Accession ID: MIRT004669 [miRNA, hsa-miR-195-5p :: CCL4, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-195LinkOut: [miRBase ]
Description Homo sapiens miR-195 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-195-5p
Mature Sequence 15| UAGCAGCACAGAAAUAUUGGC |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-195-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CCL4 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ACT2, AT744.1, G-26, HC21, LAG-1, LAG1, MIP-1-beta, MIP1B, MIP1B1, SCYA2, SCYA4
Description chemokine (C-C motif) ligand 4
Transcript NM_002984    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CCL4 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CCL4
(miRNA target sites are highlighted)
>CCL4|NM_002984|3'UTR
   1 GCTGCTCAGAGACAGGAAGTCTTCAGGGAAGGTCACCTGAGCCCGGATGCTTCTCCATGAGACACATCTCCTCCATACTC
  81 AGGACTCCTCTCCGCAGTTCCTGTCCCTTCTCTTAATTTAATCTTTTTTATGTGCCGTGTTATTGTATTAGGTGTCATTT
 161 CCATTATTTATATTAGTTTAGCCAAAGGATAAGTGTCCCCTATGGGGATGGTCCACTGTCACTGTTTCTCTGCTGTTGCA
 241 AATACATGGATAACACATTTGATTCTGTGTGTTTTCATAATAAAACTTTAAAATAAAATGCAGACAGTT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgGUUAUAAAGACACGACGAu 5'
            || |:||||| |||||:| 
Target 5' gtCACTGTTTCTCTGCTGTTg 3'
218 - 238 159.00 -18.70
2
miRNA  3' cgguuauaaagacaCGACGAu 5'
                        |||||| 
Target 5' --------------GCTGCTc 3'
1 - 7 120.00 -6.20
3
miRNA  3' cgGUUAUAAAG---ACACG--ACGAu 5'
            :||| |||:   |||||  ||:| 
Target 5' ttTAATCTTTTTTATGTGCCGTGTTa 3'
117 - 142 111.00 -7.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-195-5p :: CCL4    [ Functional MTI ]
Validation Method ELISA , Immunoprecipitaion , qRT-PCR , Western blot , Other
Conditions THP-1
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... We selected microRNA-195a among several microRNAs that showed comple- mentary target sites in 39-UTRs of MIP-1b mRNA, and also the microRNA-195a binding site was conserved among species, suggesting a possible role for microRNA-195a in the regulation of MIP- 1b mRNA and protein expression.// Moreover, ET-1-induced MIP-1b mRNA expression in either THP-1 cells or peripheral blood monocytes was reduced upon expression of microRNA-195a. Conversely, transfection of monocytes with anti-microRNA-195a oligonucleotide augmented several-fold ET-1-induced MIP-1b expression. Taken together, these studies showed that ET-1-mediated MIP-1b gene expression is regulated via hypoxia-response elements, AP-1, and NF-kB cis-binding elements in its promoter and negatively regulated by microRNA-195, which targets the 39 untranslated region of MIP-1b RNA.// ...

- Gonsalves, C. Kalra, V. K., 2010, J Immunol.

Article - Gonsalves, C. Kalra, V. K.
- J Immunol, 2010
Patients with sickle cell disease (SCD) exhibit a chronic inflammatory state manifested by leukocytosis and increased circulating levels of proinflammatory cytochemokines. Our studies show that placenta growth factor levels are high in SCD, and placental growth factor induces the release of the vasoconstrictor endothelin-1 (ET-1) from pulmonary microvascular endothelial cells. In this study, we observed that ET-1 increased the expression of the chemokines MIP-1beta or CCL4. ET-1-induced MIP-1beta mRNA expression in THP-1 cells and human peripheral blood monocytes occurred via the activation of PI3K, NADPH oxidase, p38 MAPK, and JNK-1 but not JNK-2. ET-1-induced MIP-1beta expression involved hypoxia-inducible factor-1alpha (HIF-1alpha), independent of hypoxia, as demonstrated by silencing with HIF-1alpha small interfering RNA, EMSA, and chromatin immunoprecipitation analysis. ET-1-induced MIP-1beta promoter luciferase activity was attenuated when any of the five hypoxia-response elements, AP-1, or NF-kappaB binding motifs in the proximal MIP-1beta promoter (-1053/+43 bp) were mutated. Furthermore, ET-1 significantly downregulated the expression of a key microRNA, microRNA-195a, which showed a complementary binding site in the 3' untranslated region of MIP-1beta mRNA. Moreover, ET-1-induced MIP-1beta mRNA expression in either THP-1 cells or peripheral blood monocytes was reduced upon expression of microRNA-195a. Conversely, transfection of monocytes with anti-microRNA-195a oligonucleotide augmented several-fold ET-1-induced MIP-1beta expression. Taken together, these studies showed that ET-1-mediated MIP-1beta gene expression is regulated via hypoxia-response elements, AP-1, and NF-kappaB cis-binding elements in its promoter and negatively regulated by microRNA-195, which targets the 3' untranslated region of MIP-1beta RNA. These studies provide what we believe are new avenues, based on targets of HIF-1alpha and microRNAs, for ameliorating inflammation in SCD.
