Accession ID: MIRT004650 [miRNA, hsa-miR-128-3p :: TGFBR1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-128-1LinkOut: [miRBase ]
Description Homo sapiens miR-128-1 stem-loop
Comment The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical . The sequences are therefore renamed mir-128-1 and mir-128-2.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-128-3p
Mature Sequence 50| UCACAGUGAACCGGUCUCUUU |70
Evidence Experimental
Experiments Cloned
Putative hsa-miR-128-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TGFBR1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AAT5, ACVRLK4, ALK-5, ALK5, LDS1A, LDS2A, SKR4, TGFR-1
Description transforming growth factor, beta receptor 1
Transcript NM_0011309    LinkOut: [ RefSeq ]
Other Transcripts NM_0046   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TGFBR1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TGFBR1
(miRNA target sites are highlighted)
>TGFBR1|NM_0011309|3'UTR
   1 TAATTCTACAGCTTTGCCTGAACTCTCCTTTTTTCTTCAGATCTGCTCCTGGGTTTTAATTTGGGAGGTCAATTGTTCTA
  81 CCTCACTGAGAGGGAACAGAAGGATATTGCTTCCTTTTGCAGCAGTGTAATAAAGTCAATTAAAAACTTCCCAGGATTTC
 161 TTTGGACCCAGGAAACAGCCATGTGGGTCCTTTCTGTGCACTATGAACGCTTCTTTCCCAGGACAGAAAATGTGTAGTCT
 241 ACCTTTATTTTTTATTAACAAAACTTGTTTTTTAAAAAGATGATTGCTGGTCTTAACTTTAGGTAACTCTGCTGTGCTGG
 321 AGATCATCTTTAAGGGCAAAGGAGTTGGATTGCTGAATTACAATGAAACATGTCTTATTACTAAAGAAAGTGATTTACTC
 401 CTGGTTAGTACATTCTCAGAGGATTCTGAACCACTAGAGTTTCCTTGATTCAGACTTTGAATGTACTGTTCTATAGTTTT
 481 TCAGGATCTTAAAACTAACACTTATAAAACTCTTATCTTGAGTCTAAAAATGACCTCATATAGTAGTGAGGAACATAATT
 561 CATGCAATTGTATTTTGTATACTATTATTGTTCTTTCACTTATTCAGAACATTACATGCCTTCAAAATGGGATTGTACTA
 641 TACCAGTAAGTGCCACTTCTGTGTCTTTCTAATGGAAATGAGTAGAATTGCTGAAAGTCTCTATGTTAAAACCTATAGTG
 721 TTTGAATTCAAAAAGCTTATTTATCTGGGTAACCCAAACTTTTTCTGTTTTGTTTTTGGAAGGGTTTTTGTGGTATGTCA
 801 TTTGGTATTCTATTCTGAAAATGCCTTTCTCCTACCAAAATGTGCTTAAGCCACTAAAGAAATGAAGTGGCATTAATTAG
 881 TAAATTATTAGCATGGTCATGTTTGAATATTCTCACATCAAGCTTTTGCATTTTAATTGTGTTGTCTAAGTATACTTTTA
 961 AAAAATCAAGTGGCACTCTAGATGCTTATAGTACTTTAATATTTGTAGCATACAGACTAATTTTTCTAAAAGGGAAAGTC
1041 TGTCTAGCTGCTTGTGAAAAGTTATGTGGTATTCTGTAAGCCATTTTTTTCTTTATCTGTTCAAAGACTTATTTTTTAAG
1121 ACATGAATTACATTTAAAATTAGAATATGGTTAATATTAAATAATAGGCCTTTTTCTAGGAAGGCGAAGGTAGTTAATAA
1201 TTTGAATAGATAACAGATGTGCAAGAAAGTCACATTTGTTATGTATGTAGGAGTAAACGTTCGGTGGATCCTCTGTCTTT
