Accession ID: MIRT004659 [miRNA, hsa-miR-26b-5p :: PTGS2, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-26bLinkOut: [miRBase ]
Synonyms MIRN26B, hsa-mir-26b, miR-26b, MIR26B
Description Homo sapiens miR-26b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-26b-5p
Mature Sequence 12| UUCAAGUAAUUCAGGAUAGGU |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-26b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PTGS2 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms COX-2, COX2, GRIPGHS, PGG/HS, PGHS-2, PHS-2, hCox-2
Description prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Transcript NM_0009    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PTGS2 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PTGS2
(miRNA target sites are highlighted)
>PTGS2|NM_0009|3'UTR
   1 TAGAAGTCTAATGATCATATTTATTTATTTATATGAACCATGTCTATTAATTTAATTATTTAATAATATTTATATTAAAC
  81 TCCTTATGTTACTTAACATCTTCTGTAACAGAAGTCAGTACTCCTGTTGCGGAGAAAGGAGTCATACTTGTGAAGACTTT
 161 TATGTCACTACTCTAAAGATTTTGCTGTTGCTGTTAAGTTTGGAAAACAGTTTTTATTCTGTTTTATAAACCAGAGAGAA
 241 ATGAGTTTTGACGTCTTTTTACTTGAATTTCAACTTATATTATAAGAACGAAAGTAAAGATGTTTGAATACTTAAACACT
 321 GTCACAAGATGGCAAAATGCTGAAAGTTTTTACACTGTCGATGTTTCCAATGCATCTTCCATGATGCATTAGAAGTAACT
 401 AATGTTTGAAATTTTAAAGTACTTTTGGTTATTTTTCTGTCATCAAACAAAAACAGGTATCAGTGCATTATTAAATGAAT
 481 ATTTAAATTAGACATTACCAGTAATTTCATGTCTACTTTTTAAAATCAGCAATGAAACAATAATTTGAAATTTCTAAATT
 561 CATAGGGTAGAATCACCTGTAAAAGCTTGTTTGATTTCTTAAAGTTATTAAACTTGTACATATACCAAAAAGAAGCTGTC
 641 TTGGATTTAAATCTGTAAAATCAGTAGAAATTTTACTACAATTGCTTGTTAAAATATTTTATAAGTGATGTTCCTTTTTC
 721 ACCAAGAGTATAAACCTTTTTAGTGTGACTGTTAAAACTTCCTTTTAAATCAAAATGCCAAATTTATTAAGGTGGTGGAG
 801 CCACTGCAGTGTTATCTTAAAATAAGAATATTTTGTTGAGATATTCCAGAATTTGTTTATATGGCTGGTAACATGTAAAA
 881 TCTATATCAGCAAAAGGGTCTACCTTTAAAATAAGCAATAACAAAGAAGAAAACCAAATTATTGTTCAAATTTAGGTTTA
 961 AACTTTTGAAGCAAACTTTTTTTTATCCTTGTGCACTGCAGGCCTGGTACTCAGATTTTGCTATGAGGTTAATGAAGTAC
1041 CAAGCTGTGCTTGAATAATGATATGTTTTCTCAGATTTTCTGTTGTACAGTTTAATTTAGCAGTCCATATCACATTGCAA
1121 AAGTAGCAATGACCTCATAAAATACCTCTTCAAAATGCTTAAATTCATTTCACACATTAATTTTATCTCAGTCTTGAAGC
1201 CAATTCAGTAGGTGCATTGGAATCAAGCCTGGCTACCTGCATGCTGTTCCTTTTCTTTTCTTCTTTTAGCCATTTTGCTA
1281 AGAGACACAGTCTTCTCATCACTTCGTTTCTCCTATTTTGTTTTACTAGTTTTAAGATCAGAGTTCACTTTCTTTGGACT
1361 CTGCCTATATTTTCTTACCTGAACTTTTGCAAGTTTTCAGGTAAACCTCAGCTCAGGACTGCTATTTAGCTCCTCTTAAG
1441 AAGATTAAAAGAGAAAAAAAAAGGCCCTTTTAAAAATAGTATACACTTATTTTAAGTGAAAAGCAGAGAATTTTATTTAT
1521 AGCTAATTTTAGCTATCTGTAACCAAGATGGATGCAAAGAGGCTAGTGCCTCAGAGAGAACTGTACGGGGTTTGTGACTG
1601 GAAAAAGTTACGTTCCCATTCTAATTAATGCCCTTTCTTATTTAAAAACAAAACCAAATGATATCTAAGTAGTTCTCAGC
1681 AATAATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATTTAATGGTACTGTATATTACTTAATTT
1761 ATTGAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATAAACTGTGTTTAAGCCTACAATCATTGATTTTTTTTT
1841 GTTATGTCACAATCAGTATATCTTCTTTGGGGTTACCTCTCTGAATATTATGTAAACAATCCAAAGAAATGATTGTATTA
1921 AGATTTGTGAATAAATTTTTAGAAATCTGATTGGCATATTGAGATATTTAAGGTTGAATGTTTGTCCTTAGGATAGGCCT
2001 ATGTGCTAGCCCACAAAGAATATTGTCTCATTAGCCTGAATGTGCCATAAGACTGACCTTTTAAAATGTTTTGAGGGATC
2081 TGTGGATGCTTCGTTAATTTGTTCAGCCACAATTTATTGAGAAAATATTCTGTGTCAAGCACTGTGGGTTTTAATATTTT
2161 TAAATCAAACGCTGATTACAGATAATAGTATTTATATAAATAATTGAAAAAAATTTTCTTTTGGGAAGAGGGAGAAAATG
2241 AAATAAATATCATTAAAGATAACTCAGGAGAATCTTCTTTACAATTTTACGTTTAGAATGTTTAAGGTTAAGAAAGAAAT
2321 AGTCAATATGCTTGTATAAAACACTGTTCACTGTTTTTTTTAAAAAAAAAACTTGATTTGTTATTAACATTGATCTGCTG
2401 ACAAAACCTGGGAATTTGGGTTGTGTATGCGAATGTTTCAGTGCCTCAGACAAATGTGTATTTAACTTATGTAAAAGATA
2481 AGTCTGGAAATAAATGTCTGTTTATTTTTGTACTATTTAAAAATTGACAGATCTTTTCTGAAGAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uggaUAGGACUUAAUGAACUu 5'
              :||:|   |||||||| 
Target 5' tgacGTCTT--TTTACTTGAa 3'
249 - 267 149.00 -10.30
2
miRNA  3' uggauAGGACU-UAAUGAACUu 5'
               |||| | :|||||| | 
Target 5' taaacTCCTTATGTTACTTAAc 3'
76 - 97 128.00 -6.80
3
miRNA  3' ugGAUAGGACUUAAUGAACUu 5'
            | |  |||   |:||||| 
Target 5' taCCAAGCTG---TGCTTGAa 3'
1038 - 1055 128.00 -9.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-26b-5p :: PTGS2    [ Functional MTI ]
Validation Method Luciferase reporter assay , Western blot , Other , Reporter assay
Conditions 293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... luciferase activity signii??cantly decreased after co-transfection with PGL3/COX-2 3`-UTR and miR-26b, compared with control cells co-transfected with PGL3/COX-2 3`-UTR and miR-NC ...

- Ji, Y. He, Y. Liu, L. Zhong, X., 2010, FEBS Lett.

Article - Ji, Y. He, Y. Liu, L. Zhong, X.
- FEBS Lett, 2010
Here we report that miR-26b is involved in COX-2 overexpression in desferrioxamine (DFOM)-treated carcinoma of nasopharyngeal epithelial (CNE) cells. The level of miR-26b in DFOM-treated CNE cells is inversely proportional to the expression level of the COX-2 protein. Overexpression of miR-26b in DFOM-treated CNE cells inhibits cell proliferation. A luciferase reporter gene experiment suggests that the 3' untranslated region of COX-2 carries a binding site for miR-26b. Overexpression of miR-26b marginally reduces the levels of COX-2 protein in DFOM-treated CNE cells. Moreover, knockdown of COX-2 expression had a similar effect to overexpression of miR-26b. Taken together, these results suggest that miR-26b regulates COX-2 expression in DFOM-treated cells.
LinkOut: [PMID: 20100477]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
1637 hsa-miR-26b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002312 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT003604 EP300 E1A binding protein p300 2 1
MIRT004659 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) 3 1
MIRT005508 EPHA2 EPH receptor A2 4 1
MIRT006307 CDK6 cyclin-dependent kinase 6 2 1
MIRT006308 CCNE1 cyclin E1 2 1
MIRT006713 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 3 2
MIRT006715 ARL4C ADP-ribosylation factor-like 4C 2 1
MIRT006808 GATA4 GATA binding protein 4 3 1
MIRT028745 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 1 1
MIRT028746 DEFA3 defensin, alpha 3, neutrophil-specific 1 1
MIRT028747 ZNF324B zinc finger protein 324B 1 1
MIRT028748 SIDT1 SID1 transmembrane family, member 1 1 1
MIRT028749 NDUFB4 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa 1 1
MIRT028750 PVALB parvalbumin 1 1
MIRT028751 ARRB1 arrestin, beta 1 1 1
MIRT028752 MDH1 malate dehydrogenase 1, NAD (soluble) 1 1
MIRT028753 PARP4 poly (ADP-ribose) polymerase family, member 4 1 1
MIRT028754 FKBP2 FK506 binding protein 2, 13kDa 1 1
MIRT028755 TIMP1 TIMP metallopeptidase inhibitor 1 1 1
MIRT028756 SPRY2 sprouty homolog 2 (Drosophila) 1 1
MIRT028757 TP53TG5 TP53 target 5 1 1
MIRT028758 CRYGC crystallin, gamma C 1 1
MIRT028759 NYX nyctalopin 1 1
MIRT028760 PRYP4 PTPN13-like, Y-linked pseudogene 4 1 1
MIRT028761 KLRC1 killer cell lectin-like receptor subfamily C, member 1 1 1
MIRT028762 FOXE1 forkhead box E1 (thyroid transcription factor 2) 1 1
MIRT028763 MRPS28 mitochondrial ribosomal protein S28 1 1
MIRT028764 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1
MIRT028765 CYB561D2 cytochrome b-561 domain containing 2 1 1
MIRT028766 TRMT2B TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae) 1 1
MIRT028767 PRICKLE3 prickle homolog 3 (Drosophila) 1 1
MIRT028768 LIG4 ligase IV, DNA, ATP-dependent 1 1
MIRT028769 ZDHHC7 zinc finger, DHHC-type containing 7 1 1
MIRT028770 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT028771 MAGEA9 melanoma antigen family A, 9 1 1
MIRT028772 ELAVL3 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) 1 1
MIRT028773 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT028774 SOX5 SRY (sex determining region Y)-box 5 1 1
MIRT028775 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 1 1
MIRT028776 LRRC2 leucine rich repeat containing 2 1 1
MIRT028777 DONSON downstream neighbor of SON 1 1
MIRT028778 ALG3 asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT028779 C1GALT1C1 C1GALT1-specific chaperone 1 1 1
MIRT028780 CA1 carbonic anhydrase I 1 1
MIRT028781 WDR83OS chromosome 19 open reading frame 56 1 1
MIRT028782 SRP14 signal recognition particle 14kDa (homologous Alu RNA binding protein) 1 1
MIRT028783 TAX1BP3 Tax1 (human T-cell leukemia virus type I) binding protein 3 1 1
MIRT028784 TRIM13 tripartite motif-containing 13 1 1
MIRT028785 NMRK1 chromosome 9 open reading frame 95 1 1
MIRT028786 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT028787 ZSCAN16 zinc finger and SCAN domain containing 16 1 1
MIRT028788 RSAD2 radical S-adenosyl methionine domain containing 2 1 1
MIRT028789 TMEM165 transmembrane protein 165 1 1
MIRT028790 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT028791 PODXL podocalyxin-like 1 1
MIRT028792 PSMC1 proteasome (prosome, macropain) 26S subunit, ATPase, 1 1 1
MIRT028793 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT028794 USB1 chromosome 16 open reading frame 57 1 1
MIRT028795 DUSP1 dual specificity phosphatase 1 1 1
MIRT028796 RNASE1 ribonuclease, RNase A family, 1 (pancreatic) 1 1
MIRT028797 FOXF2 forkhead box F2 1 1
MIRT028798 PIGA phosphatidylinositol glycan anchor biosynthesis, class A 1 1
MIRT028799 LHX6 LIM homeobox 6 1 1
MIRT028800 TUBD1 tubulin, delta 1 1 1
MIRT028801 FAM212B chromosome 1 open reading frame 183 1 1
MIRT028802 C6orf15 chromosome 6 open reading frame 15 1 1
MIRT028803 EMC6 transmembrane protein 93 1 1
MIRT028804 CDKL2 cyclin-dependent kinase-like 2 (CDC2-related kinase) 1 1
MIRT028805 TSPAN13 tetraspanin 13 1 1
MIRT028806 BGLAP bone gamma-carboxyglutamate (gla) protein 1 1
MIRT028807 MARCH3 membrane-associated ring finger (C3HC4) 3 1 1
MIRT028808 ATP5SL ATP5S-like 1 1
MIRT028809 SNRNP70 small nuclear ribonucleoprotein 70kDa (U1) 1 1
MIRT028810 DBNL drebrin-like 1 1
MIRT028811 PCDHB8 protocadherin beta 8 1 1