LinkOut: [PMID: 20952681]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
612 hsa-miR-195-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000222 WEE1 WEE1 homolog (S. pombe) 6 5
MIRT000223 E2F3 E2F transcription factor 3 5 3
MIRT000224 CDK6 cyclin-dependent kinase 6 5 3
MIRT000225 CCND1 cyclin D1 5 7
MIRT000785 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT000795 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT004273 VEGFA vascular endothelial growth factor A 3 9
MIRT004390 SKI v-ski sarcoma viral oncogene homolog (avian) 3 3
MIRT004669 CCL4 chemokine (C-C motif) ligand 4 3 1
MIRT004937 KRT7 keratin 7 2 1
MIRT005362 BCL2 B-cell CLL/lymphoma 2 5 3
MIRT006077 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 3 2
MIRT006080 RUNX2 runt-related transcription factor 2 3 1
MIRT006235 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 3 3
MIRT006245 TBCCD1 TBCC domain containing 1 3 2
MIRT006246 CCND3 cyclin D3 2 2
MIRT006252 CDK4 cyclin-dependent kinase 4 2 2
MIRT006995 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 2
MIRT007054 CAB39 calcium binding protein 39 2 1
MIRT007169 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007170 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT007219 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT007237 CCNE1 cyclin E1 3 5
MIRT007370 BCL2L2 BCL2-like 2 2 1
MIRT044858 JAK2 Janus kinase 2 1 1
MIRT044859 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT044860 AGER advanced glycosylation end product-specific receptor 1 1
MIRT044861 LSM11 LSM11, U7 small nuclear RNA associated 1 3
MIRT044862 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT044863 ZNF280C zinc finger protein 280C 1 1
MIRT044864 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT044865 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT044866 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT044867 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT044868 RPL10 ribosomal protein L10 1 1
MIRT044869 TMC6 transmembrane channel-like 6 1 1
MIRT044870 TPI1 triosephosphate isomerase 1 1 1
MIRT044871 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 1 1
MIRT044872 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT053191 TAR Thrombocytopenia-absent radius syndrome 2 1
MIRT053194 DICER1 dicer 1, ribonuclease type III 3 2
MIRT053228 FASN fatty acid synthase 4 3
MIRT053467 ARL2 ADP-ribosylation factor-like 2 4 1
MIRT054417 BIRC5 baculoviral IAP repeat containing 5 2 1
MIRT054418 WNT7A wingless-type MMTV integration site family, member 7A 2 1
MIRT054890 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 1
MIRT054904 ATG14 autophagy related 14 3 2
MIRT055424 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 6
MIRT055817 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT057517 CEP55 centrosomal protein 55kDa 1 4
MIRT057735 ZDHHC16 zinc finger, DHHC-type containing 16 1 1
MIRT057909 STXBP3 syntaxin binding protein 3 1 1
MIRT061007 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061249 AMOTL1 angiomotin like 1 1 6
MIRT061531 BTG2 BTG family, member 2 1 1
MIRT063399 ETNK1 ethanolamine kinase 1 1 1
MIRT064688 CCND2 cyclin D2 1 2
MIRT065716 TARBP2 TAR (HIV-1) RNA binding protein 2 1 2
MIRT066296 MTFR1L family with sequence similarity 54, member B 1 1
MIRT066314 USP15 ubiquitin specific peptidase 15 1 1
MIRT068658 AKAP11 A kinase (PRKA) anchor protein 11 1 1
MIRT071211 FCF1 FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) 1 1
MIRT072825 ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 1 3
MIRT074533 PAGR1 PAXIP1 associated glutamate-rich protein 1 1 2
MIRT075254 SNTB2 syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2) 1 2
MIRT075277 VPS4A vacuolar protein sorting 4 homolog A (S. cerevisiae) 1 4
MIRT075896 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076795 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077785 MINK1 misshapen-like kinase 1 1 1
MIRT078285 RPS6KB1 ribosomal protein S6 kinase, 70kDa, polypeptide 1 1 1
MIRT079658 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 6
MIRT080014 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 2
MIRT082988 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT083269 ZCCHC3 zinc finger, CCHC domain containing 3 1 3
MIRT084465 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085217 CCNT2 cyclin T2 1 1
MIRT086012 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087426 ZNRF3 zinc and ring finger 3 1 1
MIRT087557 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide 1 1
MIRT088106 SEPT2 septin 2 1 1
MIRT089111 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089211 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1 2
MIRT090450 CDV3 CDV3 homolog (mouse) 1 1
MIRT090691 U2SURP U2 snRNP-associated SURP domain containing 1 1
MIRT091673 RARB retinoic acid receptor, beta 1 3
MIRT092195 ITPR1 inositol 1,4,5-trisphosphate receptor, type 1 1 1
MIRT092213 BHLHE40 basic helix-loop-helix family, member e40 1 1