1281 GTAACTGAGGTTAGAGCTAGTGTGGTTTTGAGGTCTCACTACACTTTGAGGAAGGCAGCTTTTAATTCAGTGTTTCCTTA
1361 TGTGTGCGTACATTGCAACTGCTTACATGTAATTTATGTAATGCATTCAGTGCACCCTTGTTACTTGGGAGAGGTGGTAG
1441 CTAAAGAACATTCTGAGTATAGGTTTTTCTCCATTTACAGATGTCTTTGGTCAAATATTGAAAGCAAACTTGTCATGGTC
1521 TTCTTACATTAAGTTGAAACTAGCTTATAATAACTGGTTTTTACTTCCAATGCTATGAAGTCTCTGCAGGGCTTTTACAG
1601 TTTTCGAAGTCCTTTTATCACTGTGATCTTATTCTGAGGGGAGAAAAAACTATCATAGCTCTGAGGCAAGACTTCGACTT
1681 TATAGTGCTATCAGTTCCCCGATACAGGGTCAGAGTAACCCATACAGTATTTTGGTCAGGAAGAGAAAGTGGCCATTTAC
1761 ACTGAATGAGTTGCATTCTGATAATGTCTTATCTCTTATACGTAGAATAAATTTGAAAGACTATTTGATCTTAAAACCAA
1841 AGTAATTTTAGAATGAGTGACATATTACATAGGAATTTAGTGTCAATTTCATGTGTTTAAAAACATCATGGGAAAAATGC
1921 TTAGAGGTTACTATTTTGACTACAAAGTTGAGTTTTTTTCTGTAGTTACCATAATTTCATTGAAGCAAATGAATGAGTTT
2001 GAGAGGTTTGTTTTTATAGTTGTGTTGTATTACTTGTTTAATAATAATCTCTAATTCTGTGATCAGGTACTTTTTTTGTG
2081 GGGGTTTTTTTTTTGTTTTTTTTTTTTTGTTGTTGTTTTTGGGCCATTTCTAAGCCTACCAGATCTGCTTTATGAAATCC
2161 AGGGGACCAATGCATTTTATCACTAAAACTATTTTTATATAATTTTAAGAATATACCAAAAGTTGTCTGATTTAAAGTTG
2241 TAATACATGATTTCTCACTTTCATGTAAGGTTATCCACTTTTGCTGAAGATATTTTTTATTGAATCAAAGATTGAGTTAC
2321 AATTATACTTTTCTTACCTAAGTGGATAAAATGTACTTTTGATGAATCAGGGAATTTTTTTAAAGTTGGAGTTTAGTTCT
2401 AAATTGACTTTACGTATTACTGCAGTTAATTCCTTTTTTGGCTAGGGATGGTTTGATAAACCACAATTGGCTGATATTGA
2481 AAATGAAAGAAACTTAAAAGGTGGGATGGATCATGATTACTGTCGATAACTGCAGATAAATTTGATTAGAGTAATAATTT
2561 TGTCATTTAAAAACACAGTTGTTTATACTGCCCATCCTAGGATGCTCACCTTCCAAGATTCAACGTGGCTAAAACATCTT
2641 CTGGTAAATTGTGCGTCCATATTCATTTTGTCAGTAGCCAGGAGAAATGGGGATGGGGGAAATACGACTTAGTGAGGCAT
2721 AGACATCCCTGGTCCATCCTTTCTGTCTCCAGCTGTTTCTTGGAACCTGCTCTCCTGCTTGCTGGTCCCTGACGCAGAGA
2801 CCGTTGCCTCCCCCACAGCCGTTTGACTGAAGGCTGCTCTGGAGACCTAGAGTAAAACGGCTGATGGAAGTTGTGGGACC
2881 CACTTCCATTTCCTTCAGTCATTAGAGGTGGAAGGGAGGGGTCTCCAAGTTTGGAGATTGAGCAGATGAGGCTTGGGATG
2961 CCCCTGCTTTGACTTCAGCCATGGATGAGGAGTGGGATGGCAGCAAGGTGGCTCCTGTGGCAGTGGAGTTGTGCCAGAAA
3041 CAGTGGCCAGTTGTATCGCCTATAAGACAGGGTAAGGTCTGAAGAGCTGAGCCTGTAATTCTGCTGTAATAATGATAGTG
3121 CTCAAGAAGTGCCTTGAGTTGGTGTACAGTGCCATGGCCATCAAGAATCCCAGATTTCAGGTTTTATTACAAAATGTAAG
3201 TGGTCACTTGGCGATTTTGTAGTACATGCATGAGTTACCTTTTTTCTCTATGTCTGAGAACTGTCAGATTAAAACAAGAT
3281 GGCAAAGAGATCGTTAGAGTGCACAACAAAATCACTATCCCATTAGACACATCATCAAAAGCTTATTTTTATTCTTGCAC
3361 TGGAAGAATCGTAAGTCAACTGTTTCTTGACCATGGCAGTGTTCTGGCTCCAAATGGTAGTGATTCCAAATAATGGTTCT