MIRT028812 ACN9 ACN9 homolog (S. cerevisiae) 1 1
MIRT028813 ICT1 immature colon carcinoma transcript 1 1 1
MIRT028814 COQ2 coenzyme Q2 homolog, prenyltransferase (yeast) 1 1
MIRT028815 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 1
MIRT028816 VNN2 vanin 2 1 1
MIRT028817 PPAP2A phosphatidic acid phosphatase type 2A 1 1
MIRT028818 CHMP6 chromatin modifying protein 6 1 1
MIRT028819 RXRB retinoid X receptor, beta 1 1
MIRT028820 AUP1 ancient ubiquitous protein 1 1 1
MIRT028821 PLCB2 phospholipase C, beta 2 1 1
MIRT028822 OTC ornithine carbamoyltransferase 1 1
MIRT028823 S100A1 S100 calcium binding protein A1 1 1
MIRT028824 MEP1A meprin A, alpha (PABA peptide hydrolase) 1 1
MIRT028825 GNB5 guanine nucleotide binding protein (G protein), beta 5 1 1
MIRT028826 HIST2H4A histone cluster 2, H4a 1 1
MIRT028827 MCM3 minichromosome maintenance complex component 3 1 1
MIRT028828 OR2J3 olfactory receptor, family 2, subfamily J, member 3 1 1
MIRT028829 SEC61G Sec61 gamma subunit 1 1
MIRT028830 ZNF141 zinc finger protein 141 1 1
MIRT028831 AP3M2 adaptor-related protein complex 3, mu 2 subunit 1 1
MIRT028832 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT028833 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT028834 RGS20 regulator of G-protein signaling 20 1 1
MIRT028835 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT028836 KIAA1033 KIAA1033 1 1
MIRT028837 TRAF1 TNF receptor-associated factor 1 1 1
MIRT028838 IMPG1 interphotoreceptor matrix proteoglycan 1 1 1
MIRT028839 VPS54 vacuolar protein sorting 54 homolog (S. cerevisiae) 1 1
MIRT028840 LIAS lipoic acid synthetase 1 1
MIRT028841 MED22 mediator complex subunit 22 1 1
MIRT028842 GCNT2 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) 1 1
MIRT028843 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT028844 LETM1 leucine zipper-EF-hand containing transmembrane protein 1 1 1
MIRT028845 PTCD3 Pentatricopeptide repeat domain 3 1 1
MIRT028846 DMXL2 Dmx-like 2 1 1
MIRT028847 CLOCK clock homolog (mouse) 1 1
MIRT028848 PLCB4 phospholipase C, beta 4 1 1
MIRT028849 CAB39L calcium binding protein 39-like 1 1
MIRT028850 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT028851 ITFG1 integrin alpha FG-GAP repeat containing 1 1 1
MIRT028852 DIS3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT028853 MT1M metallothionein 1M 1 1
MIRT028854 TNKS tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT028855 LRRC40 leucine rich repeat containing 40 1 1
MIRT028856 DNMBP dynamin binding protein 1 1
MIRT028857 TOP1 topoisomerase (DNA) I 1 1
MIRT028858 ARMCX2 armadillo repeat containing, X-linked 2 1 1
MIRT028859 TMC7 transmembrane channel-like 7 1 1
MIRT028860 MDM2 Mdm2 p53 binding protein homolog (mouse) 1 1
MIRT028861 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 2 2
MIRT028862 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT028863 LUC7L LUC7-like (S. cerevisiae) 1 1
MIRT028864 SUCO chromosome 1 open reading frame 9 1 1
MIRT028865 MMP10 matrix metallopeptidase 10 (stromelysin 2) 1 1
MIRT028866 NAGK N-acetylglucosamine kinase 1 1
MIRT028867 CA11 carbonic anhydrase XI 1 1
MIRT028868 CLSTN1 calsyntenin 1 1 1
MIRT028869 LILRA4 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 1 1
MIRT028870 PTRH2 peptidyl-tRNA hydrolase 2 1 1
MIRT028871 TMCO3 transmembrane and coiled-coil domains 3 1 1
MIRT028872 ZFPM2 zinc finger protein, multitype 2 1 1
MIRT028873 DEFA1 defensin, alpha 1 1 1
MIRT028874 SUSD5 sushi domain containing 5 1 1
MIRT028875 MMP8 matrix metallopeptidase 8 (neutrophil collagenase) 1 1
MIRT028876 NSMAF neutral sphingomyelinase (N-SMase) activation associated factor 1 1
MIRT028877 SLC1A6 solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 1 1
MIRT028878 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT028879 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT028880 ROM1 retinal outer segment membrane protein 1 1 1
MIRT028881 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT028882 CPA1 carboxypeptidase A1 (pancreatic) 1 1
MIRT028883 ANXA8L1 annexin A8-like 1 1 1
MIRT028884 C14orf2 chromosome 14 open reading frame 2 1 1
MIRT028885 P2RY6 pyrimidinergic receptor P2Y, G-protein coupled, 6 1 1
MIRT028886 SLC22A8 solute carrier family 22 (organic anion transporter), member 8 1 1
MIRT028887 CDKN2D cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) 1 1
MIRT028888 CXCL9 chemokine (C-X-C motif) ligand 9 1 1
MIRT028889 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 1 1
MIRT028890 RAB27A RAB27A, member RAS oncogene family 1 1
MIRT028891 IMP3 IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT028892 TRIB1 tribbles homolog 1 (Drosophila) 1 1
MIRT028893 RAD54L RAD54-like (S. cerevisiae) 1 1
MIRT028894 HSPA1L heat shock 70kDa protein 1-like 1 1
MIRT028895 WLS wntless homolog (Drosophila) 1 1
MIRT028896 GPR126 G protein-coupled receptor 126 1 1
MIRT028897 SRF serum response factor (c-fos serum response element-binding transcription factor) 1 1
MIRT028898 FAHD2A fumarylacetoacetate hydrolase domain containing 2A 1 1
MIRT028899 ITGB2 integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) 1 1
MIRT028900 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT028901 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT028902 POLR2G polymerase (RNA) II (DNA directed) polypeptide G 1 1
MIRT028903 C9orf114 chromosome 9 open reading frame 114 1 1
MIRT028904 IGSF6 immunoglobulin superfamily, member 6 1 1
MIRT028905 USP18 ubiquitin specific peptidase 18 1 1
MIRT028906 HEXA hexosaminidase A (alpha polypeptide) 1 1
MIRT028907 SNORA70 small nucleolar RNA, H/ACA box 70 1 1
MIRT028908 CYBRD1 cytochrome b reductase 1 1 1
MIRT028909 GRB7 growth factor receptor-bound protein 7 1 1
MIRT028910 PSMC6 proteasome (prosome, macropain) 26S subunit, ATPase, 6 1 1
MIRT028911 ZNF84 zinc finger protein 84 1 1
MIRT028912 PIDD leucine-rich repeats and death domain containing 1 1
MIRT028913 NRN1 neuritin 1 1 1
MIRT028914 LRP1B low density lipoprotein receptor-related protein 1B 1 1
MIRT028915 ACOX2 acyl-CoA oxidase 2, branched chain 1 1
MIRT028916 CXCL13 chemokine (C-X-C motif) ligand 13 1 1
MIRT028917 AGT angiotensinogen (serpin peptidase inhibitor, clade A, member 8) 1 1
MIRT028918 MYBPC1 myosin binding protein C, slow type 1 1
MIRT028919 PFDN5 prefoldin subunit 5 1 1
MIRT028920 SMPD3 sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II) 1 1
MIRT028921 GRM8 glutamate receptor, metabotropic 8 1 1
MIRT028922 IGHMBP2 immunoglobulin mu binding protein 2 1 1
MIRT028923 ZNF652 zinc finger protein 652 1 1
MIRT028924 PARK2 Parkinson disease (autosomal recessive, juvenile) 2, parkin 1 1
MIRT028925 C22orf29 chromosome 22 open reading frame 29 1 1
MIRT028926 DGKI diacylglycerol kinase, iota 1 1
MIRT028927 DLGAP4 discs, large (Drosophila) homolog-associated protein 4 1 1
MIRT028928 XDH xanthine dehydrogenase 1 1
MIRT028929 RRAGC Ras-related GTP binding C 1 1
MIRT028930 PRRG3 proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) 1 1
MIRT028931 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT028932 POU2F3 POU class 2 homeobox 3 1 1
MIRT028933 ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like 1 1
MIRT028934 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT028935 APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 1 1
MIRT028936 TRAF3 TNF receptor-associated factor 3 1 1
MIRT028937 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT028938 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT028939 BTG1 B-cell translocation gene 1, anti-proliferative 1 1
MIRT028940 PCYOX1 prenylcysteine oxidase 1 1 1
MIRT028941 ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 1 1
MIRT028942 DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 1 1
MIRT028943 USP3 ubiquitin specific peptidase 3 1 1
MIRT028944 RNF125 ring finger protein 125 1 1
MIRT028945 TMEM168 transmembrane protein 168 1 1
MIRT028946 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 1 1
MIRT028947 GREB1 growth regulation by estrogen in breast cancer 1 1 1
MIRT028948 HAUS8 HAUS augmin-like complex, subunit 8 1 1
MIRT028949 FKBP1B FK506 binding protein 1B, 12.6 kDa 1 1
MIRT028950 TRAM1 translocation associated membrane protein 1 1 1
MIRT028951 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT028952 RAB11FIP1 RAB11 family interacting protein 1 (class I) 2 2
MIRT028953 NUBP2 nucleotide binding protein 2 (MinD homolog, E. coli) 1 1
MIRT028954 CA9 carbonic anhydrase IX 1 1
MIRT028955 TFPT TCF3 (E2A) fusion partner (in childhood Leukemia) 1 1
MIRT028956 GABRE gamma-aminobutyric acid (GABA) A receptor, epsilon 1 1
MIRT028957 HHLA3 HERV-H LTR-associating 3 1 1
MIRT028958 ZNF556 zinc finger protein 556 1 1
MIRT028959 KIFC3 kinesin family member C3 1 1
MIRT028960 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT028961 STON1-GTF2A1L STON1-GTF2A1L readthrough 1 1
MIRT028962 IL17RC interleukin 17 receptor C 1 1
MIRT028963 POLG polymerase (DNA directed), gamma 1 1
MIRT028964 GTPBP4 GTP binding protein 4 1 1
MIRT028965 TMEM230 chromosome 20 open reading frame 30 1 1
MIRT028966 CYP4A11 cytochrome P450, family 4, subfamily A, polypeptide 11 1 1
MIRT028967 ZCCHC8 zinc finger, CCHC domain containing 8 1 1
MIRT028968 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT028969 POLA1 polymerase (DNA directed), alpha 1, catalytic subunit 1 1
MIRT028970 ADGB chromosome 6 open reading frame 103 1 1
MIRT028971 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT028972 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT028973 SCGB1D2 secretoglobin, family 1D, member 2 1 1
MIRT028974 GSTT2 glutathione S-transferase theta 2 1 1
MIRT028975 WDR91 WD repeat domain 91 1 1
MIRT028976 CCNI cyclin I 1 1
MIRT028977 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT028978 AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 1 1