MIRT093687 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT095434 PURA purine-rich element binding protein A 1 1
MIRT096238 CANX calnexin 1 1
MIRT098830 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT100210 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT100368 HSPA1B heat shock 70kDa protein 1B 1 4
MIRT100571 PIM1 pim-1 oncogene 1 1
MIRT100899 CD2AP CD2-associated protein 1 1
MIRT102439 CALU calumenin 1 2
MIRT102635 UBN2 ubinuclein 2 1 6
MIRT102973 EN2 engrailed homeobox 2 1 3
MIRT103096 MAFK v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) 1 3
MIRT103858 FOXK1 forkhead box K1 1 2
MIRT104019 USP42 ubiquitin specific peptidase 42 1 3
MIRT104235 DMTF1 cyclin D binding myb-like transcription factor 1 1 2
MIRT106297 ZFHX4 zinc finger homeobox 4 1 3
MIRT106736 RAD23B RAD23 homolog B (S. cerevisiae) 1 2
MIRT107220 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT107688 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT108985 SLC9A6 solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6 1 1
MIRT109244 ZNF275 zinc finger protein 275 1 1
MIRT110056 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112974 LUZP1 leucine zipper protein 1 1 3
MIRT114927 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT117659 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120683 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT125925 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT127735 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128805 UBE4A ubiquitination factor E4A 1 1
MIRT129059 ARCN1 archain 1 1 1
MIRT130383 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT131102 TMEM138 transmembrane protein 138 1 1
MIRT132746 RASSF5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT132836 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133339 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT137521 RCOR1 REST corepressor 1 1 1
MIRT140151 SPRED1 sprouty-related, EVH1 domain containing 1 1 2
MIRT140827 SMAD3 SMAD family member 3 1 1
MIRT141246 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141285 UBE2Q2 ubiquitin-conjugating enzyme E2Q family member 2 1 1
MIRT142244 DCTN5 dynactin 5 (p25) 1 5
MIRT144030 PSKH1 protein serine kinase H1 1 1
MIRT145386 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146023 EZH1 enhancer of zeste homolog 1 (Drosophila) 1 1
MIRT146359 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146502 SNX11 sorting nexin 11 1 1
MIRT148310 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT150358 IER2 immediate early response 2 1 1
MIRT152285 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 2
MIRT152512 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152753 KIF3B kinesin family member 3B 1 1
MIRT152932 NOL4L chromosome 20 open reading frame 112 1 1
MIRT154051 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT154403 CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT156463 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT158529 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT159005 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT159592 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160173 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163261 PRKCD protein kinase C, delta 1 1
MIRT164271 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164961 TADA2B transcriptional adaptor 2B 1 1
MIRT165180 GRAMD3 GRAM domain containing 3 1 2
MIRT165896 CREBRF CREB3 regulatory factor 1 2
MIRT168591 HMGA1 high mobility group AT-hook 1 1 1
MIRT168685 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT169070 IRF4 interferon regulatory factor 4 1 1
MIRT170158 KLHDC10 kelch domain containing 10 1 1
MIRT170740 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171604 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172819 HMBOX1 homeobox containing 1 1 1
MIRT174792 RNF38 ring finger protein 38 1 1
MIRT175236 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175527 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179012 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 1
MIRT180911 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186374 PNRC2 proline-rich nuclear receptor coactivator 2 1 1
MIRT189763 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189964 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT190187 GPR180 G protein-coupled receptor 180 1 3
MIRT191457 PPM1A protein phosphatase, Mg2+/Mn2+ dependent, 1A 1 1
MIRT191628 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 3
MIRT194241 FAM103A1 family with sequence similarity 103, member A1 1 3
MIRT194907 RBBP6 retinoblastoma binding protein 6 1 4
MIRT196278 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT196455 TAOK1 TAO kinase 1 1 1
MIRT201458 SNRPB2 small nuclear ribonucleoprotein polypeptide B 1 4
MIRT204596 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204627 MOB4 MOB family member 4, phocein 1 4
