Accession ID: MIRT004669 [miRNA, hsa-miR-195-5p :: CCL4, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-195LinkOut: [miRBase ]
Description Homo sapiens miR-195 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-195-5p
Mature Sequence 15| UAGCAGCACAGAAAUAUUGGC |35
Evidence Experimental
Experiments Cloned
Putative hsa-miR-195-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CCL4 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms ACT2, AT744.1, G-26, LAG1, MGC104418, MGC126025, MGC126026, MIP-1-beta, MIP1B, MIP1B1, SCYA2, SCYA4
Description chemokine (C-C motif) ligand 4
Transcript NM_0029    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CCL4 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CCL4
(miRNA target sites are highlighted)
>CCL4|NM_0029|3'UTR
   1 TGAGCTGCTCAGAGACAGGAAGTCTTCAGGGAAGGTCACCTGAGCCCGGATGCTTCTCCATGAGACACATCTCCTCCATA
  81 CTCAGGACTCCTCTCCGCAGTTCCTGTCCCTTCTCTTAATTTAATCTTTTTTATGTGCCGTGTTATTGTATTAGGTGTCA
 161 TTTCCATTATTTATATTAGTTTAGCCAAAGGATAAGTGTCCCCTATGGGGATGGTCCACTGTCACTGTTTCTCTGCTGTT
 241 GCAAATACATGGATAACACATTTGATTCTGTGTGTTTTCATAATAAAACTTTAAAATAAAATGCAGACAGTT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgGUUAUAAAGACACGACGAu 5'
            || |:||||| |||||:| 
Target 5' gtCACTGTTTCTCTGCTGTTg 3'
221 - 241 159.00 -18.70
2
miRNA  3' cgguuauaaagacaCGACGAu 5'
                        |||||| 
Target 5' -----------tgaGCTGCTc 3'
1 - 10 120.00 -7.40
3
miRNA  3' cgGUUAUAAAG---ACACG--ACGAu 5'
            :||| |||:   |||||  ||:| 
Target 5' ttTAATCTTTTTTATGTGCCGTGTTa 3'
120 - 145 111.00 -7.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-195-5p :: CCL4    [ Functional MTI ]
Validation Method ELISA , Immunoprecipitaion , qRT-PCR , Western blot , Other
Conditions THP-1
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... We selected microRNA-195a among several microRNAs that showed comple- mentary target sites in 39-UTRs of MIP-1b mRNA, and also the microRNA-195a binding site was conserved among species, suggesting a possible role for microRNA-195a in the regulation of MIP- 1b mRNA and protein expression.// Moreover, ET-1-induced MIP-1b mRNA expression in either THP-1 cells or peripheral blood monocytes was reduced upon expression of microRNA-195a. Conversely, transfection of monocytes with anti-microRNA-195a oligonucleotide augmented several-fold ET-1-induced MIP-1b expression. Taken together, these studies showed that ET-1-mediated MIP-1b gene expression is regulated via hypoxia-response elements, AP-1, and NF-kB cis-binding elements in its promoter and negatively regulated by microRNA-195, which targets the 39 untranslated region of MIP-1b RNA.// ...

- Gonsalves, C. Kalra, V. K., 2010, J Immunol.

Article - Gonsalves, C. Kalra, V. K.
- J Immunol, 2010
Patients with sickle cell disease (SCD) exhibit a chronic inflammatory state manifested by leukocytosis and increased circulating levels of proinflammatory cytochemokines. Our studies show that placenta growth factor levels are high in SCD, and placental growth factor induces the release of the vasoconstrictor endothelin-1 (ET-1) from pulmonary microvascular endothelial cells. In this study, we observed that ET-1 increased the expression of the chemokines MIP-1beta or CCL4. ET-1-induced MIP-1beta mRNA expression in THP-1 cells and human peripheral blood monocytes occurred via the activation of PI3K, NADPH oxidase, p38 MAPK, and JNK-1 but not JNK-2. ET-1-induced MIP-1beta expression involved hypoxia-inducible factor-1alpha (HIF-1alpha), independent of hypoxia, as demonstrated by silencing with HIF-1alpha small interfering RNA, EMSA, and chromatin immunoprecipitation analysis. ET-1-induced MIP-1beta promoter luciferase activity was attenuated when any of the five hypoxia-response elements, AP-1, or NF-kappaB binding motifs in the proximal MIP-1beta promoter (-1053/+43 bp) were mutated. Furthermore, ET-1 significantly downregulated the expression of a key microRNA, microRNA-195a, which showed a complementary binding site in the 3' untranslated region of MIP-1beta mRNA. Moreover, ET-1-induced MIP-1beta mRNA expression in either THP-1 cells or peripheral blood monocytes was reduced upon expression of microRNA-195a. Conversely, transfection of monocytes with anti-microRNA-195a oligonucleotide augmented several-fold ET-1-induced MIP-1beta expression. Taken together, these studies showed that ET-1-mediated MIP-1beta gene expression is regulated via hypoxia-response elements, AP-1, and NF-kappaB cis-binding elements in its promoter and negatively regulated by microRNA-195, which targets the 3' untranslated region of MIP-1beta RNA. These studies provide what we believe are new avenues, based on targets of HIF-1alpha and microRNAs, for ameliorating inflammation in SCD.
LinkOut: [PMID: 20952681]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
39 hsa-miR-195-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000222 WEE1 WEE1 homolog (S. pombe) 5 2
MIRT000223 E2F3 E2F transcription factor 3 4 2
MIRT000224 CDK6 cyclin-dependent kinase 6 4 1
MIRT000225 CCND1 cyclin D1 3 4
MIRT000785 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT000795 MECP2 methyl CpG binding protein 2 (Rett syndrome) 2 1
MIRT004273 VEGFA vascular endothelial growth factor A 2 1
MIRT004390 SKI v-ski sarcoma viral oncogene homolog (avian) 2 1
MIRT004669 CCL4 chemokine (C-C motif) ligand 4 3 1
MIRT004937 KRT7 keratin 7 2 1
MIRT005362 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT006077 RAF1 v-raf-1 murine leukemia viral oncogene homolog 1 3 1
MIRT006080 RUNX2 runt-related transcription factor 2 3 1
MIRT006235 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 2 1
MIRT006245 TBCCD1 TBCC domain containing 1 2 1
MIRT006246 CCND3 cyclin D3 2 1
MIRT006252 CDK4 cyclin-dependent kinase 4 1 1
MIRT006995 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 1 1
MIRT007054 CAB39 calcium binding protein 39 2 1
MIRT007169 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007170 TAB3 TGF-beta activated kinase 1/MAP3K7 binding protein 3 1 1
MIRT007219 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT007237 CCNE1 cyclin E1 1 1
MIRT007370 BCL2L2 BCL2-like 2 2 1
MIRT044858 JAK2 Janus kinase 2 1 1
MIRT044859 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT044860 AGER advanced glycosylation end product-specific receptor 1 1
MIRT044861 LSM11 LSM11, U7 small nuclear RNA associated 1 1
MIRT044862 ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 1 1
MIRT044863 ZNF280C zinc finger protein 280C 1 1
MIRT044864 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT044865 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT044866 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT044867 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT044868 RPL10 ribosomal protein L10 1 1
MIRT044869 TMC6 transmembrane channel-like 6 1 1
MIRT044870 TPI1 triosephosphate isomerase 1 1 1
MIRT044871 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 1 1
MIRT044872 AGO1 eukaryotic translation initiation factor 2C, 1 1 1