3441 GTTAACACTTTGGCAGAAAATGCCAGCTCAGATATTTTGAGATACTAAGGATTATCTTTGGACATGTACTGCAGCTTCTT
3521 GTCTCTGTTTTGGATTACTGGAATACCCATGGGCCCTCTCAAGAGTGCTGGACTTCTAGGACATTAAGATGATTGTCAGT
3601 ACATTAAACTTTTCAATCCCATTATGCAATCTTGTTTGTAAATGTAAACTTCTAAAAATATGGTTAATAACATTCAACCT
3681 GTTTATTACAACTTAAAAGGAACTTCAGTGAATTTGTTTTTATTTTTTAACAAGATTTGTGAACTGAATATCATGAACCA
3761 TGTTTTGATACCCCTTTTTCACGTTGTGCCAACGGAATAGGGTGTTTGATATTTCTTCATATGTTAAGGAGATGCTTCAA
3841 AATGTCAATTGCTTTAAACTTAAATTACCTCTCAAGAGACCAAGGTACATTTACCTCATTGTGTATATAATGTTTAATAT
3921 TTGTCAGAGCATTCTCCAGGTTTGCAGTTTTATTTCTATAAAGTATGGGTATTATGTTGCTCAGTTACTCAAATGGTACT
4001 GTATTGTTTATATTTGTACCCCAAATAACATCGTCTGTACTTTCTGTTTTCTGTATTGTATTTGTGCAGGATTCTTTAGG
4081 CTTTATCAGTGTAATCTCTGCCTTTTAAGATATGTACAGAAAATGTCCATATAAATTTCCATTGAAGTCGAATGATACTG
4161 AGAAGCCTGTAAAGAGGAGAAAAAAACATAAGCTGTGTTTCCCCATAAGTTTTTTTAAATTGTATATTGTATTTGTAGTA
4241 ATATTCCAAAAGAATGTAAATAGGAAATAGAAGAGTGATGCTTATGTTAAGTCCTAACACTACAGTAGAAGAATGGAAGC
4321 AGTGCAAATAAATTACATTTTTCCCAAGTGCCAGTGGCATATTTTAAAATAAAGTGTATACGTTGGAATGAGTCATGCCA
4401 TATGTAGTTGCTGTAGATGGCAACTAGAACCTTTGAGTTACAAGAGTCTTTAGAAGTTTTCTAACCCTGCCTAGTGCAAG
4481 TTACAATATTATAGCGTGTTCGGGGAGTGCCCTCCTGTCTGCAGGTGTGTCTCTGTGCCTGGGGGCTTTTCTCCACATGC
4561 TTAGGGGTGTGGGTCTTCCATTGGGGCATGATGGACCTGTCTACAGGTGATCTCTGTTGCCTTTGGGTCAGCACATTTGT
4641 TAGTCTCCTGGGGGTGAAAACTTGGCTTACAAGAGAACTGGAAAAATGATGAGATGTGGTCCCCAAACCCTTGATTGACT
4721 CTGGGGAGGGGCTTTGTGAATAGGATTGCTCTCACATTAAAGATAGTTACTTCAATTTGAAGGCTGGATTTAGGGATTTT
4801 TTTTTTTCCTTATAACAAAGACATCACCAGGATATGAAGCTTTTGTTGAAAGTTGGAAAAAAAGTGAAATTAAAGACATT
4881 CCCAGACAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuucUCUGGCCA--AGUGACACu 5'
              || ||  |  |||||||| 
Target 5' tcgaAGTCCTTTTATCACTGTGa 3'
1604 - 1626 151.00 -14.10
2
miRNA  3' uuUCUCUGG--CCA---------AGUGACACu 5'
            |||||||  |||         |||:|||| 
Target 5' caAGAGACCAAGGTACATTTACCTCATTGTGt 3'
3873 - 3904 145.00 -22.40
3
miRNA  3' uuUCUCUGGCCAA--GUGACACu 5'
            | :| :| |||  |||| || 
Target 5' taATGGTTCTGTTAACACTTTGg 3'
3431 - 3453 121.00 -8.01
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-128-3p :: TGFBR1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other
Conditions MCF-7
Location of target site 3'UTR
Tools used in this research miRBase Target Database , TargetScan
Original Description (Extracted from the article) ... miR-128a Targets TGFbR1 in the T ? LET R lines ...

