Accession ID: MIRT004620 [miRNA, hsa-miR-486-5p :: CD40, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-486-1LinkOut: [miRBase ]
Description Homo sapiens miR-486 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-486-5p
Mature Sequence 4| UCCUGUACUGAGCUGCCCCGAG |25
Evidence Experimental
Experiments Illumina
Putative hsa-miR-486-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CD40 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Bp50, CDW40, TNFRSF5, p50
Description CD40 molecule, TNF receptor superfamily member 5
Transcript NM_152854    LinkOut: [ RefSeq ]
Other Transcripts NM_001250   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CD40 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CD40
(miRNA target sites are highlighted)
>CD40|NM_152854|3'UTR
   1 GGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGA
  81 GGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTGCTACAGGGGTTTCTGATA
 161 CCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTTGGACAAGGTCC
 241 CCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTA
 321 TCAAAAAGGTGGCCAAGAAGCCAACCAATAAGGCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGAT
 401 CTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGGTCACCCAGGAGGATGGCAAAGA
 481 GAGTCGCATCTCAGTGCAGGAGAGACAGTGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAACAGGCAGTTGGC
 561 CAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGTGAGGGGCTGGCACTGACTGGGCATAGCTCCCCGCTTCTGCCT
 641 GCACCCCTGCAGTTTGAGACAGGAGACCTGGCACTGGATGCAGAAACAGTTCACCTTGAAGAACCTCTCACTTCACCCTG
 721 GAGCCCATCCAGTCTCCCAACTTGTATTAAAGACAGAGGCAGAAGTTTGGTGGTGGTGGTGTTGGGGTATGGTTTAGTAA
 801 TATCCACCAGACCTTCCGATCCAGCAGTTTGGTGCCCAGAGAGGCATCATGGTGGCTTCCCTGCGCCCAGGAAGCCATAT
 881 ACACAGATGCCCATTGCAGCATTGTTTGTGATAGTGAACAACTGGAAGCTGCTTAACTGTCCATCAGCAGGAGACTGGCT
 961 AAATAAAATTAGAATATATTTATACAACAGAATCTCAAAAACACTGTTGAGTAAGGAAAAAAAGGCATGCTGCTGAATGA
1041 TGGGTATGGAACTTTTTAAAAAAGTACATGCTTTTATGTATGTATATTGCCTATGGATATATGTATAAATACAATATGCA
1121 TCATATATTGATATAACAAGGGTTCTGGAAGGGTACACAGAAAACCCACAGCTCGAAGAGTGGTGACGTCTGGGGTGGGG
1201 AAGAAGGGTCTGGGGG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gagcccCGUCGAGUCAUGUCCu 5'
                ||| ||||||:|||| 
Target 5' agagtcGCATCTCAGTGCAGGa 3'
480 - 501 156.00 -23.00
2
miRNA  3' gagcccCGUCGA-GUCAUGUCCu 5'
                || ||| ||||:|||| 
Target 5' aacactGCTGCTCCAGTGCAGGa 3'
413 - 435 148.00 -21.40
3
miRNA  3' gagCCC----CGUCGAGUCAUGUCCu 5'
             |||    |||| |:: |||||| 
Target 5' ttgGGGTCAAGCAGATTGCTACAGGg 3'
125 - 150 133.00 -20.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-486-5p :: CD40    [ Functional MTI ]
Validation Method Microarray , qRT-PCR , Other
Conditions A818 , ASPC1 , BxPc3 , Capan-1 , Capan-2 , HPAF-2 , MiaPaCa-2 , MPanc 96 , PANC-1 , PaTu 8902 , PaTu 8988 S , PaTu 8988 T , PT45 , Su.86.86 , Suit 0028 , Suit 007
Tools used in this research "Find miRNA Target Genes" , Literature survey , mirGen
Original Description (Extracted from the article) ... CD40 was detected as a relevant target gene for differentially expressed miRNAs observed in highly invasive and metastatic PDAC only PDAC cell-lines.//A significant overexpression (P < .05) of CD40-related miRNAs miR-224 and miR-486 was detected in highly invasive and metastatic PDAC, whereas CD40 mRNA expression was not significantly altered. Instead, CD40 protein expression at cell surfaces of these highly invasive and metastatic PDAC was significantly reduced (P < .01).//When we searched for CD40- and CD40L-targeting miRNAs in highly metastatic and highly invasive groups, we found miR-196b, miR-224, miR-424, miR-486, and miR-584 to be greatly upregulated. ...

- Mees, S. T. Mardin, W. A. Sielker, S. et al., 2009, Ann Surg Oncol.

Article - Mees, S. T. Mardin, W. A. Sielker, S. et al.
