTCACTTCACCCTG
 721 GAGCCCATCCAGTCTCCCAACTTGTATTAAAGACAGAGGCAGAAGTTTGGTGGTGGTGGTGTTGGGGTATGGTTTAGTAA
 801 TATCCACCAGACCTTCCGATCCAGCAGTTTGGTGCCCAGAGAGGCATCATGGTGGCTTCCCTGCGCCCAGGAAGCCATAT
 881 ACACAGATGCCCATTGCAGCATTGTTTGTGATAGTGAACAACTGGAAGCTGCTTAACTGTCCATCAGCAGGAGACTGGCT
 961 AAATAAAATTAGAATATATTTATACAACAGAATCTCAAAAACACTGTTGAGTAAGGAAAAAAAGGCATGCTGCTGAATGA
1041 TGGGTATGGAACTTTTTAAAAAAGTACATGCTTTTATGTATGTATATTGCCTATGGATATATGTATAAATACAATATGCA
1121 TCATATATTGATATAACAAGGGTTCTGGAAGGGTACACAGAAAACCCACAGCTCGAAGAGTGGTGACGTCTGGGGTGGGG
1201 AAGAAGGGTCTGGGGG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gagcccCGUCGAGUCAUGUCCu 5'
                ||| ||||||:|||| 
Target 5' agagtcGCATCTCAGTGCAGGa 3'
480 - 501 156.00 -23.00
2
miRNA  3' gagcccCGUCGA-GUCAUGUCCu 5'
                || ||| ||||:|||| 
Target 5' aacactGCTGCTCCAGTGCAGGa 3'
413 - 435 148.00 -21.40
3
miRNA  3' gagCCC----CGUCGAGUCAUGUCCu 5'
             |||    |||| |:: |||||| 
Target 5' ttgGGGTCAAGCAGATTGCTACAGGg 3'
125 - 150 133.00 -20.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-486-5p :: CD40    [ Functional MTI ]
Validation Method Microarray , qRT-PCR , Other
Conditions A818 , ASPC1 , BxPc3 , Capan-1 , Capan-2 , HPAF-2 , MiaPaCa-2 , MPanc 96 , PANC-1 , PaTu 8902 , PaTu 8988 S , PaTu 8988 T , PT45 , Su.86.86 , Suit 0028 , Suit 007
Tools used in this research "Find miRNA Target Genes" , Literature survey , mirGen
Original Description (Extracted from the article) ... CD40 was detected as a relevant target gene for differentially expressed miRNAs observed in highly invasive and metastatic PDAC only PDAC cell-lines.//A significant overexpression (P < .05) of CD40-related miRNAs miR-224 and miR-486 was detected in highly invasive and metastatic PDAC, whereas CD40 mRNA expression was not significantly altered. Instead, CD40 protein expression at cell surfaces of these highly invasive and metastatic PDAC was significantly reduced (P < .01).//When we searched for CD40- and CD40L-targeting miRNAs in highly metastatic and highly invasive groups, we found miR-196b, miR-224, miR-424, miR-486, and miR-584 to be greatly upregulated. ...

- Mees, S. T. Mardin, W. A. Sielker, S. et al., 2009, Ann Surg Oncol.

Article - Mees, S. T. Mardin, W. A. Sielker, S. et al.
- Ann Surg Oncol, 2009
BACKGROUND: Genetic and epigenetic alterations during development of pancreatic ductal adenocarcinomas (PDAC) are well known. Genetic and epigenetic data were correlated with tumor biology to find specific alterations responsible for invasion and metastasis in pancreatic ductal adenocarcinomas. METHODS: A total of 16 human PDAC cell lines were used in murine orthotopic PDAC models. By means of standardized dissemination scores, local invasion and metastatic spread were assessed. mRNA and microRNA expression were studied by microarray and TaqMan low-density array. Quantitative real-time-polymerase chain reaction and flow cytometry were used for expression validation. RESULTS: CD40 was detected as a relevant target gene for differentially expressed miRNAs observed in highly invasive and metastatic PDAC only. A significant overexpression (P < .05) of CD40-related miRNAs miR-224 and miR-486 was detected in highly invasive and metastatic PDAC, whereas CD40 mRNA expression was not significantly altered. Instead, CD40 protein expression at cell surfaces of these highly invasive and metastatic PDAC was significantly reduced (P < .01). CONCLUSIONS: Epigenetic alterations with upregulated CD40-targeting miR-224 and miR-486 are related to downregulated CD40 protein expression at cell surfaces in highly invasive and metastatic PDAC. Thus, miRNA-regulated CD40 expression seems to play an important role in progression of PDAC. These data suggest a diagnostic and therapeutic potential for CD40 and/or its targeting miRNAs in PDAC.
LinkOut: [PMID: 19475450]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
2 hsa-miR-486-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004620 CD40 CD40 molecule, TNF receptor superfamily member 5 3 1
MIRT041623 TMED1 transmembrane emp24 protein transport domain containing 1 1 1