- Masri, S. Liu, Z. Phung, S. Wang, E. Yuan, et al., 2010, Breast Cancer Res Treat.

Article - Masri, S. Liu, Z. Phung, S. Wang, E. Yuan, et al.
- Breast Cancer Res Treat, 2010
Resistance to endocrine therapy agents has presented a clinical obstacle in the treatment of hormone-dependent breast cancer. Our laboratory has initiated a study of microRNA regulation of signaling pathways that may result in breast cancer progression on aromatase inhibitors (AI). Microarray analysis of hormone refractory cell lines identified 115 differentially regulated microRNAs, of which 49 microRNAs were believed to be hormone-responsive. A group of microRNAs were inversely expressed in the AI-resistant lines versus LTEDaro and tamoxifen-resistant. We focused our work on hsa-miR-128a which was hormone-responsive and selectively up-regulated in the letrozole-resistant cell lines. Human miR-128a was predicted to target the TGFbeta signaling pathway and indeed sensitivity to TGFbeta was compromised in the letrozole-resistant cells, as compared to parental MCF-7aro. Human miR-128a was shown to negatively target TGFbetaRI protein expression by binding to the 3'UTR region of the gene. Inhibition of endogenous miR-128a resulted in resensitization of the letrozole-resistant lines to TGFbeta growth inhibitory effects. These data suggest that the hormone-responsive miR-128a can modulate TGFbeta signaling and survival of the letrozole-resistant cell lines. To our knowledge, this is the first study to address the role of microRNA regulation as well as TGFbeta signaling in AI-resistant breast cancer cell lines. We believe that in addition to estrogen-modulation of gene expression, hormone-regulated microRNAs may provide an additional level of post-transcriptional regulation of signaling pathways critically involved in breast cancer progression and AI-resistance.
LinkOut: [PMID: 20054641]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-128-3p :: TGFBR1    [ Functional MTI ]
Validation Method CLASH
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D., 2013, Cell.

Article - Helwak, A. Kudla, G. Dudnakova, T. Tollervey, D.
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
290 hsa-miR-128-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000340 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 2 2
MIRT001070 DCX doublecortin 4 1
MIRT001071 RELN reelin 4 1
MIRT003734 E2F3 E2F transcription factor 3 2 2
MIRT004353 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 2 2
MIRT004415 MLL myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 1 1
MIRT004416 AFF1 AF4/FMR2 family, member 1 1 1
MIRT004417 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT004645 BMI1 BMI1 polycomb ring finger oncogene 5 4
MIRT004650 TGFBR1 transforming growth factor, beta receptor 1 4 2
MIRT004757 FBXW7 F-box and WD repeat domain containing 7 5 2
MIRT006099 WEE1 WEE1 homolog (S. pombe) 3 2
MIRT007324 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT021868 RND1 Rho family GTPase 1 1 1
MIRT021869 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT021870 TUSC5 tumor suppressor candidate 5 1 1
MIRT021871 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 1 1
MIRT021872 EFEMP2 EGF-containing fibulin-like extracellular matrix protein 2 1 1
MIRT021873 LRRC40 leucine rich repeat containing 40 1 1
MIRT021874 RGS14 regulator of G-protein signaling 14 1 1
MIRT021875 FKBP10 FK506 binding protein 10, 65 kDa 1 1
MIRT021876 TNNI1 troponin I type 1 (skeletal, slow) 1 1
MIRT021877 JAK1 Janus kinase 1 1 1
MIRT021878 PRR11 proline rich 11 1 1
MIRT021879 CCDC6 coiled-coil domain containing 6 1 1
MIRT021880 AJUBA jub, ajuba homolog (Xenopus laevis) 1 1
MIRT021881 BOC Boc homolog (mouse) 1 1
MIRT021882 NBEA neurobeachin 1 1
