Accession ID: MIRT004733 [miRNA, hsa-miR-153-3p :: SNCA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-153-1LinkOut: [miRBase ]
Description Homo sapiens miR-153-1 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-153-3p
Mature Sequence 54| UUGCAUAGUCACAAAAGUGAUC |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-153-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol SNCA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC110988, NACP, PARK1, PARK4, PD1
Description synuclein, alpha (non A4 component of amyloid precursor)
Transcript NM_0003    LinkOut: [ RefSeq ]
Other Transcripts NM_0011460 , NM_0011460 , NM_0073   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on SNCA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of SNCA
(miRNA target sites are highlighted)
>SNCA|NM_0003|3'UTR
   1 TAAGAAATATCTTTGCTCCCAGTTTCTTGAGATCTGCTGACAGATGTTCCATCCTGTACAAGTGCTCAGTTCCAATGTGC
  81 CCAGTCATGACATTTCTCAAAGTTTTTACAGTGTATCTCGAAGTCTTCCATCAGCAGTGATTGAAGTATCTGTACCTGCC
 161 CCCACTCAGCATTTCGGTGCTTCCCTTTCACTGAAGTGAATACATGGTAGCAGGGTCTTTGTGTGCTGTGGATTTTGTGG
 241 CTTCAATCTACGATGTTAAAACAAATTAAAAACACCTAAGTGACTACCACTTATTTCTAAATCCTCACTATTTTTTTGTT
 321 GCTGTTGTTCAGAAGTTGTTAGTGATTTGCTATCATATATTATAAGATTTTTAGGTGTCTTTTAATGATACTGTCTAAGA
 401 ATAATGACGTATTGTGAAATTTGTTAATATATATAATACTTAAAAATATGTGAGCATGAAACTATGCACCTATAAATACT
 481 AAATATGAAATTTTACCATTTTGCGATGTGTTTTATTCACTTGTGTTTGTATATAAATGGTGAGAATTAAAATAAAACGT
 561 TATCTCATTGCAAAAATATTTTATTTTTATCCCATCTCACTTTAATAATAAAAATCATGCTTATAAGCAACATGAATTAA
 641 GAACTGACACAAAGGACAAAAATATAAAGTTATTAATAGCCATTTGAAGAAGGAGGAATTTTAGAAGAGGTAGAGAAAAT
 721 GGAACATTAACCCTACACTCGGAATTCCCTGAAGCAACACTGCCAGAAGTGTGTTTTGGTATGCACTGGTTCCTTAAGTG
 801 GCTGTGATTAATTATTGAAAGTGGGGTGTTGAAGACCCCAACTACTATTGTAGAGTGGTCTATTTCTCCCTTCAATCCTG
 881 TCAATGTTTGCTTTACGTATTTTGGGGAACTGTTGTTTGATGTGTATGTGTTTATAATTGTTATACATTTTTAATTGAGC
 961 CTTTTATTAACATATATTGTTATTTTTGTCTCGAAATAATTTTTTAGTTAAAATCTATTTTGTCTGATATTGGTGTGAAT
1041 GCTGTACCTTTCTGACAATAAATAATATTCGACCATGAATAAAAAAAAAAAAAAAGTGGGTTCCCGGGAACTAAGCAGTG
1121 TAGAAGATGATTTTGACTACACCCTCCTTAGAGAGCCATAAGACACATTAGCACATATTAGCACATTCAAGGCTCTGAGA
1201 GAATGTGGTTAACTTTGTTTAACTCAGCATTCCTCACTTTTTTTTTTTAATCATCAGAAATTCTCTCTCTCTCTCTCTCT
1281 TTTTCTCTCGCTCTCTTTTTTTTTTTTTTTTTACAGGAAATGCCTTTAAACATCGTTGGAACTACCAGAGTCACCTTAAA
1361 GGAGATCAATTCTCTAGACTGATAAAAATTTCATGGCCTCCTTTAAATGTTGCCAAATATATGAATTCTAGGATTTTTCC
1441 TTAGGAAAGGTTTTTCTCTTTCAGGGAAGATCTATTAACTCCCCATGGGTGCTGAAAATAAACTTGATGGTGAAAAACTC
1521 TGTATAAATTAATTTAAAAATTATTTGGTTTCTCTTTTTAATTATTCTGGGGCATAGTCATTTCTAAAAGTCACTAGTAG
1601 AAAGTATAATTTCAAGACAGAATATTCTAGACATGCTAGCAGTTTATATGTATTCATGAGTAATGTGATATATATTGGGC
1681 GCTGGTGAGGAAGGAAGGAGGAATGAGTGACTATAAGGATGGTTACCATAGAAACTTCCTTTTTTACCTAATTGAAGAGA
1761 GACTACTACAGAGTGCTAAGCTGCATGTGTCATCTTACACTAGAGAGAAATGGTAAGTTTCTTGTTTTATTTAAGTTATG
1841 TTTAAGCAAGGAAAGGATTTGTTATTGAACAGTATATTTCAGGAAGGTTAGAAAGTGGCGGTTAGGATATATTTTAAATC
1921 TACCTAAAGCAGCATATTTTAAAAATTTAAAAGTATTGGTATTAAATTAAGAAATAGAGGACAGAACTAGACTGATAGCA
2001 GTGACCTAGAACAATTTGAGATTAGGAAAGTTGTGACCATGAATTTAAGGATTTATGTGGATACAAATTCTCCTTTAAAG