MIRT028979 PCDHA6 protocadherin alpha 6 1 1
MIRT028980 SMAD7 SMAD family member 7 1 1
MIRT028981 WHAMMP3 WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 1 1
MIRT028982 SRGN serglycin 1 1
MIRT028983 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT028984 C17orf59 chromosome 17 open reading frame 59 1 1
MIRT028985 TADA3 transcriptional adaptor 3 1 1
MIRT028986 NDUFS7 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) 1 1
MIRT028987 CAAP1 chromosome 9 open reading frame 82 1 1
MIRT028988 SLC38A10 solute carrier family 38, member 10 1 1
MIRT028989 POMP proteasome maturation protein 1 1
MIRT028990 NR0B2 nuclear receptor subfamily 0, group B, member 2 1 1
MIRT028991 STAT6 signal transducer and activator of transcription 6, interleukin-4 induced 1 1
MIRT028992 GYS1 glycogen synthase 1 (muscle) 1 1
MIRT028993 MAGEC3 melanoma antigen family C, 3 1 1
MIRT028994 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT028995 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT028996 FBXO24 F-box protein 24 1 1
MIRT028997 NMRK2 integrin beta 1 binding protein 3 1 1
MIRT028998 PCDHA4 protocadherin alpha 4 1 1
MIRT028999 GJA5 gap junction protein, alpha 5, 40kDa 1 1
MIRT029000 MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) 1 1
MIRT029001 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT029002 MAGT1 magnesium transporter 1 1 1
MIRT029003 OR10H2 olfactory receptor, family 10, subfamily H, member 2 1 1
MIRT029004 FHL5 four and a half LIM domains 5 1 1
MIRT029005 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT029006 FUT8 fucosyltransferase 8 (alpha (1,6) fucosyltransferase) 1 1
MIRT029007 TRAPPC13 chromosome 5 open reading frame 44 1 1
MIRT029008 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT029009 RIPK4 receptor-interacting serine-threonine kinase 4 1 1
MIRT029010 CHST4 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 1 1
MIRT029011 GPR27 G protein-coupled receptor 27 1 1
MIRT029012 TRIM58 tripartite motif-containing 58 1 1
MIRT029013 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT029014 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT029015 GFOD2 glucose-fructose oxidoreductase domain containing 2 1 1
MIRT029016 FGF23 fibroblast growth factor 23 1 1
MIRT029017 TRMT11 tRNA methyltransferase 11 homolog (S. cerevisiae) 1 1
MIRT029018 TRIM44 tripartite motif-containing 44 1 1
MIRT029019 GRIK2 glutamate receptor, ionotropic, kainate 2 1 1
MIRT029020 TAZ tafazzin 1 1
MIRT029021 MLXIP MLX interacting protein 1 1
MIRT029022 MTERF mitochondrial transcription termination factor 1 1
MIRT029023 PCNT pericentrin 1 1
MIRT029024 ZFY zinc finger protein, Y-linked 1 1
MIRT029025 TMEM156 transmembrane protein 156 1 1
MIRT029026 RASAL2 RAS protein activator like 2 1 1
MIRT029027 CACNG3 calcium channel, voltage-dependent, gamma subunit 3 1 1
MIRT029028 GID4 chromosome 17 open reading frame 39 1 1
MIRT029029 KIF1C kinesin family member 1C 1 1
MIRT029030 NPRL2 nitrogen permease regulator-like 2 (S. cerevisiae) 1 1
MIRT029031 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT029032 MEF2C myocyte enhancer factor 2C 1 1
MIRT029033 SALL1 sal-like 1 (Drosophila) 1 1
MIRT029034 CACNB2 calcium channel, voltage-dependent, beta 2 subunit 1 1
MIRT029035 HOXC4 homeobox C4 1 1
MIRT029036 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 1 1
MIRT029037 TMEM206 transmembrane protein 206 1 1
MIRT029038 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT029039 RNF6 ring finger protein (C3H2C3 type) 6 1 1
MIRT029040 KLHL24 kelch-like 24 (Drosophila) 2 2
MIRT029041 ZBTB18 zinc finger protein 238 2 2
MIRT029042 SLC13A4 solute carrier family 13 (sodium/sulfate symporters), member 4 1 1
MIRT029043 ANXA8L2 annexin A8-like 2 1 1
MIRT029044 DGAT1 diacylglycerol O-acyltransferase homolog 1 (mouse) 1 1
MIRT029045 LACTB2 lactamase, beta 2 1 1
MIRT029046 CPA4 carboxypeptidase A4 1 1
MIRT029047 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT029048 ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 1 1
MIRT029049 PLXNA4 plexin A4 1 1
MIRT029050 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT029051 PLXNC1 plexin C1 1 1
MIRT029052 ELOVL2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 1 1
MIRT029053 SLC6A9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1 1
MIRT029054 ZNF140 zinc finger protein 140 1 1
MIRT029055 MVD mevalonate (diphospho) decarboxylase 1 1
MIRT029056 MYEF2 myelin expression factor 2 1 1
MIRT029057 EAF2 ELL associated factor 2 1 1
MIRT029058 GUF1 GUF1 GTPase homolog (S. cerevisiae) 1 1
MIRT029059 SH3BP1 SH3-domain binding protein 1 1 1
MIRT029060 CMC4 mature T-cell proliferation 1 neighbor 1 1
MIRT029061 ING2 inhibitor of growth family, member 2 1 1
MIRT029062 MUC7 mucin 7, secreted 1 1
MIRT029063 NOC3L nucleolar complex associated 3 homolog (S. cerevisiae) 1 1
MIRT029064 PLCH2 phospholipase C, eta 2 1 1
MIRT029065 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT029066 ROGDI rogdi homolog (Drosophila) 1 1
MIRT029067 LGALSL galectin-related protein 1 1
MIRT029068 KRTAP5-3 keratin associated protein 5-3 1 1
MIRT029069 NSF N-ethylmaleimide-sensitive factor 1 1
MIRT029070 SMN2 survival of motor neuron 2, centromeric 1 1
MIRT029071 EIF1AY eukaryotic translation initiation factor 1A, Y-linked 1 1
MIRT029072 ZNF573 zinc finger protein 573 1 1
MIRT029073 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT029074 ZBED1 zinc finger, BED-type containing 1 1 1
MIRT029075 FANCC Fanconi anemia, complementation group C 1 1
MIRT029076 QDPR quinoid dihydropteridine reductase 1 1
MIRT029077 KIAA0922 KIAA0922 1 1
MIRT029078 CMC2 chromosome 16 open reading frame 61 1 1
MIRT029079 FN1 fibronectin 1 1 1
MIRT029080 STARD7 StAR-related lipid transfer (START) domain containing 7 1 1
MIRT029081 ATF3 activating transcription factor 3 1 1
MIRT029082 RNASET2 ribonuclease T2 1 1
MIRT029083 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT029084 ZNF696 zinc finger protein 696 1 1
MIRT029085 RAD54L2 RAD54-like 2 (S. cerevisiae) 1 1
MIRT029086 GSTT2B glutathione S-transferase theta 2B (gene/pseudogene) 1 1
MIRT029087 CRADD CASP2 and RIPK1 domain containing adaptor with death domain 1 1
MIRT029088 TMEM30A transmembrane protein 30A 1 1
MIRT029089 ASTN2 astrotactin 2 1 1
MIRT029090 FOLR2 folate receptor 2 (fetal) 1 1
MIRT029091 ITM2A integral membrane protein 2A 1 1
MIRT029092 RBM41 RNA binding motif protein 41 1 1
MIRT029093 IL20RA interleukin 20 receptor, alpha 1 1
MIRT029094 NARS2 asparaginyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT029095 OR10H5 olfactory receptor, family 10, subfamily H, member 5 1 1
MIRT029096 KHDC1 KH homology domain containing 1 1 1
MIRT029097 ARMC7 armadillo repeat containing 7 1 1
MIRT029098 WDR4 WD repeat domain 4 1 1
MIRT029099 ACADS acyl-CoA dehydrogenase, C-2 to C-3 short chain 1 1
MIRT029100 MT1P3 metallothionein 1 pseudogene 3 1 1
MIRT029101 MYBBP1A MYB binding protein (P160) 1a 1 1
MIRT029102 SLC34A2 solute carrier family 34 (sodium phosphate), member 2 1 1
MIRT029103 INPP5A inositol polyphosphate-5-phosphatase, 40kDa 1 1
MIRT029104 MKNK1 MAP kinase interacting serine/threonine kinase 1 1 1
MIRT029105 SLC27A6 solute carrier family 27 (fatty acid transporter), member 6 1 1
MIRT029106 ATP7B ATPase, Cu++ transporting, beta polypeptide 1 1
MIRT029107 N6AMT1 N-6 adenine-specific DNA methyltransferase 1 (putative) 1 1
MIRT029108 KRT222 keratin 222 1 1
MIRT029109 KIAA0232 KIAA0232 1 1
MIRT029110 SLBP stem-loop binding protein 1 1
MIRT029111 ST8SIA2 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 1 1
MIRT029112 ZNF81 zinc finger protein 81 1 1
MIRT029113 KIAA1024 KIAA1024 1 1
MIRT029114 IGSF3 immunoglobulin superfamily, member 3 1 1
MIRT029115 RBM12B RNA binding motif protein 12B 1 1
MIRT029116 LIN28A lin-28 homolog A (C. elegans) 1 1
MIRT029117 PKD2 polycystic kidney disease 2 (autosomal dominant) 1 1
MIRT029118 SYNE2 spectrin repeat containing, nuclear envelope 2 1 1
MIRT029119 KIAA0368 KIAA0368 1 1
MIRT029120 BRD4 bromodomain containing 4 1 1
MIRT029121 JHDM1D jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae) 1 1
MIRT029122 IFNG interferon, gamma 1 1
MIRT029123 MATR3 matrin 3 1 1
MIRT029124 SREK1IP1 SFRS12-interacting protein 1 1 1
MIRT029125 MED23 mediator complex subunit 23 1 1
MIRT029126 RCBTB1 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 1 1
MIRT029127 RTF1 Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT029128 OR10H1 olfactory receptor, family 10, subfamily H, member 1 1 1
MIRT029129 ADI1 acireductone dioxygenase 1 1 1
MIRT029130 FAM136A family with sequence similarity 136, member A 1 1
MIRT029131 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT029132 OR2F2 olfactory receptor, family 2, subfamily F, member 2 1 1
MIRT029133 TRPV6 transient receptor potential cation channel, subfamily V, member 6 1 1
MIRT029134 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) 1 1
MIRT029135 LONP1 lon peptidase 1, mitochondrial 1 1
MIRT029136 FAM168B family with sequence similarity 168, member B 1 1
MIRT029137 NPTN neuroplastin 1 1
MIRT029138 GSTA1 glutathione S-transferase alpha 1 1 1
MIRT029139 BLOC1S5 muted homolog (mouse) 1 1
MIRT029140 STK16 serine/threonine kinase 16 1 1
MIRT029141 RASGRF1 Ras protein-specific guanine nucleotide-releasing factor 1 1 1
MIRT029142 OR1A2 olfactory receptor, family 1, subfamily A, member 2 1 1
MIRT029143 LRRC8E leucine rich repeat containing 8 family, member E 1 1
MIRT029144 FADS2 fatty acid desaturase 2 1 1
MIRT029145 CNTLN centlein, centrosomal protein 1 1
MIRT029146 TMEM132A transmembrane protein 132A 1 1
MIRT029147 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT029148 CAPN9 calpain 9 1 1
MIRT029149 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT029150 KIR3DX1 killer cell immunoglobulin-like receptor, three domains, X1 1 1