MIRT021883 INTS2 integrator complex subunit 2 1 1
MIRT021884 INA internexin neuronal intermediate filament protein, alpha 1 1
MIRT021885 MOB1A MOB1, Mps One Binder kinase activator-like 1B (yeast) 1 1
MIRT021886 DCK deoxycytidine kinase 1 1
MIRT021887 ARHGAP5 Rho GTPase activating protein 5 1 1
MIRT021888 SGPP1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT021889 TSPAN13 tetraspanin 13 1 1
MIRT021890 HRASLS5 HRAS-like suppressor family, member 5 1 1
MIRT021891 GATA6 GATA binding protein 6 1 1
MIRT021892 YPEL1 yippee-like 1 (Drosophila) 1 1
MIRT021893 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT021894 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT021895 LDLR low density lipoprotein receptor 2 2
MIRT021896 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 1 1
MIRT021897 ZNF652 zinc finger protein 652 1 1
MIRT021898 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT021899 GCNT2 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) 1 1
MIRT021900 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT021901 CASC3 cancer susceptibility candidate 3 1 1
MIRT021902 UBE2W ubiquitin-conjugating enzyme E2W (putative) 1 1
MIRT021903 UNC13C unc-13 homolog C (C. elegans) 1 1
MIRT021904 NXT1 NTF2-like export factor 1 1 1
MIRT021905 KIF5B kinesin family member 5B 1 1
MIRT021906 ZIC5 Zic family member 5 (odd-paired homolog, Drosophila) 1 1
MIRT021907 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT021908 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT021909 SUPT7L suppressor of Ty 7 (S. cerevisiae)-like 1 1
MIRT021910 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT021911 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 1 1
MIRT021912 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT021913 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 1 1
MIRT021914 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT021915 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT021916 HOXC6 homeobox C6 1 1
MIRT021917 ABHD17C family with sequence similarity 108, member C1 1 1
MIRT021918 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT021919 MIER3 mesoderm induction early response 1, family member 3 1 1
MIRT021920 ZBTB18 zinc finger protein 238 1 1
MIRT021921 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 2 2
MIRT021922 EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa 1 1
MIRT021923 TUB tubby homolog (mouse) 1 2
MIRT021924 SOX2 SRY (sex determining region Y)-box 2 1 1
MIRT021925 FAM213B chromosome 1 open reading frame 93 1 1
MIRT021926 KLF4 Kruppel-like factor 4 (gut) 1 1
MIRT021927 FAM89A family with sequence similarity 89, member A 1 1
MIRT021928 CCL17 chemokine (C-C motif) ligand 17 1 1
MIRT021929 NCK2 NCK adaptor protein 2 1 1
MIRT021930 LILRB5 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 1 1
MIRT021931 ZNF552 zinc finger protein 552 1 1
MIRT021932 MCTP1 multiple C2 domains, transmembrane 1 1 1
MIRT021933 PLA2G5 phospholipase A2, group V 1 1
MIRT021934 MID2 midline 2 1 1
MIRT021935 CLDN5 claudin 5 1 1
MIRT021936 FAM9B family with sequence similarity 9, member B 1 1
MIRT021937 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT021938 STK3 serine/threonine kinase 3 (STE20 homolog, yeast) 1 1
MIRT021939 PI4K2A phosphatidylinositol 4-kinase type 2 alpha 1 1
MIRT021940 KCNJ6 potassium inwardly-rectifying channel, subfamily J, member 6 1 1
MIRT021941 HTRA4 HtrA serine peptidase 4 1 1
MIRT021942 PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 1 1
MIRT021943 CDK19 cyclin-dependent kinase 19 1 1
MIRT021944 SLC35F4 solute carrier family 35, member F4 1 1
MIRT021945 DNAJB8 DnaJ (Hsp40) homolog, subfamily B, member 8 1 1
MIRT021946 PDZRN4 PDZ domain containing ring finger 4 1 1