MIRT204743 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206022 NUP50 nucleoporin 50kDa 1 4
MIRT211200 FGF2 fibroblast growth factor 2 (basic) 1 2
MIRT211316 HSPA4L heat shock 70kDa protein 4-like 1 2
MIRT212610 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217747 TBPL1 TBP-like 1 1 2
MIRT223692 FZD6 frizzled family receptor 6 1 3
MIRT224968 BAG4 BCL2-associated athanogene 4 1 1
MIRT229349 ZNF449 zinc finger protein 449 1 1
MIRT229863 YIPF6 Yip1 domain family, member 6 1 1
MIRT230122 DDX3Y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT234345 MSL1 male-specific lethal 1 homolog (Drosophila) 1 4
MIRT245006 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246940 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT247239 ELK4 ELK4, ETS-domain protein (SRF accessory protein 1) 1 2
MIRT247370 GABARAPL1 GABA(A) receptor-associated protein like 1 1 3
MIRT248555 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248768 ATXN7L3B ataxin 7-like 3B 1 2
MIRT249452 ZNF691 zinc finger protein 691 1 2
MIRT251494 DYNLL2 dynein, light chain, LC8-type 2 1 2
MIRT255337 SRPRB signal recognition particle receptor, B subunit 1 3
MIRT256310 CDC42SE2 CDC42 small effector 2 1 1
MIRT258413 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265058 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265078 CHEK1 checkpoint kinase 1 1 2
MIRT267256 TMEM109 transmembrane protein 109 1 1
MIRT267531 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270456 SIRT4 sirtuin 4 1 1
MIRT270555 SETD1B SET domain containing 1B 1 1
MIRT273668 HOXC8 homeobox C8 1 1
MIRT274744 RAB3IP RAB3A interacting protein (rabin3) 1 1
MIRT277508 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 2
MIRT282537 SLCO3A1 solute carrier organic anion transporter family, member 3A1 1 1
MIRT286970 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT289633 CBX2 chromobox homolog 2 1 1
MIRT294286 ZFP28 zinc finger protein 28 homolog (mouse) 1 1
MIRT295814 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297781 GABPA GA binding protein transcription factor, alpha subunit 60kDa 1 2
MIRT300108 STRADB STE20-related kinase adaptor beta 3 2
MIRT300997 MTMR3 myotubularin related protein 3 1 1
MIRT302617 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 3
MIRT302828 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307144 CTDSPL CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like 1 2
MIRT313678 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 1 1
MIRT314054 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 4
MIRT317724 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 4
MIRT319334 CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 1 1
MIRT320630 ZNRF2 zinc and ring finger 2 1 1
MIRT324841 IFT74 intraflagellar transport 74 homolog (Chlamydomonas) 1 1
MIRT326305 OCRL oculocerebrorenal syndrome of Lowe 1 1
MIRT327966 CHIC1 cysteine-rich hydrophobic domain 1 1 3
MIRT367267 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT437657 ALOX12 arachidonate 12-lipoxygenase 2 1
MIRT437658 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437659 CGNL1 cingulin-like 1 2 1
MIRT437660 KIF21A kinesin family member 21A 2 1
MIRT437661 RASGEF1B RasGEF domain family, member 1B 2 1
MIRT437662 TUFT1 tuftelin 1 2 1
MIRT437663 PDIA6 protein disulfide isomerase family A, member 6 3 3
MIRT437664 SNX16 sorting nexin 16 3 4
MIRT437665 TRIP10 thyroid hormone receptor interactor 10 2 1
MIRT437792 CDC25A cell division cycle 25 homolog A (S. pombe) 3 3
MIRT437793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 3 2
MIRT438296 INSR insulin receptor 3 1
MIRT438377 ELN elastin 3 1
MIRT438609 RET ret proto-oncogene 1 1
MIRT438896 Bace1 beta-site APP cleaving enzyme 1 1 1
MIRT443814 SIDT2 SID1 transmembrane family, member 2 1 1
MIRT446505 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447775 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448444 TLL1 tolloid-like 1 1 1
MIRT449187 LUC7L3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT451836 ALDH3B1 aldehyde dehydrogenase 3 family, member B1 1 1
MIRT453285 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453751 CSNK1E casein kinase 1, epsilon 1 1
MIRT454967 TPM2 tropomyosin 2 (beta) 1 1
MIRT456864 ZNF460 zinc finger protein 460 1 5
MIRT460221 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460435 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461561 ACTR3B ARP3 actin-related protein 3 homolog B (yeast) 1 1
MIRT463166 ZNF367 zinc finger protein 367 1 5
MIRT464664 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 4
MIRT464747 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 2
MIRT465164 TSC22D2 TSC22 domain family, member 2 1 1
MIRT465567 TOB2 transducer of ERBB2, 2 1 1
MIRT465928 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466011 TMEM189 transmembrane protein 189 1 4
MIRT466295 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466434 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT466919 STK38 serine/threonine kinase 38 1 5