MIRT029151 CBLL1 Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 1 1
MIRT029152 SELENBP1 selenium binding protein 1 1 1
MIRT029153 ZNF35 zinc finger protein 35 1 1
MIRT029154 MYT1L myelin transcription factor 1-like 1 1
MIRT029155 OFD1 oral-facial-digital syndrome 1 1 1
MIRT029156 TMEM208 transmembrane protein 208 1 1
MIRT029157 PNMT phenylethanolamine N-methyltransferase 1 1
MIRT029158 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT029159 TFB2M transcription factor B2, mitochondrial 1 1
MIRT029160 C11orf16 chromosome 11 open reading frame 16 1 1
MIRT029161 RPL39 ribosomal protein L39 1 1
MIRT029162 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT029163 TRPC7 transient receptor potential cation channel, subfamily C, member 7 1 1
MIRT029164 PIAS2 protein inhibitor of activated STAT, 2 1 1
MIRT029165 NVL nuclear VCP-like 1 1
MIRT029166 THAP3 THAP domain containing, apoptosis associated protein 3 1 1
MIRT029167 YIPF5 Yip1 domain family, member 5 1 1
MIRT029168 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT029169 UBE2E1 ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast) 1 1
MIRT029170 CHMP3 vacuolar protein sorting 24 homolog (S. cerevisiae) 1 1
MIRT029171 POTEF POTE ankyrin domain family, member F 1 1
MIRT029172 IL1RL1 interleukin 1 receptor-like 1 1 1
MIRT029173 ALKBH4 alkB, alkylation repair homolog 4 (E. coli) 1 1
MIRT029174 DCHS2 dachsous 2 (Drosophila) 1 1
MIRT029175 KCND1 potassium voltage-gated channel, Shal-related subfamily, member 1 1 1
MIRT029176 TRIM6-TRIM34 TRIM6-TRIM34 readthrough 1 1
MIRT029177 CBY1 chibby homolog 1 (Drosophila) 1 1
MIRT029178 CDH5 cadherin 5, type 2 (vascular endothelium) 1 1
MIRT029179 VAV1 vav 1 guanine nucleotide exchange factor 1 1
MIRT029180 SIX5 SIX homeobox 5 1 1
MIRT029181 CYP2D7P1 cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 1 1 1
MIRT029182 TCTA T-cell leukemia translocation altered gene 1 1
MIRT029183 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT029184 AKAP5 A kinase (PRKA) anchor protein 5 1 1
MIRT029185 ARMC1 armadillo repeat containing 1 1 1
MIRT029186 ICAM5 intercellular adhesion molecule 5, telencephalin 1 1
MIRT029187 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT029188 TARBP2 TAR (HIV-1) RNA binding protein 2 1 1
MIRT029189 CYTH1 cytohesin 1 1 1
MIRT029190 CXCR6 chemokine (C-X-C motif) receptor 6 1 1
MIRT029191 ZNF23 zinc finger protein 23 (KOX 16) 1 1
MIRT029192 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT029193 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT029194 FDXR ferredoxin reductase 1 1
MIRT029195 BRD3 bromodomain containing 3 1 1
MIRT029196 NLGN4X neuroligin 4, X-linked 1 1
MIRT029197 DIABLO diablo homolog (Drosophila) 1 1
MIRT029198 KAT2B K(lysine) acetyltransferase 2B 1 1
MIRT029199 CDK19 cyclin-dependent kinase 19 1 1
MIRT029200 DNAL4 dynein, axonemal, light chain 4 1 1
MIRT029201 MICU2 EF-hand domain family, member A1 1 1
MIRT029202 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT029203 RAI14 retinoic acid induced 14 1 1
MIRT029204 TMEM50B transmembrane protein 50B 1 1
MIRT029205 LRPAP1 low density lipoprotein receptor-related protein associated protein 1 1 1
MIRT029206 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT029207 ERCC8 excision repair cross-complementing rodent repair deficiency, complementation group 8 1 1
MIRT029208 MAGEA9B melanoma antigen family A, 9B 1 1
MIRT029209 CSNK1G1 casein kinase 1, gamma 1 1 1
MIRT029210 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 1
MIRT029211 ARHGAP44 Rho-type GTPase-activating protein RICH2 1 1
MIRT029212 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT029213 SEC22A SEC22 vesicle trafficking protein homolog A (S. cerevisiae) 1 1
MIRT029214 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT029215 SPATA6 spermatogenesis associated 6 1 1
MIRT029216 MAT2A methionine adenosyltransferase II, alpha 1 1
MIRT029217 G3BP2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT029218 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 2 2
MIRT029219 BOLA2 bolA homolog 2 (E. coli) 1 1
MIRT029220 S100P S100 calcium binding protein P 1 1
MIRT029221 METTL9 methyltransferase like 9 1 1
MIRT029222 OR2S2 olfactory receptor, family 2, subfamily S, member 2 1 1
MIRT029223 TIPRL TIP41, TOR signaling pathway regulator-like (S. cerevisiae) 1 1
MIRT029224 SLC22A13 solute carrier family 22 (organic anion transporter), member 13 1 1
MIRT029225 RGCC chromosome 13 open reading frame 15 1 1
MIRT029226 CRYL1 crystallin, lambda 1 1 1
MIRT029227 INSR insulin receptor 1 1
MIRT029228 TAC3 tachykinin 3 1 1
MIRT029229 TCEAL1 transcription elongation factor A (SII)-like 1 1 1
MIRT029230 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT029231 GPR135 G protein-coupled receptor 135 1 1
MIRT029232 RBMY1F RNA binding motif protein, Y-linked, family 1, member F 1 1
MIRT029233 INHA inhibin, alpha 1 1
MIRT029234 ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 1 1
MIRT029235 PRR4 proline rich 4 (lacrimal) 1 1
MIRT029236 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1 1
MIRT029237 PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 1 1
MIRT029238 MANSC1 MANSC domain containing 1 1 1
MIRT029239 TCTN2 tectonic family member 2 1 1
MIRT029240 ZNF672 zinc finger protein 672 1 1
MIRT029241 ERAP2 endoplasmic reticulum aminopeptidase 2 1 1
MIRT029242 SESN1 sestrin 1 1 1
MIRT029243 MCUR1 coiled-coil domain containing 90A 1 1
MIRT029244 CASP9 caspase 9, apoptosis-related cysteine peptidase 1 1
MIRT029245 CLEC2B C-type lectin domain family 2, member B 1 1
MIRT029246 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT029247 STX12 syntaxin 12 1 1
MIRT029248 TSEN34 tRNA splicing endonuclease 34 homolog (S. cerevisiae) 1 1
MIRT029249 TNP2 transition protein 2 (during histone to protamine replacement) 1 1
MIRT029250 BMP2 bone morphogenetic protein 2 1 1
MIRT029251 NELFE RD RNA binding protein 1 1
MIRT029252 KIAA1107 KIAA1107 1 1
MIRT029253 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 1 1
MIRT029254 TMEM187 transmembrane protein 187 1 1
MIRT029255 PUS7 pseudouridylate synthase 7 homolog (S. cerevisiae) 1 1
MIRT029256 MPI mannose phosphate isomerase 1 1
MIRT029257 SNRPN small nuclear ribonucleoprotein polypeptide N 1 1
MIRT029258 DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 1 1
MIRT029259 MGST3 microsomal glutathione S-transferase 3 1 1
MIRT029260 TPPP tubulin polymerization promoting protein 1 1
MIRT029261 CPN2 carboxypeptidase N, polypeptide 2 1 1
MIRT029262 ADNP activity-dependent neuroprotector homeobox 1 1
MIRT029263 HMGN5 high-mobility group nucleosome binding domain 5 1 1
MIRT029264 KRT4 keratin 4 1 1
MIRT029265 SERPINB1 serpin peptidase inhibitor, clade B (ovalbumin), member 1 1 1
MIRT029266 SCGB1D1 secretoglobin, family 1D, member 1 1 1
MIRT029267 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT029268 CLIC2 chloride intracellular channel 2 1 1
MIRT029269 DAK dihydroxyacetone kinase 2 homolog (S. cerevisiae) 1 1
MIRT029270 DUSP7 dual specificity phosphatase 7 1 1
MIRT029271 TESK1 testis-specific kinase 1 1 1
MIRT029272 SLC2A4RG SLC2A4 regulator 1 1
MIRT029273 NDUFA1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa 1 1
MIRT029274 CCDC15 coiled-coil domain containing 15 1 1
MIRT029275 IDH2 isocitrate dehydrogenase 2 (NADP+), mitochondrial 1 1
MIRT029276 ALX1 ALX homeobox 1 1 1
MIRT029277 CXCR1 chemokine (C-X-C motif) receptor 1 1 1
MIRT029278 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT029279 SNX2 sorting nexin 2 1 1
MIRT029280 MADD MAP-kinase activating death domain 1 1
MIRT029281 GNL3 guanine nucleotide binding protein-like 3 (nucleolar) 1 1
MIRT029282 VIPAS39 VPS33B interacting protein, apical-basolateral polarity regulator 1 1
MIRT029283 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT029284 RPL28 ribosomal protein L28 1 1
MIRT029285 TOR1B torsin family 1, member B (torsin B) 1 1
MIRT029286 POP4 processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) 1 1
MIRT029287 MDM1 Mdm1 nuclear protein homolog (mouse) 1 1
MIRT029288 ANKRD46 ankyrin repeat domain 46 1 1
MIRT029289 RPA3 replication protein A3, 14kDa 1 1
MIRT029290 BNC2 basonuclin 2 1 1
MIRT029291 SYNE1 spectrin repeat containing, nuclear envelope 1 1 1
MIRT029292 ROS1 c-ros oncogene 1 , receptor tyrosine kinase 1 1
MIRT029293 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT029294 RYR3 ryanodine receptor 3 1 1
MIRT029295 TSC22D2 TSC22 domain family, member 2 1 1
MIRT029296 CDK14 cyclin-dependent kinase 14 1 1
MIRT029297 IFRD1 interferon-related developmental regulator 1 1 1
MIRT029298 UBE2K ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) 1 1
MIRT029299 TMEM2 transmembrane protein 2 1 1
MIRT029300 KIAA1704 KIAA1704 1 1
MIRT029301 FAM98A family with sequence similarity 98, member A 1 1
MIRT029302 MESDC2 mesoderm development candidate 2 1 1
MIRT029303 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 1
MIRT029304 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT029305 IL3 interleukin 3 (colony-stimulating factor, multiple) 1 1
MIRT029306 MRPS18B mitochondrial ribosomal protein S18B 1 1
MIRT029307 HMOX1 heme oxygenase (decycling) 1 1 1
MIRT029308 DNAJA3 DnaJ (Hsp40) homolog, subfamily A, member 3 1 1
MIRT029309 PSMB8 proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7) 1 1
MIRT029310 LGMN legumain 1 1
MIRT029311 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT029312 MED31 mediator complex subunit 31 1 1
MIRT029313 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT029314 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT029315 RAD51C RAD51 homolog C (S. cerevisiae) 1 1
MIRT029316 CERK ceramide kinase 1 1
MIRT029317 ACSF2 acyl-CoA synthetase family member 2 1 1
MIRT029318 PDK1 pyruvate dehydrogenase kinase, isozyme 1 1 1