- Ann Surg Oncol, 2009
BACKGROUND: Genetic and epigenetic alterations during development of pancreatic ductal adenocarcinomas (PDAC) are well known. Genetic and epigenetic data were correlated with tumor biology to find specific alterations responsible for invasion and metastasis in pancreatic ductal adenocarcinomas. METHODS: A total of 16 human PDAC cell lines were used in murine orthotopic PDAC models. By means of standardized dissemination scores, local invasion and metastatic spread were assessed. mRNA and microRNA expression were studied by microarray and TaqMan low-density array. Quantitative real-time-polymerase chain reaction and flow cytometry were used for expression validation. RESULTS: CD40 was detected as a relevant target gene for differentially expressed miRNAs observed in highly invasive and metastatic PDAC only. A significant overexpression (P < .05) of CD40-related miRNAs miR-224 and miR-486 was detected in highly invasive and metastatic PDAC, whereas CD40 mRNA expression was not significantly altered. Instead, CD40 protein expression at cell surfaces of these highly invasive and metastatic PDAC was significantly reduced (P < .01). CONCLUSIONS: Epigenetic alterations with upregulated CD40-targeting miR-224 and miR-486 are related to downregulated CD40 protein expression at cell surfaces in highly invasive and metastatic PDAC. Thus, miRNA-regulated CD40 expression seems to play an important role in progression of PDAC. These data suggest a diagnostic and therapeutic potential for CD40 and/or its targeting miRNAs in PDAC.
LinkOut: [PMID: 19475450]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
51 hsa-miR-486-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004620 CD40 CD40 molecule, TNF receptor superfamily member 5 3 1
MIRT041623 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT053295 ARHGAP5 Rho GTPase activating protein 5 3 1
MIRT053473 OLFM4 olfactomedin 4 4 1
MIRT054106 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT099600 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 3
MIRT218896 PIM1 pim-1 oncogene 1 1
MIRT320632 ZNRF2 zinc and ring finger 2 1 1
MIRT438711 IGF1R insulin-like growth factor 1 receptor 3 1
MIRT438814 DOCK3 dedicator of cytokinesis 3 3 1
MIRT438847 CADM1 cell adhesion molecule 1 2 2
MIRT438848 H3F3B H3 histone, family 3B (H3.3B) 2 5
MIRT445558 PCCA propionyl CoA carboxylase, alpha polypeptide 1 1
MIRT463395 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT492022 UBASH3B ubiquitin associated and SH3 domain containing B 1 1
MIRT498107 RCOR3 REST corepressor 3 1 1
MIRT505033 ZNF460 zinc finger protein 460 1 2
MIRT505067 ZIC5 Zic family member 5 1 3
MIRT507941 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT526393 CCDC14 coiled-coil domain containing 14 1 1
MIRT526937 CMSS1 cms1 ribosomal small subunit homolog (yeast) 1 1
MIRT551095 TTC8 tetratricopeptide repeat domain 8 1 1
MIRT554897 RBM12B RNA binding motif protein 12B 1 1
MIRT556147 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT557975 FAM217B family with sequence similarity 217, member B 1 1
MIRT567157 IGSF3 immunoglobulin superfamily, member 3 1 1
MIRT607348 YAE1D1 Yae1 domain containing 1 1 3
MIRT609917 SEL1L3 sel-1 suppressor of lin-12-like 3 (C. elegans) 1 2
MIRT613031 FOXP1 forkhead box P1 1 1
MIRT614413 TM4SF20 transmembrane 4 L six family member 20 1 1
MIRT623308 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT627540 SP4 Sp4 transcription factor 1 1
MIRT627643 SEC23IP SEC23 interacting protein 1 1
MIRT628696 BAG2 BCL2-associated athanogene 2 1 1
MIRT628804 WBSCR27 Williams Beuren syndrome chromosome region 27 1 1
MIRT633067 DENND5B DENN/MADD domain containing 5B 1 1
MIRT641744 MACROD2 MACRO domain containing 2 1 1
MIRT647911 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT649729 LTBP2 latent transforming growth factor beta binding protein 2 1 1
MIRT660555 ARF6 ADP-ribosylation factor 6 1 1
MIRT671018 RBM22 RNA binding motif protein 22 1 1
MIRT709194 SAPCD2 suppressor APC domain containing 2 1 1
MIRT710840 BASP1 brain abundant, membrane attached signal protein 1 1 1
MIRT711045 CENPN centromere protein N 1 1
MIRT711909 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT712889 DCTN4 dynactin 4 (p62) 1 1
MIRT713267 SPRTN SprT-like N-terminal domain 1 1
MIRT716652 EPGN epithelial mitogen homolog (mouse) 1 1
MIRT719013 HPGD hydroxyprostaglandin dehydrogenase 15-(NAD) 1 1
MIRT720270 FAM46A family with sequence similarity 46, member A 1 1
MIRT724175 ABCF2 ATP-binding cassette, sub-family F (GCN20), member 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*