MIRT021947 CDH5 cadherin 5, type 2 (vascular endothelium) 1 1
MIRT021948 A2M alpha-2-macroglobulin 1 1
MIRT021949 GAS7 growth arrest-specific 7 1 1
MIRT021950 PYGO1 pygopus homolog 1 (Drosophila) 1 1
MIRT021951 CLSPN claspin homolog (Xenopus laevis) 1 1
MIRT021952 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT021953 RBM24 RNA binding motif protein 24 1 1
MIRT021954 CDY2B chromodomain protein, Y-linked, 2B 1 1
MIRT021955 ARF6 ADP-ribosylation factor 6 1 1
MIRT021956 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 1 1
MIRT021957 KNG1 kininogen 1 1 1
MIRT021958 GPR83 G protein-coupled receptor 83 1 1
MIRT021959 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT021960 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT021961 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT021962 SERTAD4 SERTA domain containing 4 1 1
MIRT021963 MARCKSL1 MARCKS-like 1 1 1
MIRT021964 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 1 1
MIRT021965 ZNF236 zinc finger protein 236 1 1
MIRT021966 CASQ2 calsequestrin 2 (cardiac muscle) 1 1
MIRT021967 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT021968 ZNF614 zinc finger protein 614 1 1
MIRT021969 TRIM36 tripartite motif-containing 36 1 1
MIRT021970 FAM49B family with sequence similarity 49, member B 1 1
MIRT021971 C8orf4 chromosome 8 open reading frame 4 1 1
MIRT021972 MOB3B MOB1, Mps One Binder kinase activator-like 2B (yeast) 1 1
MIRT021973 WNT3A wingless-type MMTV integration site family, member 3A 1 1
MIRT021974 RBBP5 retinoblastoma binding protein 5 1 1
MIRT021975 UBE2D1 ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) 1 1
MIRT021976 PTCHD1 patched domain containing 1 1 1
MIRT021977 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT021978 TSPAN6 tetraspanin 6 1 1
MIRT021979 ZBED6CL chromosome 7 open reading frame 29 1 1
MIRT021980 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT021981 GLRX glutaredoxin (thioltransferase) 1 1
MIRT021982 RFX3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT021983 GCC2 GRIP and coiled-coil domain containing 2 1 1
MIRT021984 DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 1 1
MIRT021985 SH3RF1 SH3 domain containing ring finger 1 1 1
MIRT021986 MYPN myopalladin 1 1
MIRT021987 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT021988 BAG2 BCL2-associated athanogene 2 1 1
MIRT021989 VEGFC vascular endothelial growth factor C 1 1
MIRT021990 UBE2N ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) 1 1
MIRT021991 CTSZ cathepsin Z 1 1
MIRT021992 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT021993 MYO9A myosin IXA 1 1
MIRT021994 BLOC1S2 biogenesis of lysosomal organelles complex-1, subunit 2 1 1
MIRT021995 TRMT112 tRNA methyltransferase 11-2 homolog (S. cerevisiae) 1 1
MIRT021996 YIPF5 Yip1 domain family, member 5 1 1
MIRT021997 RPL28 ribosomal protein L28 1 1
MIRT021998 KLHL23 kelch-like 23 (Drosophila) 1 1
MIRT021999 SSFA2 sperm specific antigen 2 1 1
MIRT022000 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT022001 ITPR1 inositol 1,4,5-triphosphate receptor, type 1 1 1
MIRT022002 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT022003 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT022004 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT022005 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT022006 CERK ceramide kinase 1 1
MIRT022007 MRPL44 mitochondrial ribosomal protein L44 1 1
MIRT022008 MBTD1 mbt domain containing 1 1 1
MIRT022009 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT022010 VPS4B vacuolar protein sorting 4 homolog B (S. cerevisiae) 1 1
MIRT022011 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT022012 TMEM30A transmembrane protein 30A 1 1