MIRT029319 PPP1R14B protein phosphatase 1, regulatory (inhibitor) subunit 14B 1 1
MIRT029320 GSTP1 glutathione S-transferase pi 1 1 1
MIRT029321 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT029322 CYP4A22 cytochrome P450, family 4, subfamily A, polypeptide 22 1 1
MIRT029323 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT029324 SAMD14 sterile alpha motif domain containing 14 1 1
MIRT029325 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 1 1
MIRT029326 HSF2 heat shock transcription factor 2 1 1
MIRT029327 CYB5R4 cytochrome b5 reductase 4 1 1
MIRT029328 COMMD3 COMM domain containing 3 1 1
MIRT029329 HECA headcase homolog (Drosophila) 1 1
MIRT029330 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT029331 ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) 1 1
MIRT029332 EI24 etoposide induced 2.4 mRNA 1 1
MIRT029333 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 1 1
MIRT029334 ZMAT4 zinc finger, matrin type 4 1 1
MIRT029335 AEN apoptosis enhancing nuclease 1 1
MIRT029336 GEM GTP binding protein overexpressed in skeletal muscle 1 1
MIRT029337 NEK9 NIMA (never in mitosis gene a)- related kinase 9 1 1
MIRT029338 CCDC181 chromosome 1 open reading frame 114 1 1
MIRT029339 RCBTB2 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 1 1
MIRT029340 KCNN2 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 1 1
MIRT029341 COL4A4 collagen, type IV, alpha 4 1 1
MIRT029342 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 1 1
MIRT029343 KIAA1644 KIAA1644 1 1
MIRT029344 CD97 CD97 molecule 1 1
MIRT029345 LY6D lymphocyte antigen 6 complex, locus D 1 1
MIRT029346 CDK18 cyclin-dependent kinase 18 1 1
MIRT029347 CCDC109B coiled-coil domain containing 109B 1 1
MIRT029348 BUD31 BUD31 homolog (S. cerevisiae) 1 1
MIRT029349 GPX4 glutathione peroxidase 4 (phospholipid hydroperoxidase) 1 1
MIRT029350 METTL16 methyltransferase 10 domain containing 1 1
MIRT029351 YIF1A Yip1 interacting factor homolog A (S. cerevisiae) 1 1
MIRT029352 PLS1 plastin 1 1 1
MIRT029353 CRELD1 cysteine-rich with EGF-like domains 1 1 1
MIRT029354 GP1BB glycoprotein Ib (platelet), beta polypeptide 1 1
MIRT029355 EMP3 epithelial membrane protein 3 1 1
MIRT029356 BRSK2 BR serine/threonine kinase 2 1 1
MIRT029357 GDI1 GDP dissociation inhibitor 1 1 1
MIRT029358 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 1 1
MIRT029359 HSF4 heat shock transcription factor 4 1 1
MIRT029360 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT029361 TMEM74B chromosome 20 open reading frame 46 1 1
MIRT029362 USP32P1 TL132 pseudogene 1 1
MIRT029363 NTSR1 neurotensin receptor 1 (high affinity) 1 1
MIRT029364 WASF2 WAS protein family, member 2 1 1
MIRT029365 ARL5A ADP-ribosylation factor-like 5A 1 1
MIRT029366 HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 1 1
MIRT029367 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT029368 FAM20B family with sequence similarity 20, member B 1 1
MIRT029369 MMD monocyte to macrophage differentiation-associated 1 1
MIRT029370 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT029371 DUSP21 dual specificity phosphatase 21 1 1
MIRT029372 MCMBP chromosome 10 open reading frame 119 1 1
MIRT029373 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 1 1
MIRT029374 PDE12 phosphodiesterase 12 1 1
MIRT029375 PEX5L peroxisomal biogenesis factor 5-like 1 1
MIRT029376 GINS4 GINS complex subunit 4 (Sld5 homolog) 1 1
MIRT029377 SMNDC1 survival motor neuron domain containing 1 1 1
MIRT029378 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 1
MIRT029379 PDSS2 prenyl (decaprenyl) diphosphate synthase, subunit 2 1 1
MIRT029380 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT029381 FAM118A family with sequence similarity 118, member A 1 1
MIRT029382 GTF2A2 general transcription factor IIA, 2, 12kDa 1 1
MIRT029383 MNAT1 menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) 1 1
MIRT029384 FGF9 fibroblast growth factor 9 (glia-activating factor) 1 1
MIRT029385 RPS6KA6 ribosomal protein S6 kinase, 90kDa, polypeptide 6 1 1
MIRT029386 SIRT4 sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) 1 1
MIRT029387 RSRC2 arginine/serine-rich coiled-coil 2 1 1
MIRT029388 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT029389 CREBZF CREB/ATF bZIP transcription factor 1 1
MIRT029390 TEX30 chromosome 13 open reading frame 27 1 1
MIRT029391 THOC7 THO complex 7 homolog (Drosophila) 1 1
MIRT029392 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT029393 UPF3B UPF3 regulator of nonsense transcripts homolog B (yeast) 1 1
MIRT029394 UBE3C ubiquitin protein ligase E3C 1 1
MIRT029395 PDHA2 pyruvate dehydrogenase (lipoamide) alpha 2 1 1
MIRT029396 KIF4A kinesin family member 4A 1 1
MIRT029397 HSPB7 heat shock 27kDa protein family, member 7 (cardiovascular) 1 1
MIRT029398 SF3B2 splicing factor 3b, subunit 2, 145kDa 1 1
MIRT029399 TXNRD1 thioredoxin reductase 1 1 1
MIRT029400 ODAM odontogenic, ameloblast asssociated 1 1
MIRT029401 NR4A3 nuclear receptor subfamily 4, group A, member 3 1 1
MIRT029402 EFNA4 ephrin-A4 1 1
MIRT029403 DCTN3 dynactin 3 (p22) 1 1
MIRT029404 RAB36 RAB36, member RAS oncogene family 1 1
MIRT029405 FOXG1 forkhead box G1 1 1
MIRT029406 KHK ketohexokinase (fructokinase) 1 1
MIRT029407 GBP2 guanylate binding protein 2, interferon-inducible 1 1
MIRT029408 ADAM18 ADAM metallopeptidase domain 18 1 1
MIRT029409 CCL7 chemokine (C-C motif) ligand 7 1 1
MIRT029410 MRPS15 mitochondrial ribosomal protein S15 1 1
MIRT029411 ARL17A ADP-ribosylation factor-like 17A 1 1
MIRT029412 MTX1 metaxin 1 1 1
MIRT029413 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT029414 WRAP73 WD repeat domain 8 1 1
MIRT029415 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT029416 ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 1 1
MIRT029417 LBH limb bud and heart development homolog (mouse) 1 1
MIRT029418 SRP9 signal recognition particle 9kDa 1 1
MIRT029419 LMCD1 LIM and cysteine-rich domains 1 1 1
MIRT029420 GABBR1 gamma-aminobutyric acid (GABA) B receptor, 1 1 1
MIRT029421 RAB32 RAB32, member RAS oncogene family 1 1
MIRT029422 RBM19 RNA binding motif protein 19 1 1
MIRT029423 TK1 thymidine kinase 1, soluble 1 1
MIRT029424 BOLA2B bolA homolog 2B (E. coli) 1 1
MIRT029425 GLRX glutaredoxin (thioltransferase) 1 1
MIRT029426 ZNF549 zinc finger protein 549 1 1
MIRT029427 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT029428 PDGFRL platelet-derived growth factor receptor-like 1 1
MIRT029429 RBMY1HP RNA binding motif protein, Y-linked, family 1, member H 1 1
MIRT029430 CTSZ cathepsin Z 1 1
MIRT029431 GAS2 growth arrest-specific 2 1 1
MIRT029432 IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein 1 1
MIRT029433 KLRC2 killer cell lectin-like receptor subfamily C, member 2 1 1
MIRT029434 BLVRB biliverdin reductase B (flavin reductase (NADPH)) 1 1
MIRT029435 SLC25A23 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 1 1
MIRT029436 VIM vimentin 1 1
MIRT029437 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT029438 TGM1 transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT029439 CBLC Cas-Br-M (murine) ecotropic retroviral transforming sequence c 1 1
MIRT029440 STIL SCL/TAL1 interrupting locus 1 1
MIRT029441 IFI16 interferon, gamma-inducible protein 16 1 1
MIRT029442 ANO2 anoctamin 2 1 1
MIRT029443 IL17RB interleukin 17 receptor B 1 1
MIRT029444 PDGFB platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) 1 1
MIRT029445 OXCT1 3-oxoacid CoA transferase 1 1 1
MIRT029446 UFSP2 UFM1-specific peptidase 2 1 1
MIRT029447 VCP valosin-containing protein 1 1
MIRT029448 CBX6 chromobox homolog 6 1 1
MIRT029449 UBQLN3 ubiquilin 3 1 1
MIRT029450 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) 1 1
MIRT029451 PRY PTPN13-like, Y-linked 1 1
MIRT029452 ECT2 epithelial cell transforming sequence 2 oncogene 1 1
MIRT029453 DUT deoxyuridine triphosphatase 1 1
MIRT029454 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT029455 PDIA5 protein disulfide isomerase family A, member 5 1 1
MIRT029456 RABL3 RAB, member of RAS oncogene family-like 3 1 1
MIRT029457 NMD3 NMD3 homolog (S. cerevisiae) 1 1
MIRT029458 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT029459 SNAPC5 small nuclear RNA activating complex, polypeptide 5, 19kDa 1 1
MIRT029460 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT029461 KIAA1462 KIAA1462 1 1
MIRT029462 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 1 1
MIRT029463 SACM1L SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT029464 ASXL3 additional sex combs like 3 (Drosophila) 1 1
MIRT029465 MRPL22 mitochondrial ribosomal protein L22 1 1
MIRT029466 SKIL SKI-like oncogene 1 1
MIRT029467 COL5A1 collagen, type V, alpha 1 1 1
MIRT029468 INTS7 integrator complex subunit 7 1 1
MIRT029469 FBXO3 F-box protein 3 1 1
MIRT029470 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT029471 ENOSF1 enolase superfamily member 1 1 1
MIRT029472 CPM carboxypeptidase M 1 1
MIRT029473 ATAD2B ATPase family, AAA domain containing 2B 1 1
MIRT029474 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT029475 SRSF6 splicing factor, arginine/serine-rich 6 1 1
MIRT029476 BEND4 BEN domain containing 4 1 1
MIRT029477 FAM49B family with sequence similarity 49, member B 1 1
MIRT029478 VANGL2 vang-like 2 (van gogh, Drosophila) 1 1
MIRT029479 BABAM1 chromosome 19 open reading frame 62 1 1
MIRT029480 FAM208B chromosome 10 open reading frame 18 1 1
MIRT029481 BAG3 BCL2-associated athanogene 3 1 1
MIRT029482 CYP2F1 cytochrome P450, family 2, subfamily F, polypeptide 1 1 1
MIRT029483 CCND1 cyclin D1 1 1
MIRT029484 PBXIP1 pre-B-cell leukemia homeobox interacting protein 1 1 1
MIRT029485 LRP4 low density lipoprotein receptor-related protein 4 1 1
MIRT029486 ZNF133 zinc finger protein 133 1 1
MIRT029487 MGP matrix Gla protein 1 1
