Accession ID: MIRT004701 [miRNA, hsa-miR-185-5p :: AKT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-185LinkOut: [miRBase ]
Synonyms MIRN185, miR-185, MIR185
Description Homo sapiens miR-185 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-185-5p
Mature Sequence 15| UGGAGAGAAAGGCAGUUCCUGA |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-185-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol AKT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AKT, MGC99656, PKB, PKB-ALPHA, PRKBA, RAC, RAC-ALPHA
Description v-akt murine thymoma viral oncogene homolog 1
Transcript NM_0051    LinkOut: [ RefSeq ]
Other Transcripts NM_0010144 , NM_0010144   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on AKT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of AKT1
(miRNA target sites are highlighted)
>AKT1|NM_0051|3'UTR
   1 TCGGCCAGCGGCACGGCCTGAGGCGGCGGTGGACTGCGCTGGACGATAGCTTGGAGGGATGGAGAGGCGGCCTCGTGCCA
  81 TGATCTGTATTTAATGGTTTTTATTTCTCGGGTGCATTTGAGAGAAGCCACGCTGTCCTCTCGAGCCCAGATGGAAAGAC
 161 GTTTTTGTGCTGTGGGCAGCACCCTCCCCCGCAGCGGGGTAGGGAAGAAAACTATCCTGCGGGTTTTAATTTATTTCATC
 241 CAGTTTGTTCTCCGGGTGTGGCCTCAGCCCTCAGAACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTAT
 321 GCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCT
 401 GTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTA
 481 TGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCAT
 561 CGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTA
 641 AATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCCTCCCCCTTCC
 721 CCTTCTGTGTCACAGTTCTTGGTGACTGTCCCACCGGGAGCCTCCCCCTCAGATGATCTCTCCACGGTAGCACTTGACCT
 801 TTTCGACGCTTAACCTTTCCGCTGTCGCCCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCAC
 881 GCCTCCTGGCCAGACGCTGCCGCTGCCGCTGCACCACGGCGTTTTTTTACAACATTCAACTTTAGTATTTTTACTATTAT
 961 AATATAATATGGAACCTTCCCTCCAAATTCTTCAATAAAAGTTGCTTTTCAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUCCUU-GA--CGGA----A--AGAGAGGu 5'
            :|||: ||   |||    |  ||||||| 
Target 5' ccGGGAGCCTCCCCCTCAGATGATCTCTCCa 3'
754 - 784 142.00 -21.50
2
miRNA  3' aguccUUGACGGAAAGAGAGGu 5'
               | |||:|  ||||||: 
Target 5' cagctATCTGTC-ATCTCTCTg 3'
406 - 426 136.00 -14.30
3
miRNA  3' aguCCUUGACGGAAAGAGAGGu 5'
             ||||   || ||| |||| 
Target 5' tatGGAA---CC-TTCCCTCCa 3'
968 - 985 123.00 -13.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-185-5p :: AKT1    [ Functional MTI ]
Validation Method Flow , Immunoblot , Microarray , qRT-PCR , Other
Conditions H1299 , A549
Disease non-small cell lung carcinoma;
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... Using miRNA-target prediction analyses and the array data, we listed up a set of likely targets of miR-107 and miR-185 for G1 cell cycle arrest and validate a subset of them using real-time RT-PCR and immunoblotting for CDK6. ...

- Takahashi, Y. Forrest, A. R. Maeno, E. et al., 2009, PLoS One.

Article - Takahashi, Y. Forrest, A. R. Maeno, E. et al.
- PLoS One, 2009
BACKGROUND: MicroRNAs (miRNAs) are short single stranded noncoding RNAs that suppress gene expression through either translational repression or degradation of target mRNAs. The annealing between messenger RNAs and 5' seed region of miRNAs is believed to be essential for the specific suppression of target gene expression. One miRNA can have several hundred different targets in a cell. Rapidly accumulating evidence suggests that many miRNAs are involved in cell cycle regulation and consequentially play critical roles in carcinogenesis. METHODOLOGY/PRINCIPAL FINDINGS: Introduction of synthetic miR-107 or miR-185 suppressed growth of the human non-small cell lung cancer cell lines. Flow cytometry analysis revealed these miRNAs induce a G1 cell cycle arrest in H1299 cells and the suppression of cell cycle progression is stronger than that by Let-7 miRNA. By the gene expression analyses with oligonucleotide microarrays, we find hundreds of genes are affected by transfection of these miRNAs. Using miRNA-target prediction analyses and the array data, we listed up a set of likely targets of miR-107 and miR-185 for G1 cell cycle arrest and validate a subset of them using real-time RT-PCR and immunoblotting for CDK6. CONCLUSIONS/SIGNIFICANCE: We identified new cell cycle regulating miRNAs, miR-107 and miR-185, localized in frequently altered chromosomal regions in human lung cancers. Especially for miR-107, a large number of down-regulated genes are annotated with the gene ontology term 'cell cycle'. Our results suggest that these miRNAs may contribute to regulate cell cycle in human malignant tumors.