MIRT022013 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT022014 TUSC3 tumor suppressor candidate 3 1 1
MIRT022015 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT022016 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT022017 RNF182 ring finger protein 182 1 1
MIRT022018 TAGLN transgelin 1 1
MIRT022019 POU5F1 POU class 5 homeobox 1 1 1
MIRT022020 GOLPH3L golgi phosphoprotein 3-like 1 1
MIRT022021 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT022022 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 1 1
MIRT022023 SH3BGRL SH3 domain binding glutamic acid-rich protein like 1 1
MIRT022024 FXYD2 FXYD domain containing ion transport regulator 2 1 1
MIRT022025 VPS13D vacuolar protein sorting 13 homolog D (S. cerevisiae) 1 1
MIRT022026 ROPN1L ropporin 1-like 1 1
MIRT022027 DACT2 dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis) 1 1
MIRT022028 AZGP1 alpha-2-glycoprotein 1, zinc-binding 1 1
MIRT022029 MUC13 mucin 13, cell surface associated 1 1
MIRT022030 CD300A CD300a molecule 1 1
MIRT022031 FRA10AC1 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 1 1
MIRT022032 GDNF glial cell derived neurotrophic factor 1 1
MIRT022033 CETN1 centrin, EF-hand protein, 1 1 1
MIRT022034 PTCHD3 patched domain containing 3 1 1
MIRT022035 INTS8 integrator complex subunit 8 1 1
MIRT022036 BRCA2 breast cancer 2, early onset 1 1
MIRT022037 CLCA4 chloride channel accessory 4 1 1
MIRT022038 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT022039 BPIFB3 chromosome 20 open reading frame 185 1 1
MIRT022040 KLF5 Kruppel-like factor 5 (intestinal) 1 1
MIRT022041 HEY2 hairy/enhancer-of-split related with YRPW motif 2 1 1
MIRT022042 SLC17A4 solute carrier family 17 (sodium phosphate), member 4 1 1
MIRT022043 TUBBP1 tubulin, beta pseudogene 1 1 1
MIRT022044 SUMF1 sulfatase modifying factor 1 1 1
MIRT022045 BPGM 2,3-bisphosphoglycerate mutase 1 1
MIRT022046 RNF144B ring finger protein 144B 1 1
MIRT022047 ACSL5 acyl-CoA synthetase long-chain family member 5 1 1
MIRT022048 FYN FYN oncogene related to SRC, FGR, YES 1 1
MIRT022049 PIK3C2B phosphoinositide-3-kinase, class 2, beta polypeptide 1 1
MIRT022050 SLC22A14 solute carrier family 22, member 14 1 1
MIRT022051 SNRK SNF related kinase 1 1
MIRT022052 TBX3 T-box 3 1 1
MIRT022053 CNNM2 cyclin M2 1 1
MIRT022054 FNBP1 formin binding protein 1 1 1
MIRT022055 PHF14 PHD finger protein 14 1 1
MIRT022056 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT022057 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 1 1
MIRT022058 PDE3B phosphodiesterase 3B, cGMP-inhibited 1 1
MIRT022059 C6orf211 chromosome 6 open reading frame 211 1 1
MIRT022060 KIAA0319L KIAA0319-like 1 1
MIRT022061 EPB41L1 erythrocyte membrane protein band 4.1-like 1 1 1
MIRT022062 G6PC3 glucose 6 phosphatase, catalytic, 3 1 1
MIRT022063 TXNIP thioredoxin interacting protein 2 2
MIRT022064 SOX11 SRY (sex determining region Y)-box 11 1 1
MIRT022065 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT022066 TROVE2 TROVE domain family, member 2 1 1
MIRT022067 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT022068 ATP8A1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1 1
MIRT022069 E2F7 E2F transcription factor 7 1 1
MIRT022070 STAG1 stromal antigen 1 1 1
MIRT022071 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT022072 EYA4 eyes absent homolog 4 (Drosophila) 1 1
MIRT022073 MOB1B MOB1, Mps One Binder kinase activator-like 1A (yeast) 1 1
MIRT022074 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT022075 ALDH4A1 aldehyde dehydrogenase 4 family, member A1 1 1
MIRT022076 CLPP ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) 1 1
MIRT022077 NEK2 NIMA (never in mitosis gene a)-related kinase 2 1 1
MIRT022078 PDE3A phosphodiesterase 3A, cGMP-inhibited 1 1