MIRT029488 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 1
MIRT029489 MEAF6 MYST/Esa1-associated factor 6 1 1
MIRT029490 PRDM13 PR domain containing 13 1 1
MIRT029491 NFKBIE nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon 1 1
MIRT029492 CDCA3 cell division cycle associated 3 1 1
MIRT029493 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT029494 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT029495 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT029496 COL15A1 collagen, type XV, alpha 1 1 1
MIRT029497 DSCC1 defective in sister chromatid cohesion 1 homolog (S. cerevisiae) 1 1
MIRT029498 KDM4A lysine (K)-specific demethylase 4A 1 1
MIRT029499 MIR22HG chromosome 17 open reading frame 91 1 1
MIRT029500 COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1 1
MIRT029501 C17orf53 chromosome 17 open reading frame 53 1 1
MIRT029502 NRD1 nardilysin (N-arginine dibasic convertase) 1 1
MIRT029503 TLX3 T-cell leukemia homeobox 3 1 1
MIRT029504 POLR2H polymerase (RNA) II (DNA directed) polypeptide H 1 1
MIRT029505 QARS glutaminyl-tRNA synthetase 1 1
MIRT029506 INPP5K inositol polyphosphate-5-phosphatase K 1 1
MIRT029507 TUSC3 tumor suppressor candidate 3 1 1
MIRT029508 PBX3 pre-B-cell leukemia homeobox 3 1 1
MIRT029509 CCL27 chemokine (C-C motif) ligand 27 1 1
MIRT029510 TAS2R10 taste receptor, type 2, member 10 1 1
MIRT029511 CHST7 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7 1 1
MIRT029512 SLC35C1 solute carrier family 35, member C1 1 1
MIRT029513 ALPI alkaline phosphatase, intestinal 1 1
MIRT029514 PRR14 proline rich 14 1 1
MIRT029515 POLD4 polymerase (DNA-directed), delta 4 1 1
MIRT029516 TPD52L2 tumor protein D52-like 2 1 1
MIRT029517 CLTA clathrin, light chain A 1 1
MIRT029518 ATP1A3 ATPase, Na+/K+ transporting, alpha 3 polypeptide 1 1
MIRT029519 ADPGK ADP-dependent glucokinase 1 1
MIRT029520 AOX1 aldehyde oxidase 1 1 1
MIRT029521 IFRD2 interferon-related developmental regulator 2 1 1
MIRT029522 CISH cytokine inducible SH2-containing protein 1 1
MIRT029523 GADD45GIP1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 1 1
MIRT029524 ARFRP1 ADP-ribosylation factor related protein 1 1 1
MIRT029525 FKBP9L FK506 binding protein 9-like 1 1
MIRT029526 FAM114A2 family with sequence similarity 114, member A2 1 1
MIRT029527 CPB2 carboxypeptidase B2 (plasma) 1 1
MIRT029528 GINS1 GINS complex subunit 1 (Psf1 homolog) 1 1
MIRT029529 CCDC25 coiled-coil domain containing 25 1 1
MIRT029530 AKT1 v-akt murine thymoma viral oncogene homolog 1 1 1
MIRT029531 SLC35D2 solute carrier family 35, member D2 1 1
MIRT029532 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT029533 POLR2F polymerase (RNA) II (DNA directed) polypeptide F 1 1
MIRT029534 CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 1 1
MIRT029535 WISP3 WNT1 inducible signaling pathway protein 3 1 1
MIRT029536 LRRC17 leucine rich repeat containing 17 1 1
MIRT029537 RNF24 ring finger protein 24 1 1
MIRT029538 FOLH1 folate hydrolase (prostate-specific membrane antigen) 1 1 1
MIRT029539 BLNK B-cell linker 1 1
MIRT029540 MNDA myeloid cell nuclear differentiation antigen 1 1
MIRT029541 CXorf38 chromosome X open reading frame 38 1 1
MIRT029542 RABGGTA Rab geranylgeranyltransferase, alpha subunit 1 1
MIRT029543 TXK TXK tyrosine kinase 1 1
MIRT029544 SCN2A sodium channel, voltage-gated, type II, alpha subunit 1 1
MIRT029545 MST4 serine/threonine protein kinase MST4 1 1
MIRT029546 COL4A2 collagen, type IV, alpha 2 1 1
MIRT029547 IGFBP4 insulin-like growth factor binding protein 4 1 1
MIRT029548 FAF1 Fas (TNFRSF6) associated factor 1 1 1
MIRT029549 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT029550 PTPRO protein tyrosine phosphatase, receptor type, O 1 1
MIRT029551 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT029552 PDE11A phosphodiesterase 11A 1 1
MIRT029553 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT029554 SORCS3 sortilin-related VPS10 domain containing receptor 3 1 1
MIRT029555 PFN2 profilin 2 1 1
MIRT029556 MCC mutated in colorectal cancers 1 1
MIRT029557 HECTD3 HECT domain containing 3 1 1
MIRT029558 MCTP2 multiple C2 domains, transmembrane 2 1 1
MIRT029559 MXI1 MAX interactor 1 1 1
MIRT029560 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT029561 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT029562 SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1 1
MIRT029563 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT029564 TRIM65 tripartite motif-containing 65 1 1
MIRT029565 ADM adrenomedullin 1 1
MIRT029566 SLC6A16 solute carrier family 6, member 16 1 1
MIRT029567 IDI1 isopentenyl-diphosphate delta isomerase 1 1 1
MIRT029568 SPRR1A small proline-rich protein 1A 1 1
MIRT029569 GNRHR gonadotropin-releasing hormone receptor 1 1
MIRT029570 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT029571 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT029572 GPR107 G protein-coupled receptor 107 1 1
MIRT029573 PKN1 protein kinase N1 1 1
MIRT029574 ZNF862 zinc finger protein 862 1 1
MIRT029575 COPZ2 coatomer protein complex, subunit zeta 2 1 1
MIRT029576 CADM1 cell adhesion molecule 1 1 1
MIRT029577 KLRC4 killer cell lectin-like receptor subfamily C, member 4 1 1
MIRT029578 CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 1 1
MIRT029579 TRIM22 tripartite motif-containing 22 1 1
MIRT029580 SMG6 Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT029581 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT029582 LIF leukemia inhibitory factor (cholinergic differentiation factor) 1 1
MIRT029583 SH3GL2 SH3-domain GRB2-like 2 1 1
MIRT029584 CIB1 calcium and integrin binding 1 (calmyrin) 1 1
MIRT029585 PRPS2 phosphoribosyl pyrophosphate synthetase 2 1 1
MIRT029586 MAP1LC3C microtubule-associated protein 1 light chain 3 gamma 1 1
MIRT029587 GABRA3 gamma-aminobutyric acid (GABA) A receptor, alpha 3 1 1
MIRT029588 DOCK10 dedicator of cytokinesis 10 1 1
MIRT029589 PCCA propionyl CoA carboxylase, alpha polypeptide 1 1
MIRT029590 MAP3K12 mitogen-activated protein kinase kinase kinase 12 1 1
MIRT029591 MLNR motilin receptor 1 1
MIRT029592 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT029593 SP4 Sp4 transcription factor 1 1
MIRT029594 PARP6 poly (ADP-ribose) polymerase family, member 6 1 1
MIRT029595 KEAP1 kelch-like ECH-associated protein 1 1 1
MIRT029596 REPIN1 replication initiator 1 1 1
MIRT029597 MT1HL1 metallothionein 1 pseudogene 2 1 1
MIRT029598 TGFB1I1 transforming growth factor beta 1 induced transcript 1 1 1
MIRT029599 MRPS34 mitochondrial ribosomal protein S34 1 1
MIRT029600 PCBP3 poly(rC) binding protein 3 1 1
MIRT029601 ZNF195 zinc finger protein 195 1 1
MIRT029602 HIST1H2BI histone cluster 1, H2bi 1 1
MIRT029603 MFSD9 major facilitator superfamily domain containing 9 1 1
MIRT029604 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT029605 PNKP polynucleotide kinase 3'-phosphatase 1 1
MIRT029606 DPPA4 developmental pluripotency associated 4 1 1
MIRT029607 MB myoglobin 1 1
MIRT029608 TYMS thymidylate synthetase 1 1
MIRT029609 RAMP2-AS1 hypothetical LOC100190938 1 1
MIRT029610 KDELC1 KDEL (Lys-Asp-Glu-Leu) containing 1 1 1
MIRT029611 IFI44 interferon-induced protein 44 1 1
MIRT029612 SND1 staphylococcal nuclease and tudor domain containing 1 1 1
MIRT029613 FBXL6 F-box and leucine-rich repeat protein 6 1 1
MIRT029614 FCGR1B Fc fragment of IgG, high affinity Ib, receptor (CD64) 1 1
MIRT029615 ARNT2 aryl-hydrocarbon receptor nuclear translocator 2 1 1
MIRT029616 EVI2A ecotropic viral integration site 2A 1 1
MIRT029617 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT029618 BTG2 BTG family, member 2 1 1
MIRT029619 PDLIM1 PDZ and LIM domain 1 1 1
MIRT029620 ATAT1 chromosome 6 open reading frame 134 1 1
MIRT029621 RGS3 regulator of G-protein signaling 3 1 1
MIRT029622 DGKZ diacylglycerol kinase, zeta 104kDa 1 1
MIRT029623 TAF9 TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa 1 1
MIRT029624 FCN2 ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin) 1 1
MIRT029625 FAM105A family with sequence similarity 105, member A 1 1
MIRT029626 FAM3A family with sequence similarity 3, member A 1 1
MIRT029627 ATP6AP2 ATPase, H+ transporting, lysosomal accessory protein 2 1 1
MIRT029628 RBMS2 RNA binding motif, single stranded interacting protein 2 1 1
MIRT029629 CLINT1 clathrin interactor 1 1 1
MIRT029630 ENDOG endonuclease G 1 1
MIRT029631 CATSPERB cation channel, sperm-associated, beta 1 1
MIRT029632 LRFN3 leucine rich repeat and fibronectin type III domain containing 3 1 1
MIRT029633 WFDC6 WAP four-disulfide core domain 6 1 1
MIRT029634 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT029635 SHFM1 split hand/foot malformation (ectrodactyly) type 1 1 1
MIRT029636 SMC4 structural maintenance of chromosomes 4 1 1
MIRT029637 WDHD1 WD repeat and HMG-box DNA binding protein 1 1 1
MIRT029638 SPAG1 sperm associated antigen 1 1 1
MIRT029639 JOSD1 Josephin domain containing 1 1 1
MIRT029640 RNASEH1 ribonuclease H1 1 1
MIRT029641 JUN jun oncogene 1 1
MIRT029642 HSPA12A heat shock 70kDa protein 12A 1 1
MIRT029643 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT029644 USP6 ubiquitin specific peptidase 6 (Tre-2 oncogene) 1 1
MIRT029645 CD28 CD28 molecule 1 1
MIRT029646 MME membrane metallo-endopeptidase 1 1
MIRT029647 TMX4 thioredoxin-related transmembrane protein 4 1 1
MIRT029648 RAB30 RAB30, member RAS oncogene family 1 1
MIRT029649 GPC4 glypican 4 1 1
MIRT029650 NCAM2 neural cell adhesion molecule 2 1 1
MIRT029651 CHORDC1 cysteine and histidine-rich domain (CHORD)-containing 1 1 1
MIRT029652 FBXO28 F-box protein 28 1 1
MIRT029653 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT029654 TXLNA taxilin alpha 1 1
MIRT029655 SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 1 1