2081 TGTTTCTTCCCTTAATATTTATCTGACGGTAATTTTTGAGCAGTGAATTACTTTATATATCTTAATAGTTTATTTGGGAC
2161 CAAACACTTAAACAAAAAGTTCTTTAAGTCATATAAGCCTTTTCAGGAAGCTTGTCTCATATTCACTCCCGAGACATTCA
2241 CCTGCCAAGTGGCCTGAGGATCAATCCAGTCCTAGGTTTATTTTGCAGACTTACATTCTCCCAAGTTATTCAGCCTCATA
2321 TGACTCCACGGTCGGCTTTACCAAAACAGTTCAGAGTGCACTTTGGCACACAATTGGGAACAGAACAATCTAATGTGTGG
2401 TTTGGTATTCCAAGTGGGGTCTTTTTCAGAATCTCTGCACTAGTGTGAGATGCAAACATGTTTCCTCATCTTTCTGGCTT
2481 ATCCAGTATGTAGCTATTTGTGACATAATAAATATATACATATATGAAAATA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-153-3p :: SNCA    [ Functional MTI ]
Validation Method Immunocytochemistry , Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions 293
Disease Parkinson\'s disease;
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... Mir-7 and Mir-153 Post-transcriptionally Control SNCA Expression via Its 3'-UTR// Mir-7 and Mir-153 Regulate Endogenous SNCA Protein Levels in Neurons// This study has revealed a previously unknown mechanism by which SNCA levels are regulated in the nervous system. Specifically, two brain-enriched miRNAs, mir-7 and mir-153, have been shown to bind directly to the 3'-UTR of SNCA mRNA and significantly reduce its levels// ...

- Doxakis, E., 2010, J Biol Chem.

Article - Doxakis, E.
- J Biol Chem, 2010
Genetic and biochemical studies have established a central role for alpha-synuclein accumulation in the pathogenesis of Parkinson disease. Here, two microRNAs, namely mir-7 and mir-153, have been identified to regulate alpha-synuclein levels post-transcriptionally. These microRNAs bind specifically to the 3'-untranslated region of alpha-synuclein and down-regulate its mRNA and protein levels, with their effect being additive. They are expressed predominantly in the brain with a pattern that mirrors synuclein expression in different tissues as well as during neuronal development, indicating that they play a tuning role in the amount of alpha-synuclein produced. Overexpression of mir-7 and mir-153 significantly reduces endogenous alpha-synuclein levels, whereas inhibition of mir-7 and mir-153 enhances translation of a luciferase construct bearing the alpha-synuclein 3'-untranslated region in primary neurons. These findings reveal a significant additional mechanism by which alpha-synuclein is regulated and point toward new therapeutic regimes for lowering endogenous alpha-synuclein levels in patients with familial or sporadic Parkinson disease.
LinkOut: [PMID: 20106983]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
8 hsa-miR-153-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000290 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT003299 FOXO1 forkhead box O1 3 1
MIRT004080 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 3 2
MIRT004733 SNCA synuclein, alpha (non A4 component of amyloid precursor) 4 1
MIRT005682 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT007098 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT007099 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT007311 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1