MIRT022079 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 1 1
MIRT022080 SFXN2 sideroflexin 2 1 1
MIRT022081 PAGR1 chromosome 16 open reading frame 53 1 1
MIRT022082 RPS6KA5 ribosomal protein S6 kinase, 90kDa, polypeptide 5 1 1
MIRT022083 ZNF490 zinc finger protein 490 1 1
MIRT022084 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT022085 BYSL bystin-like 1 1
MIRT022086 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT022087 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT022088 ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) 1 1
MIRT022089 RAB21 RAB21, member RAS oncogene family 1 1
MIRT022090 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT022091 FOXP4 forkhead box P4 1 1
MIRT022092 LBR lamin B receptor 1 1
MIRT022093 USP25 ubiquitin specific peptidase 25 1 1
MIRT022094 LMNB1 lamin B1 1 1
MIRT022095 CD2AP CD2-associated protein 1 1
MIRT022096 TMEM170B transmembrane protein 170B 1 1
MIRT022097 MMS22L chromosome 6 open reading frame 167 1 1
MIRT022098 SLC39A7 solute carrier family 39 (zinc transporter), member 7 1 1
MIRT022099 FAM217B chromosome 20 open reading frame 177 1 1
MIRT022100 ZNF800 zinc finger protein 800 1 1
MIRT022101 AFF4 AF4/FMR2 family, member 4 1 1
MIRT022102 LITAF lipopolysaccharide-induced TNF factor 2 2
MIRT022103 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 1 1
MIRT035580 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT035581 ADORA2B adenosine A2b receptor 1 1
MIRT035582 DBI diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) 1 1
MIRT045851 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT045852 RAB22A RAB22A, member RAS oncogene family 1 1
MIRT045853 HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 1 1
MIRT045854 RPS24 ribosomal protein S24 1 1
MIRT045855 RPL21 ribosomal protein L21 1 1
MIRT045856 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT045857 NDUFC2 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa 1 1
MIRT045858 METTL25 chromosome 12 open reading frame 26 1 1
MIRT045859 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT045860 STK35 serine/threonine kinase 35 1 1
MIRT045861 CNOT1 CCR4-NOT transcription complex, subunit 1 1 1
MIRT045862 CCDC117 coiled-coil domain containing 117 1 1
MIRT045863 KPNB1 karyopherin (importin) beta 1 1 1
MIRT045864 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT045865 POP4 processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT045866 C19orf47 chromosome 19 open reading frame 47 1 1
MIRT045867 SNX11 sorting nexin 11 1 1
MIRT045868 FUBP3 far upstream element (FUSE) binding protein 3 1 1
MIRT045869 ETF1 eukaryotic translation termination factor 1 1 1
MIRT045870 SH3D19 SH3 domain containing 19 1 1
MIRT045871 C2orf72 chromosome 2 open reading frame 72 1 1
MIRT045872 ZFHX4 zinc finger homeobox 4 1 1
MIRT045873 ALDH9A1 aldehyde dehydrogenase 9 family, member A1 1 1
MIRT045874 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT045875 KDM3B lysine (K)-specific demethylase 3B 1 1
MIRT045876 SUV420H1 suppressor of variegation 4-20 homolog 1 (Drosophila) 1 1
MIRT045877 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 1
MIRT045878 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT045879 PARP1 poly (ADP-ribose) polymerase 1 1 1
MIRT045880 WDR81 WD repeat domain 81 1 1
MIRT045881 TUBB4B tubulin, beta 2C 1 1
MIRT045882 CISD1 CDGSH iron sulfur domain 1 1 1
MIRT045883 HIP1R huntingtin interacting protein 1 related 1 1
MIRT045884 GLTSCR2 glioma tumor suppressor candidate region gene 2 1 1
MIRT045885 HIATL1 hippocampus abundant transcript-like 1 1 1
MIRT045886 INO80D INO80 complex subunit D 1 1
MIRT045887 UBE2G2 ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) 1 1
MIRT045888 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1