MIRT029656 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT029657 SAFB scaffold attachment factor B 1 1
MIRT029658 DRD3 dopamine receptor D3 1 1
MIRT029659 TTI2 chromosome 8 open reading frame 41 1 1
MIRT029660 CD248 CD248 molecule, endosialin 1 1
MIRT029661 MEGF8 multiple EGF-like-domains 8 1 1
MIRT029662 G6PD glucose-6-phosphate dehydrogenase 1 1
MIRT029663 ZNHIT1 zinc finger, HIT type 1 1 1
MIRT029664 ARFIP2 ADP-ribosylation factor interacting protein 2 1 1
MIRT029665 PCDHA11 protocadherin alpha 11 1 1
MIRT029666 PAQR4 progestin and adipoQ receptor family member IV 1 1
MIRT029667 GCH1 GTP cyclohydrolase 1 1 1
MIRT029668 C1D C1D nuclear receptor corepressor 1 1
MIRT029669 SIX1 SIX homeobox 1 1 1
MIRT029670 RNF187 ring finger protein 187 1 1
MIRT029671 DHODH dihydroorotate dehydrogenase 1 1
MIRT029672 NDUFS8 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) 1 1
MIRT029673 EMC7 chromosome 15 open reading frame 24 1 1
MIRT029674 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 1
MIRT029675 RTCB chromosome 22 open reading frame 28 1 1
MIRT029676 THAP10 THAP domain containing 10 1 1
MIRT029677 KRT18 keratin 18 1 1
MIRT029678 KCTD9 potassium channel tetramerisation domain containing 9 1 1
MIRT029679 HSD17B11 hydroxysteroid (17-beta) dehydrogenase 11 1 1
MIRT029680 PRY2 PTPN13-like, Y-linked 2 1 1
MIRT029681 UBB ubiquitin B 1 1
MIRT029682 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT029683 MRPL18 mitochondrial ribosomal protein L18 1 1
MIRT029684 FAHD2B fumarylacetoacetate hydrolase domain containing 2B 1 1
MIRT029685 ACBD3 acyl-CoA binding domain containing 3 1 1
MIRT029686 S100A2 S100 calcium binding protein A2 1 1
MIRT029687 TOP2B topoisomerase (DNA) II beta 180kDa 1 1
MIRT029688 SSX7 synovial sarcoma, X breakpoint 7 1 1
MIRT029689 EGR3 early growth response 3 1 1
MIRT029690 PANK3 pantothenate kinase 3 1 1
MIRT029691 ZNF548 zinc finger protein 548 1 1
MIRT029692 SPECC1L cytospin A 1 1
MIRT029693 MED9 mediator complex subunit 9 1 1
MIRT029694 POTEJ protein-coding 1 1
MIRT029695 SCAND2P SCAN domain containing 2 pseudogene 1 1
MIRT029696 CACNA1S calcium channel, voltage-dependent, L type, alpha 1S subunit 1 1
MIRT029697 IL22RA1 interleukin 22 receptor, alpha 1 1 1
MIRT029698 CARD14 caspase recruitment domain family, member 14 1 1
MIRT029699 CTSL2 cathepsin L2 1 1
MIRT029700 HGD homogentisate 1,2-dioxygenase 1 1
MIRT029701 SLC35F5 solute carrier family 35, member F5 1 1
MIRT029702 WDR25 WD repeat domain 25 1 1
MIRT029703 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT029704 HDAC5 histone deacetylase 5 1 1
MIRT029705 AGMAT agmatine ureohydrolase (agmatinase) 1 1
MIRT029706 RAPGEF4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT029707 TEX2 testis expressed 2 1 1
MIRT029708 ABCA6 ATP-binding cassette, sub-family A (ABC1), member 6 1 1
MIRT029709 STUB1 STIP1 homology and U-box containing protein 1 1 1
MIRT029710 SRP9P1 signal recognition particle 9-like 1 1 1
MIRT029711 LCAT lecithin-cholesterol acyltransferase 1 1
MIRT029712 TCN1 transcobalamin I (vitamin B12 binding protein, R binder family) 1 1
MIRT029713 C1QTNF9B-AS1 prostate collagen triple helix 1 1
MIRT029714 CXCL6 chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) 1 1
MIRT029715 GHSR growth hormone secretagogue receptor 1 1
MIRT029716 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT029717 RRS1 RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) 1 1
MIRT029718 OXA1L oxidase (cytochrome c) assembly 1-like 1 1
MIRT029719 C1orf216 chromosome 1 open reading frame 216 1 1
MIRT029720 ZNF584 zinc finger protein 584 1 1
MIRT029721 ANXA5 annexin A5 1 1
MIRT029722 MARC2 MOCO sulphurase C-terminal domain containing 2 1 1
MIRT029723 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT029724 LSAMP limbic system-associated membrane protein 1 1
MIRT029725 ANKRD36BP1 ankyrin repeat domain 36B pseudogene 1 1 1
MIRT029726 GREB1L growth regulation by estrogen in breast cancer-like 1 1
MIRT029727 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT029728 GABRB3 gamma-aminobutyric acid (GABA) A receptor, beta 3 1 1
MIRT029729 ZNF136 zinc finger protein 136 1 1
MIRT029730 ELF4 E74-like factor 4 (ets domain transcription factor) 1 1
MIRT029731 KIF21B kinesin family member 21B 1 1
MIRT029732 CTNS cystinosis, nephropathic 1 1
MIRT029733 STARD5 StAR-related lipid transfer (START) domain containing 5 1 1
MIRT029734 NKX2-2 NK2 homeobox 2 1 1
MIRT029735 SMYD2 SET and MYND domain containing 2 1 1
MIRT029736 TRANK1 tetratricopeptide repeat and ankyrin repeat containing 1 1 1
MIRT029737 MARCH1 membrane-associated ring finger (C3HC4) 1 1 1
MIRT029738 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 1 1
MIRT029739 KIAA0947 KIAA0947 1 1
MIRT029740 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT029741 DNAJC11 DnaJ (Hsp40) homolog, subfamily C, member 11 1 1
MIRT029742 GSR glutathione reductase 1 1
MIRT029743 ZNF207 zinc finger protein 207 1 1
MIRT029744 HADH hydroxyacyl-CoA dehydrogenase 1 1
MIRT029745 FDFT1 farnesyl-diphosphate farnesyltransferase 1 1 1
MIRT029746 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT029747 PMP22 peripheral myelin protein 22 1 1
MIRT029748 BNC1 basonuclin 1 1 1
MIRT029749 SNAP91 synaptosomal-associated protein, 91kDa homolog (mouse) 1 1
MIRT029750 EED embryonic ectoderm development 1 1
MIRT029751 CAV2 caveolin 2 1 1
MIRT029752 GALK1 galactokinase 1 1 1
MIRT029753 CFI complement factor I 1 1
MIRT029754 HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 1 1
MIRT029755 APOO apolipoprotein O 1 1
MIRT029756 COQ9 coenzyme Q9 homolog (S. cerevisiae) 1 1
MIRT029757 SLC16A4 solute carrier family 16, member 4 (monocarboxylic acid transporter 5) 1 1
MIRT029758 POU4F3 POU class 4 homeobox 3 1 1
MIRT029759 TSFM Ts translation elongation factor, mitochondrial 1 1
MIRT029760 ACAA2 acetyl-CoA acyltransferase 2 1 1
MIRT029761 GRTP1 growth hormone regulated TBC protein 1 1 1
MIRT029762 RPGRIP1 retinitis pigmentosa GTPase regulator interacting protein 1 1 1
MIRT029763 GATA2 GATA binding protein 2 1 1
MIRT029764 PAQR6 progestin and adipoQ receptor family member VI 1 1
MIRT029765 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae) 1 1
MIRT029766 RAB3A RAB3A, member RAS oncogene family 1 1
MIRT029767 C1orf63 chromosome 1 open reading frame 63 1 1
MIRT029768 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT029769 OXSR1 oxidative-stress responsive 1 1 1
MIRT029770 METRN meteorin, glial cell differentiation regulator 1 1
MIRT029771 FSTL1 follistatin-like 1 1 1
MIRT029772 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT029773 CNNM2 cyclin M2 1 1
MIRT029774 SERPINI2 serpin peptidase inhibitor, clade I (pancpin), member 2 1 1
MIRT029775 WBP5 WW domain binding protein 5 1 1
MIRT029776 ACTR5 ARP5 actin-related protein 5 homolog (yeast) 1 1
MIRT029777 CLSTN2 calsyntenin 2 1 1
MIRT029778 ANXA8 annexin A8 1 1
MIRT029779 IL1R2 interleukin 1 receptor, type II 1 1
MIRT029780 FASLG Fas ligand (TNF superfamily, member 6) 1 1
MIRT029781 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT029782 TPM3 tropomyosin 3 1 1
MIRT029783 CEND1 cell cycle exit and neuronal differentiation 1 1 1
MIRT029784 STXBP3 syntaxin binding protein 3 1 1
MIRT029785 TRAM2 translocation associated membrane protein 2 1 1
MIRT029786 ETV4 ets variant 4 1 1
MIRT029787 IL7R interleukin 7 receptor 1 1
MIRT029788 PNOC prepronociceptin 1 1
MIRT029789 RAD51D RAD51-like 3 (S. cerevisiae) 1 1
MIRT029790 CSPG5 chondroitin sulfate proteoglycan 5 (neuroglycan C) 1 1
MIRT029791 DDX25 DEAD (Asp-Glu-Ala-Asp) box polypeptide 25 1 1
MIRT029792 ADRA2A adrenergic, alpha-2A-, receptor 1 1
MIRT029793 IKZF1 IKAROS family zinc finger 1 (Ikaros) 1 1
MIRT029794 GPR17 G protein-coupled receptor 17 1 1
MIRT029795 KIAA0101 KIAA0101 1 1
MIRT029796 FKBP9 FK506 binding protein 9, 63 kDa 1 1
MIRT029797 BMP8B bone morphogenetic protein 8b 1 1
MIRT029798 F3 coagulation factor III (thromboplastin, tissue factor) 1 1
MIRT029799 TRMT2A TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) 1 1
MIRT029800 IL36RN interleukin 1 family, member 5 (delta) 1 1
MIRT029801 TIPARP TCDD-inducible poly(ADP-ribose) polymerase 1 1
MIRT029802 PODNL1 podocan-like 1 1 1
MIRT029803 SLC3A2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1 1
MIRT029804 IER5 immediate early response 5 1 1
MIRT029805 KRTAP5-7 keratin associated protein 5-7 1 1
MIRT029806 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT029807 AAMDC chromosome 11 open reading frame 67 1 1
MIRT029808 MBIP MAP3K12 binding inhibitory protein 1 1 1
MIRT029809 GPR183 G protein-coupled receptor 183 1 1
MIRT029810 BRDT bromodomain, testis-specific 1 1
MIRT029811 RPS6KB2 ribosomal protein S6 kinase, 70kDa, polypeptide 2 1 1
MIRT029812 RPLP1 ribosomal protein, large, P1 1 1
MIRT029813 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 1
MIRT029814 BCHE butyrylcholinesterase 1 1
MIRT029815 CNTRL centrosomal protein 110kDa 1 1
MIRT029816 RRAS2 related RAS viral (r-ras) oncogene homolog 2 1 1
MIRT029817 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1 1
MIRT029818 MAT2B methionine adenosyltransferase II, beta 1 1
MIRT029819 DDX60 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 1 1
MIRT029820 SMPDL3A sphingomyelin phosphodiesterase, acid-like 3A 1 1
MIRT029821 PACRG PARK2 co-regulated 1 1
MIRT029822 ZNF85 zinc finger protein 85 1 1
MIRT029823 TBCCD1 TBCC domain containing 1 1 1
MIRT029824 CHM choroideremia (Rab escort protein 1) 1 1
MIRT029825 C7orf10 chromosome 7 open reading frame 10 1 1
MIRT029826 CH25H cholesterol 25-hydroxylase 1 1
MIRT029827 SUPT3H suppressor of Ty 3 homolog (S. cerevisiae) 1 1
MIRT029828 RFX7 regulatory factor X, 7 1 1
MIRT029829 SEPT7 septin 7 1 1
MIRT029830 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT029831 RCN2 reticulocalbin 2, EF-hand calcium binding domain 1 1