MIRT466999 SSRP1 structure specific recognition protein 1 1 3
MIRT468056 SIK1 salt-inducible kinase 1 1 2
MIRT468148 SH3BP4 SH3-domain binding protein 4 1 1
MIRT468678 SEC24A SEC24 family, member A (S. cerevisiae) 1 2
MIRT469087 RNF168 ring finger protein 168, E3 ubiquitin protein ligase 1 1
MIRT469412 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 3
MIRT471036 PISD phosphatidylserine decarboxylase 1 5
MIRT471493 PDE4D phosphodiesterase 4D, cAMP-specific 1 2
MIRT471953 NR6A1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT472264 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472666 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474317 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT474832 KIAA0226 KIAA0226 1 1
MIRT475066 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475120 IPPK inositol 1,3,4,5,6-pentakisphosphate 2-kinase 1 1
MIRT475536 HOXA3 homeobox A3 1 4
MIRT475717 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 1
MIRT475840 HDGF hepatoma-derived growth factor 1 2
MIRT476257 GNB1 guanine nucleotide binding protein (G protein), beta polypeptide 1 1 4
MIRT476274 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT476697 FURIN furin (paired basic amino acid cleaving enzyme) 1 1
MIRT477562 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477846 DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1 1
MIRT478909 CPSF7 cleavage and polyadenylation specific factor 7, 59kDa 1 3
MIRT479985 CARD10 caspase recruitment domain family, member 10 1 1
MIRT481180 AVL9 AVL9 homolog (S. cerevisiase) 1 3
MIRT482115 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 2
MIRT482372 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT482552 ABL2 v-abl Abelson murine leukemia viral oncogene homolog 2 1 5
MIRT482579 ABHD2 abhydrolase domain containing 2 1 1
MIRT484775 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT485217 PRKAR2A protein kinase, cAMP-dependent, regulatory, type II, alpha 1 4
MIRT487391 C10orf54 chromosome 10 open reading frame 54 1 1
MIRT492712 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494349 CASKIN1 CASK interacting protein 1 1 1
MIRT495144 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT496016 CD180 CD180 molecule 1 1
MIRT497773 KIAA0895 KIAA0895 1 1
MIRT498981 ORC4 origin recognition complex, subunit 4 1 4
MIRT499453 ODF2L outer dense fiber of sperm tails 2-like 1 4
MIRT499617 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 4
MIRT500094 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500323 ZNF622 zinc finger protein 622 1 5
MIRT500421 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT500577 USP53 ubiquitin specific peptidase 53 1 1
MIRT500862 SYPL1 synaptophysin-like 1 1 4
MIRT500939 SRPR signal recognition particle receptor (docking protein) 1 4
MIRT500950 SREK1 splicing regulatory glutamine/lysine-rich protein 1 1 4
MIRT501086 SMAD7 SMAD family member 7 1 4
MIRT501503 PRICKLE2 prickle homolog 2 (Drosophila) 1 1
MIRT502037 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT502149 KIF5B kinesin family member 5B 1 5
MIRT502499 FAM122B family with sequence similarity 122B 1 4
MIRT502569 E2F7 E2F transcription factor 7 1 6
MIRT502647 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 4
MIRT502917 CDCA4 cell division cycle associated 4 1 5
MIRT502949 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 5
MIRT503145 ATG9A autophagy related 9A 1 4
MIRT504335 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504537 ZNF620 zinc finger protein 620 1 3
MIRT504853 HAUS3 HAUS augmin-like complex, subunit 3 1 3
MIRT505117 YTHDC1 YTH domain containing 1 1 3
MIRT505347 TMEM245 transmembrane protein 245 1 3
MIRT505397 TMEM100 transmembrane protein 100 1 1
MIRT505503 SRSF1 serine/arginine-rich splicing factor 1 1 3
MIRT505685 SESTD1 SEC14 and spectrin domains 1 1 3
MIRT505909 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505927 RCAN3 RCAN family member 3 1 2
MIRT506109 PPIG peptidylprolyl isomerase G (cyclophilin G) 1 3
MIRT506134 PLRG1 pleiotropic regulator 1 1 2
MIRT506167 PLAG1 pleiomorphic adenoma gene 1 1 5
MIRT506193 PHKA1 phosphorylase kinase, alpha 1 (muscle) 1 3
MIRT506489 MYO5A myosin VA (heavy chain 12, myoxin) 1 4
MIRT506855 KIF23 kinesin family member 23 1 4
MIRT507000 HNRNPDL heterogeneous nuclear ribonucleoprotein D-like 1 3
MIRT507821 CDK1 cyclin-dependent kinase 1 1 3
MIRT507851 CCNE2 cyclin E2 1 3
MIRT507880 CBX6 chromobox homolog 6 1 1
MIRT508038 AXIN2 axin 2 1 3
MIRT508642 CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 2
MIRT509365 DMPK dystrophia myotonica-protein kinase 1 5
MIRT509691 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510044 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1 2
MIRT511844 GPATCH8 G patch domain containing 8 1 3
MIRT512284 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 1 4
MIRT512643 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513859 JARID2 jumonji, AT rich interactive domain 2 1 4