LinkOut: [PMID: 19688090]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
88 hsa-miR-185-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004036 RHOA ras homolog gene family, member A 4 1
MIRT004037 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 1
MIRT004698 CCNE1 cyclin E1 3 1
MIRT004700 CDK6 cyclin-dependent kinase 6 4 2
MIRT004701 AKT1 v-akt murine thymoma viral oncogene homolog 1 3 1
MIRT004702 HMGA2 high mobility group AT-hook 2 3 1
MIRT004703 CORO2B coronin, actin binding protein, 2B 3 1
MIRT005550 SIX1 SIX homeobox 1 4 1
MIRT005963 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 1 1
MIRT006696 DNMT1 DNA (cytosine-5-)-methyltransferase 1 4 1
MIRT006962 EPAS1 endothelial PAS domain protein 1 2 1
MIRT035517 AR androgen receptor 1 1
MIRT035549 SCARB1 scavenger receptor class B, member 1 1 1
MIRT045312 MATR3 matrin 3 1 1
MIRT045313 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 1
MIRT045314 PDPK1 3-phosphoinositide dependent protein kinase-1 1 1
MIRT045315 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT045316 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT045317 MSANTD1 chromosome 4 open reading frame 44 1 1
MIRT045318 WDR77 WD repeat domain 77 1 1
MIRT045319 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT045320 ARL9 ADP-ribosylation factor-like 9 1 1
MIRT045321 AADACL3 arylacetamide deacetylase-like 3 1 1
MIRT045322 FASTK Fas-activated serine/threonine kinase 1 1
MIRT045323 COPB1 coatomer protein complex, subunit beta 1 1 1
MIRT045324 STK35 serine/threonine kinase 35 1 1
MIRT045325 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT045326 CAMKK2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT045327 FRMPD4 FERM and PDZ domain containing 4 1 1
MIRT045328 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT045329 CYFIP1 cytoplasmic FMR1 interacting protein 1 1 1
MIRT045330 GLUL glutamate-ammonia ligase 1 1
MIRT045331 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT045332 DENND2A DENN/MADD domain containing 2A 1 1
MIRT045333 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT045334 CANX calnexin 1 1
MIRT045335 GSTA4 glutathione S-transferase alpha 4 1 1
MIRT045336 ANKHD1 ankyrin repeat and KH domain containing 1 1 1
MIRT045337 MPV17 MpV17 mitochondrial inner membrane protein 1 1
MIRT045338 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT045339 UBR4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT045340 TUBB tubulin, beta 1 1
MIRT045341 NFE2L1 nuclear factor (erythroid-derived 2)-like 1 1 1
MIRT045342 DIAPH1 diaphanous homolog 1 (Drosophila) 1 1
MIRT045343 KIAA0368 KIAA0368 1 1
MIRT045344 SMG7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT045345 UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 1 1
MIRT045346 AHCYL2 adenosylhomocysteinase-like 2 1 1
MIRT045347 TMEM160 transmembrane protein 160 1 1
MIRT045348 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT045349 ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 1 1
MIRT045350 LDHB lactate dehydrogenase B 1 1
MIRT045351 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT045352 KITLG KIT ligand 1 1
MIRT045353 MED17 mediator complex subunit 17 1 1
MIRT045354 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT045355 LENG8 leukocyte receptor cluster (LRC) member 8 1 1
MIRT045356 CACHD1 cache domain containing 1 1 1
MIRT045357 DAZAP1 DAZ associated protein 1 1 1
MIRT045358 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT045359 GLUD1 glutamate dehydrogenase 1 1 1
MIRT045360 LUZP1 leucine zipper protein 1 1 1
MIRT045361 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT045362 RAE1 RAE1 RNA export 1 homolog (S. pombe) 1 1
MIRT045363 SMG6 Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT045364 ACTN4 actinin, alpha 4 1 1
MIRT045365 PBX2 pre-B-cell leukemia homeobox 2 1 1
MIRT045366 UHMK1 U2AF homology motif (UHM) kinase 1 1 1
MIRT045367 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT045368 GOLGA2P5 golgin A2 family, member B 1 1
MIRT045369 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT045370 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT045371 WNT5B wingless-type MMTV integration site family, member 5B 1 1
MIRT045372 MARS methionyl-tRNA synthetase 1 1
MIRT045373 AKT1S1 AKT1 substrate 1 (proline-rich) 1 1
MIRT045374 MLF1IP MLF1 interacting protein 1 1
MIRT045375 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT045376 CTTN cortactin 1 1
MIRT045377 SET SET nuclear oncogene 1 1
MIRT045378 IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase 1 1
MIRT045379 XPO6 exportin 6 1 1
MIRT045380 GPR108 G protein-coupled receptor 108 1 1
MIRT045381 TRRAP transformation/transcription domain-associated protein 1 1
MIRT045382 ARL16 ADP-ribosylation factor-like 16 1 1
MIRT045383 C16orf70 chromosome 16 open reading frame 70 1 1
MIRT045384 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT045385 EMC10 chromosome 19 open reading frame 63 1 1
MIRT045386 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 1 1