MIRT029832 PLOD2 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 1 1
MIRT029833 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 1
MIRT029834 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT029835 CCR6 chemokine (C-C motif) receptor 6 1 1
MIRT029836 UBL3 ubiquitin-like 3 1 1
MIRT029837 CASD1 CAS1 domain containing 1 1 1
MIRT029838 GALNT11 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11) 1 1
MIRT029839 FAM127B family with sequence similarity 127, member B 1 1
MIRT029840 STOML2 stomatin (EPB72)-like 2 1 1
MIRT029841 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT029842 POM121L1P POM121 membrane glycoprotein-like 1 (rat) pseudogene 1 1
MIRT029843 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT029844 GRHL2 grainyhead-like 2 (Drosophila) 1 1
MIRT029845 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 1 1
MIRT029846 TPRKB TP53RK binding protein 1 1
MIRT029847 RASIP1 Ras interacting protein 1 1 1
MIRT029848 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 1 1
MIRT029849 LMNB1 lamin B1 1 1
MIRT029850 DSC1 desmocollin 1 1 1
MIRT029851 C9orf16 chromosome 9 open reading frame 16 1 1
MIRT029852 MEF2D myocyte enhancer factor 2D 1 1
MIRT029853 CYTIP cytohesin 1 interacting protein 1 1
MIRT029854 CNTFR ciliary neurotrophic factor receptor 1 1
MIRT029855 TMPRSS11E transmembrane protease, serine 11E 1 1
MIRT029856 RXFP3 relaxin/insulin-like family peptide receptor 3 1 1
MIRT029857 POTEG POTE ankyrin domain family, member G 1 1
MIRT029858 CTSD cathepsin D 1 1
MIRT029859 CNPY3 canopy 3 homolog (zebrafish) 1 1
MIRT029860 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT029861 DPM1 dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit 1 1
MIRT029862 KLHL21 kelch-like 21 (Drosophila) 1 1
MIRT029863 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT029864 FBLN5 fibulin 5 1 1
MIRT029865 DEFB4A defensin, beta 4A 1 1
MIRT029866 SETD5 SET domain containing 5 1 1
MIRT029867 EPPIN serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) 1 1
MIRT029868 LAMP3 lysosomal-associated membrane protein 3 1 1
MIRT029869 CEP85 coiled-coil domain containing 21 1 1
MIRT029870 TEAD3 TEA domain family member 3 1 1
MIRT029871 CTDNEP1 dullard homolog (Xenopus laevis) 1 1
MIRT029872 TRIOBP TRIO and F-actin binding protein 1 1
MIRT029873 CYP11B2 cytochrome P450, family 11, subfamily B, polypeptide 2 1 1
MIRT029874 DCUN1D2 DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) 1 1
MIRT029875 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT029876 ZNF480 zinc finger protein 480 1 1
MIRT029877 NR2E1 nuclear receptor subfamily 2, group E, member 1 1 1
MIRT029878 MTHFS 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) 1 1
MIRT029879 TMEM41B transmembrane protein 41B 1 1
MIRT029880 GADD45A growth arrest and DNA-damage-inducible, alpha 1 1
MIRT029881 GGH gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) 1 1
MIRT029882 RAB23 RAB23, member RAS oncogene family 1 1
MIRT029883 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT029884 IFITM3 interferon induced transmembrane protein 3 (1-8U) 1 1
MIRT029885 GABARAP GABA(A) receptor-associated protein 1 1
MIRT029886 SLC25A28 solute carrier family 25, member 28 1 1
MIRT029887 TSPAN12 tetraspanin 12 1 1
MIRT029888 IRGC immunity-related GTPase family, cinema 1 1
MIRT029889 TLX1 T-cell leukemia homeobox 1 1 1
MIRT029890 CHPF chondroitin polymerizing factor 1 1
MIRT029891 SFMBT1 Scm-like with four mbt domains 1 1 1
MIRT029892 EFNA2 ephrin-A2 1 1
MIRT029893 TRIM6 tripartite motif-containing 6 1 1
MIRT029894 EMC3 transmembrane protein 111 1 1
MIRT029895 MTCH2 mitochondrial carrier homolog 2 (C. elegans) 1 1
MIRT029896 ACTR8 ARP8 actin-related protein 8 homolog (yeast) 1 1
MIRT029897 SNAI1 snail homolog 1 (Drosophila) 1 1
MIRT029898 FKRP fukutin related protein 1 1
MIRT029899 EXT2 exostosin 2 1 1
MIRT029900 ZKSCAN7 zinc finger protein 167 1 1
MIRT029901 STAG1 stromal antigen 1 1 1
MIRT029902 CNIH4 cornichon homolog 4 (Drosophila) 1 1
MIRT029903 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT029904 CENPQ centromere protein Q 1 1
MIRT029905 DTNB dystrobrevin, beta 1 1
MIRT029906 CCSER2 family with sequence similarity 190, member B 1 1
MIRT029907 WRB tryptophan rich basic protein 1 1
MIRT029908 SLC17A6 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 1 1
MIRT029909 PER3 period homolog 3 (Drosophila) 1 1
MIRT029910 CCDC144A coiled-coil domain containing 144A 1 1
MIRT029911 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT029912 NTNG1 netrin G1 1 1
MIRT029913 MTCP1 mature T-cell proliferation 1 1 1
MIRT029914 JAM2 junctional adhesion molecule 2 1 1
MIRT029915 PRR5L proline rich 5 like 1 1
MIRT029916 TRPC4 transient receptor potential cation channel, subfamily C, member 4 1 1
MIRT029917 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT029918 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1 1
MIRT029919 GSPT2 G1 to S phase transition 2 1 1
MIRT029920 UNC13A unc-13 homolog A (C. elegans) 1 1
MIRT029921 NOX3 NADPH oxidase 3 1 1
MIRT029922 TASP1 taspase, threonine aspartase, 1 1 1
MIRT029923 GLI2 GLI family zinc finger 2 1 1
MIRT029924 PSMB7 proteasome (prosome, macropain) subunit, beta type, 7 1 1
MIRT029925 MAPKAP1 mitogen-activated protein kinase associated protein 1 1 1
MIRT029926 HERPUD1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 1 1
MIRT029927 ZNF551 zinc finger protein 551 1 1
MIRT029928 GDF11 growth differentiation factor 11 1 1
MIRT029929 ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 1 1
MIRT029930 TCEB3B transcription elongation factor B polypeptide 3B (elongin A2) 1 1
MIRT029931 FGGY FGGY carbohydrate kinase domain containing 1 1
MIRT029932 OAZ2 ornithine decarboxylase antizyme 2 1 1
MIRT029933 NRBP1 nuclear receptor binding protein 1 1 1
MIRT029934 KCTD14 potassium channel tetramerisation domain containing 14 1 1
MIRT029935 GKN1 gastrokine 1 1 1
MIRT029936 TULP2 tubby like protein 2 1 1
MIRT029937 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT029938 ZNF839 zinc finger protein 839 1 1
MIRT029939 TRPM1 transient receptor potential cation channel, subfamily M, member 1 1 1
MIRT029940 RELB v-rel reticuloendotheliosis viral oncogene homolog B 1 1
MIRT029941 NOP10 NOP10 ribonucleoprotein homolog (yeast) 1 1
MIRT029942 CASQ1 calsequestrin 1 (fast-twitch, skeletal muscle) 1 1
MIRT029943 COLEC12 collectin sub-family member 12 1 1
MIRT029944 SCO2 SCO cytochrome oxidase deficient homolog 2 (yeast) 1 1
MIRT029945 FICD FIC domain containing 1 1
MIRT029946 GREM2 gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) 1 1
MIRT029947 CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 1 1
MIRT029948 IBSP integrin-binding sialoprotein 1 1
MIRT029949 DERA 2-deoxyribose-5-phosphate aldolase homolog (C. elegans) 1 1
MIRT029950 SULT1B1 sulfotransferase family, cytosolic, 1B, member 1 1 1
MIRT029951 PSME1 proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) 1 1
MIRT029952 PRYP3 PTPN13-like, Y-linked pseudogene 3 1 1
MIRT029953 ZWINT ZW10 interactor 1 1
MIRT029954 GNB3 guanine nucleotide binding protein (G protein), beta polypeptide 3 1 1
MIRT029955 PARK7 Parkinson disease (autosomal recessive, early onset) 7 1 1
MIRT029956 PMF1 polyamine-modulated factor 1 1 1
MIRT029957 ANKRD36B ankyrin repeat domain 36B 1 1
MIRT029958 GAL3ST1 galactose-3-O-sulfotransferase 1 1 1
MIRT029959 B3GALT1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 1 1
MIRT029960 FES feline sarcoma oncogene 1 1
MIRT029961 NME5 non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) 1 1
MIRT029962 GPR39 G protein-coupled receptor 39 1 1
MIRT029963 TRIM17 tripartite motif-containing 17 1 1
MIRT029964 CCNB1IP1 cyclin B1 interacting protein 1 1 1
MIRT029965 TOR4A chromosome 9 open reading frame 167 1 1
MIRT029966 MAP4K3 mitogen-activated protein kinase kinase kinase kinase 3 1 1
MIRT029967 GMNN geminin, DNA replication inhibitor 1 1
MIRT029968 ECH1 enoyl CoA hydratase 1, peroxisomal 1 1
MIRT029969 TSGA10 testis specific, 10 1 1
MIRT029970 UXT ubiquitously-expressed transcript 1 1
MIRT029971 VTN vitronectin 1 1
MIRT029972 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT029973 TNFRSF11A tumor necrosis factor receptor superfamily, member 11a, NFKB activator 1 1
MIRT029974 HIST2H4B histone cluster 2, H4b 1 1
MIRT029975 KCNF1 potassium voltage-gated channel, subfamily F, member 1 1 1
MIRT029976 NDUFB1 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa 1 1
MIRT029977 OSTF1 osteoclast stimulating factor 1 1 1
MIRT029978 DDB2 damage-specific DNA binding protein 2, 48kDa 1 1
MIRT029979 KDM5D lysine (K)-specific demethylase 5D 1 1
MIRT029980 FOXD2 forkhead box D2 1 1
MIRT029981 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT029982 HSF1 heat shock transcription factor 1 1 1
MIRT029983 SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 1 1
MIRT029984 GPATCH2 G patch domain containing 2 1 1
MIRT029985 AFAP1 actin filament associated protein 1 1 1
MIRT029986 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT029987 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT029988 PAPPA pregnancy-associated plasma protein A, pappalysin 1 1 1
MIRT029989 EXOC6B exocyst complex component 6B 1 1
MIRT029990 NET1 neuroepithelial cell transforming 1 1 1
MIRT029991 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 1
MIRT029992 TMEM62 transmembrane protein 62 1 1
MIRT029993 RNF111 ring finger protein 111 1 1
MIRT029994 HPS4 Hermansky-Pudlak syndrome 4 1 1
MIRT029995 PCSK1 proprotein convertase subtilisin/kexin type 1 1 1
MIRT029996 FAM198B family with sequence similarity 198, member B 1 1
MIRT029997 PLGRKT chromosome 9 open reading frame 46 1 1
MIRT029998 RPS6KC1 ribosomal protein S6 kinase, 52kDa, polypeptide 1 1 1
MIRT029999 NPTXR neuronal pentraxin receptor