MIRT514023 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 3
MIRT518092 TRIM35 tripartite motif containing 35 1 1
MIRT518531 FLCN folliculin 1 3
MIRT518995 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521204 SBNO1 strawberry notch homolog 1 (Drosophila) 1 3
MIRT521813 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522101 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 3
MIRT522776 LAMP2 lysosomal-associated membrane protein 2 1 3
MIRT537816 EFNB2 ephrin-B2 1 2
MIRT539900 RPL14 ribosomal protein L14 1 2
MIRT540844 GNAT1 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 1 2
MIRT541220 HOXA10 homeobox A10 1 1
MIRT541431 CBX4 chromobox homolog 4 1 2
MIRT542807 PHC3 polyhomeotic homolog 3 (Drosophila) 1 2
MIRT542834 PDCD1 programmed cell death 1 1 3
MIRT543060 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT543080 APP amyloid beta (A4) precursor protein 1 1
MIRT543307 ZNF585B zinc finger protein 585B 1 1
MIRT543409 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543526 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT543798 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 2
MIRT543836 GSG1 germ cell associated 1 1 1
MIRT544572 POLDIP3 polymerase (DNA-directed), delta interacting protein 3 1 1
MIRT544590 AP5Z1 adaptor-related protein complex 5, zeta 1 subunit 1 2
MIRT544913 CLSPN claspin 1 1
MIRT544966 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 1 1
MIRT545187 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545348 CCDC83 coiled-coil domain containing 83 1 1
MIRT545683 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 1 1
MIRT545956 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545976 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 1 1
MIRT546115 USP48 ubiquitin specific peptidase 48 1 2
MIRT546606 SALL1 sal-like 1 (Drosophila) 1 2
MIRT546618 RUNX1T1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 1 1
MIRT546637 RTN4 reticulon 4 1 1
MIRT547064 PNISR PNN-interacting serine/arginine-rich protein 1 2
MIRT547129 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547232 PAG1 phosphoprotein associated with glycosphingolipid microdomains 1 1 2
MIRT547301 NUCKS1 nuclear casein kinase and cyclin-dependent kinase substrate 1 1 2
MIRT547410 MKX mohawk homeobox 1 1
MIRT547461 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT547550 LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 1 2
MIRT547665 KPNA3 karyopherin alpha 3 (importin alpha 4) 1 1
MIRT547701 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 2
MIRT547971 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 2
MIRT547997 HCFC2 host cell factor C2 1 2
MIRT548016 GRB2 growth factor receptor-bound protein 2 1 2
MIRT548221 FKBP1A FK506 binding protein 1A, 12kDa 1 1
MIRT548277 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT548728 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1 1
MIRT548805 CLIP4 CAP-GLY domain containing linker protein family, member 4 1 2
MIRT548948 CDK17 cyclin-dependent kinase 17 1 2
MIRT549079 CACUL1 CDK2-associated, cullin domain 1 1 1
MIRT549126 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549277 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 2
MIRT549387 AMOT angiomotin 1 1
MIRT550403 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 2
MIRT550467 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550616 MTHFR methylenetetrahydrofolate reductase (NAD(P)H) 1 1
MIRT550824 FAM229B chromosome 6 open reading frame 225 1 1
MIRT551380 EPM2AIP1 EPM2A (laforin) interacting protein 1 1 1
MIRT551618 ZNF267 zinc finger protein 267 1 1
MIRT551738 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 1 1
MIRT552036 DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 1 1
MIRT552345 ZNF704 zinc finger protein 704 1 1
MIRT552750 YRDC yrdC domain containing (E. coli) 1 1
MIRT553440 TPM3 tropomyosin 3 1 1
MIRT553563 TMEM161B transmembrane protein 161B 1 1
MIRT553617 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553773 TAF13 TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa 1 2
MIRT553810 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554701 RNF149 ring finger protein 149 1 1
MIRT554963 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555033 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555148 PTPRD protein tyrosine phosphatase, receptor type, D 1 1
MIRT555226 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 2
MIRT555277 PRDM4 PR domain containing 4 1 1
MIRT555437 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT556384 LURAP1L leucine rich adaptor protein 1-like 1 1
MIRT556854 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557282 HIST2H2BE histone cluster 2, H2be 1 1
MIRT557481 GPR27 G protein-coupled receptor 27 1 2
MIRT558038 EXT1 exostosin 1 1 1
MIRT558508 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 2
MIRT558590 CREBL2 cAMP responsive element binding protein-like 2 1 2
MIRT558663 CNKSR3 CNKSR family member 3 1 1
MIRT559012 CA8 carbonic anhydrase VIII 1 1
MIRT559157 BTN3A3 butyrophilin, subfamily 3, member A3 1 1
MIRT559532 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560853 OSBPL3 oxysterol binding protein-like 3 1 1
MIRT561151 KRT33B keratin 33B 1 1
MIRT561401 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT561875 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT562028 LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) 1 1
MIRT562202 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562878 KIAA1456 KIAA1456 1 1
MIRT563087 SLC25A12 solute carrier family 25 (aspartate/glutamate carrier), member 12 1 2
MIRT563504 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 1 1
MIRT563702 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563846 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT563897 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564333 CCNT1 cyclin T1 1 1
MIRT564479 ZNF391 zinc finger protein 391 1 1
MIRT564553 CCDC80 coiled-coil domain containing 80 1 1
MIRT564841 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564951 XKR7 XK, Kell blood group complex subunit-related family, member 7 1 1
MIRT564988 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565043 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT565396 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT566121 RASEF RAS and EF-hand domain containing 1 1
MIRT566651 NCKAP1 NCK-associated protein 1 1 1
MIRT566832 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567020 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT567447 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT567478 FZD9 frizzled family receptor 9 1 1
MIRT568022 CMTM4 CKLF-like MARVEL transmembrane domain containing 4 1 1
MIRT568144 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568471 ARMC12 armadillo repeat containing 12 1 1
MIRT568573 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568623 ACVR2A activin A receptor, type IIA 1 1
MIRT570465 TLK1 tousled-like kinase 1 1 2
MIRT571120 UBE2H ubiquitin-conjugating enzyme E2H 1 1
MIRT571284 TTLL5 tubulin tyrosine ligase-like family, member 5 1 1
MIRT571429 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT571661 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571829 PHF19 PHD finger protein 19 1 1
MIRT574058 PROSC proline synthetase co-transcribed homolog (bacterial) 1 1
MIRT574204 CLEC2D C-type lectin domain family 2, member D 1 1
MIRT574596 N4BP1 NEDD4 binding protein 1 1 2
MIRT575883 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575925 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576097 Pdcd1 programmed cell death 1 1 1
MIRT576597 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614701 TRAK1 trafficking protein, kinesin binding 1 1 1
MIRT616468 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618897 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT619615 RNF41 ring finger protein 41 1 1
MIRT621499 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 2
MIRT640539 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645511 BSPRY B-box and SPRY domain containing 1 1
MIRT646596 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648785 KLHL40 kelch repeat and BTB (POZ) domain containing 5 1 1
MIRT655813 NOTCH2 notch 2 1 2
MIRT658794 EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa 1 1
MIRT659257 CUL3 cullin 3 1 1
MIRT680983 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682282 RS1 retinoschisin 1 1 1
MIRT682515 GLP2R glucagon-like peptide 2 receptor 1 1
MIRT691710 FLOT2 flotillin 2 1 2
MIRT693931 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701507 NEGR1 neuronal growth regulator 1 1 1
MIRT702093 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702874 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713420 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT714439 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716433 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717462 ADORA3 adenosine A3 receptor 1 1
MIRT720148 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725128 SYNRG synergin, gamma 1 1
MIRT726004 ZNF91 zinc finger protein 91 1 1
MIRT726082 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726125 VPS33B vacuolar protein sorting 33 homolog B (yeast) 1 1
MIRT726130 CHMP3 charged multivesicular body protein 3 1 1
MIRT726141 VCL vinculin 1 1
MIRT726155 USP3 ubiquitin specific peptidase 3 1 1
MIRT726163 USP31 ubiquitin specific peptidase 31 1 1
MIRT726219 TUBB tubulin, beta class I 1 1
MIRT726235 TRAM1 translocation associated membrane protein 1 1 1
MIRT726277 TMEM69 transmembrane protein 69 1 1
MIRT726285 TMEM55B transmembrane protein 55B 1 1
MIRT726304 TMEM135 transmembrane protein 135 1 1
MIRT726316 TLE4 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 1 1
MIRT726319 TKTL1 transketolase-like 1 1 1
MIRT726323 TIMM13 translocase of inner mitochondrial membrane 13 homolog (yeast) 1 1
MIRT726335 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726346 TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) 1 1
MIRT726354 TBL1XR1 transducin (beta)-like 1 X-linked receptor 1 1 1
MIRT726365 TBC1D20 TBC1 domain family, member 20 1 1
MIRT726370 TBC1D14 TBC1 domain family, member 14 1 1
MIRT726382 TASP1 taspase, threonine aspartase, 1 1 1
MIRT726408 SUPT16H suppressor of Ty 16 homolog (S. cerevisiae) 1 1
MIRT726419 STX17 syntaxin 17 1 1
MIRT726453 SRPK1 SRSF protein kinase 1 1 1
MIRT726460 SPTLC1 serine palmitoyltransferase, long chain base subunit 1 1 1
MIRT726480 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726504 SLC9A1 solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 1 1
MIRT726508 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT726542 SLC25A29 solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29 1 1
MIRT726546 SLC25A22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22 1 1
MIRT726675 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT726678 RPS5 ribosomal protein S5 1 1
MIRT726682 RPL36 ribosomal protein L36 1 1
MIRT726710 RNPS1 RNA binding protein S1, serine-rich domain 1 1
MIRT726714 RNMT RNA (guanine-7-) methyltransferase 1 1
MIRT726717 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726754 RFWD2 ring finger and WD repeat domain 2, E3 ubiquitin protein ligase 1 1
MIRT726760 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT726770 RELT RELT tumor necrosis factor receptor 1 1
MIRT726786 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726809 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726824 RAB11FIP2 RAB11 family interacting protein 2 (class I) 1 1
MIRT726851 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 1 1
MIRT726872 PPP6C protein phosphatase 6, catalytic subunit 1 1
MIRT726899 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726908 POLE4 polymerase (DNA-directed), epsilon 4, accessory subunit 1 1
MIRT726965 PGD phosphogluconate dehydrogenase 1 1
MIRT726972 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727019 PANK1 pantothenate kinase 1 1 1
MIRT727025 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727036 OTUB1 OTU domain, ubiquitin aldehyde binding 1 1 1
MIRT727065 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT727094 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727135 MTMR4 myotubularin related protein 4 1 1
MIRT727151 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727174 MLXIP MLX interacting protein 1 1
MIRT727196 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727220 MED11 mediator complex subunit 11 1 1
MIRT727226 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727260 LYRM5 LYR motif containing 5 1 1
MIRT727265 LRRC57 leucine rich repeat containing 57 1 1
MIRT727269 LRPPRC leucine-rich pentatricopeptide repeat containing 1 1
MIRT727295 LITAF lipopolysaccharide-induced TNF factor 1 1
MIRT727346 KLC2 kinesin light chain 2 1 1
MIRT727375 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727384 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT727423 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT727480 HYOU1 hypoxia up-regulated 1 1 1
MIRT727521 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727582 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727603 GANAB glucosidase, alpha; neutral AB 1 1
MIRT727616 GABARAP GABA(A) receptor-associated protein 1 1
MIRT727645 FRYL FRY-like 1 1
MIRT727698 FAM73A family with sequence similarity 73, member A 1 1
MIRT727717 AMER1 family with sequence similarity 123B 1 1
MIRT727812 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727854 DSCR3 Down syndrome critical region gene 3 1 1
MIRT727857 DPP8 dipeptidyl-peptidase 8 1 1
MIRT727864 DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 1 1
MIRT727907 CYLD cylindromatosis (turban tumor syndrome) 1 1
MIRT727911 CYB561A3 cytochrome b, ascorbate dependent 3 1 1
MIRT727914 CUL2 cullin 2 1 1
MIRT727922 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT727934 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727950 CPNE1 copine I 1 1
MIRT727997 RHOV ras homolog family member V 1 1
MIRT728003 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728017 CDC27 cell division cycle 27 homolog (S. cerevisiae) 1 1
MIRT728044 CBFA2T3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3 1 1
MIRT728089 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728098 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728125 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728129 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728192 BSG basigin (Ok blood group) 1 1
MIRT728236 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728263 ATP13A3 ATPase type 13A3 1 1
MIRT728287 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT728327 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT728381 AFF4 AF4/FMR2 family, member 4 1 1
MIRT728397 ACOX1 acyl-CoA oxidase 1, palmitoyl 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*