Accession ID: MIRT004904 [miRNA, hsa-miR-145 :: POU5F1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-145 LinkOut: [miRBase ]
Synonyms MIRN145, miR-145, miRNA145, MIR145
Description Homo sapiens miR-145 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-145-3p
Mature Sequence 54| GGAUUCCUGGAAAUACUGUUCU |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-145-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Mature miRNA hsa-miR-145-5p
Mature Sequence 16| GUCCAGUUUUCCCAGGAAUCCCU |38
Evidence Experimental
Experiments Cloned
Putative hsa-miR-145-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
miRNA-target interaction network
Gene Information
Gene Symbol POU5F1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC22487, OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4
Description POU class 5 homeobox 1
Transcript NM_001173531   LinkOut: [ RefSeq ]
Other Transcripts NM_002701, NM_203289   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on POU5F1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of POU5F1
(miRNA target sites are highlighted)
>POU5F1|NM_001173531|3'UTR
   1 TGAGGTGCCTGCCCTTCTAGGAATGGGGGACAGGGGGAGGGGAGGAGCTAGGGAAAGAAAACCTGGAGTTTGTGCCAGGG
  81 TTTTTGGGATTAAGTTCTTCATTCACTAAGGAAGGAATTGGGAACACAAAGGGTGGGGGCAGGGGAGTTTGGGGCAACTG
 161 GTTGGAGGGAAGGTGAAGTTCAATGATGCTCTTGATTTTAATCCCACATCATGTATCACTTTTTTCTTAAATAAAGAAGC
 241 CTGGGACACAGTAGATAGACACACTTAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucuugucauaAAGGUCCUUAgg 5'
                    |||:||||||  
Target 5' gtgcctgcccTTCTAGGAATgg 3'
5 - 26 136.00 -9.40
2
miRNA  3' ucuugucauaaaggUCCUUAGg 5'
                        ||||||: 
Target 5' tcattcactaaggaAGGAATTg 3'
99 - 120 124.00 -5.20
3
miRNA  3' ucuuGUCAUAAAGGUCCUUAgg 5'
              ||| :|||:::||| |  
Target 5' gtgcCAGGGTTTTTGGGATTaa 3'
72 - 93 102.00 -9.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145 :: POU5F1    [ Functional MTI ]
Validation Method FACS , Flow , GFP reporter assay , In situ hybridization , Luciferase reporter assay , qRT-PCR
Conditions H9
Location of target site 3'UTR
Tools used in this research miRanda, miRBase Target Database
Original Description (Extracted from the article) ... At 24 hr after transfection, there was signifi- cant repression on the wild-type 30 UTR luciferase reporter activities of OCT4 (p = 5.1x10^-5 ), SOX2 (p = 1.0x10^-5 ), and KLF4 (p = 1.2x10^-6 ) in comparison to the no-UTR control, and these effects persisted at 48 hr (Figures 2A–2C). In contrast, the mutant reporters with a 6 bp deletion of the miR-145 target sites had significantly less repression than the wild-type reporters (OCT4, p = 1.3x10^-7 ; SOX2, p = 0.03; KLF4, p = 0.002. Figures 2A–2C). ...

- Xu, N. Papagiannakopoulos, T. Pan, G. et al., 2009, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' ucCCUAAGGACCCUUUUGACCug 5'
            ||| | :||||: ||||||  
Target 5' ggGGAGU-UUGGGGCAACUGGuu 3'
2 - 23
Article - Xu, N. Papagiannakopoulos, T. Pan, G. et al.
- Cell, 2009
MicroRNAs (miRNAs) are posttranscriptional modulators of gene expression and play an important role in many developmental processes. We report here that expression of microRNA-145 (miR-145) is low in self-renewing human embryonic stem cells (hESCs) but highly upregulated during differentiation. We identify the pluripotency factors OCT4, SOX2, and KLF4 as direct targets of miR-145 and show that endogenous miR-145 represses the 3' untranslated regions of OCT4, SOX2, and KLF4. Increased miR-145 expression inhibits hESC self-renewal, represses expression of pluripotency genes, and induces lineage-restricted differentiation. Loss of miR-145 impairs differentiation and elevates OCT4, SOX2, and KLF4. Furthermore, we find that the miR-145 promoter is bound and repressed by OCT4 in hESCs. This work reveals a direct link between the core reprogramming factors and miR-145 and uncovers a double-negative feedback loop involving OCT4, SOX2, KLF4, and miR-145.
LinkOut: [PMID: 19409607]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-145 :: POU5F1    [ Functional MTI ]
Validation Method Immunofluorescence , qRT-PCR
Conditions HSK
Location of target site 3'UTR
Tools used in this research None
Original Description (Extracted from the article) ... mir-145 regulates OCT4 expression in decitabine-treated HSK//Here, we report for the first time that the cancer treatment drug decitabine reactivates endogenous Oct4 and its regulator mir-145,in HSK. We also show for the first time that another cancer treatment drug, doxorubicin, induces expression of endogenous mir-145 only in cells that already express OCT4. ...

- Chinnathambi, S. Wiechert, S. et al., 2012, J Dermatol.

Article - Chinnathambi, S. Wiechert, S. et al.
- J Dermatol, 2012
Previously, we showed that transient transfection with OCT4 not only produced high expression of Oct4 in skin keratinocytes, but also caused a generalized demethylation of keratinocyte DNA. We hypothesized that DNA demethylation alone might allow expression of endogenous OCT4. Here, we report that treatment with the cancer drug decitabine results in generalized DNA demethylation in skin keratinocytes, and by 48 h after treatment, 96% of keratinocytes show expression of the endogenous Oct4 protein and the OCT4 repressor mir-145. This is true for keratinocytes only, as skin fibroblasts treated similarly show no OCT4 or mir-145 expression. Decitabine-treated keratinocytes also show increased mir-302c and proliferation similar to other Oct4(+) cells. Treatment with doxorubicin, another cancer drug, induces expression of mir-145 only in cells that already express OCT4, suggesting that Oct4 regulates its own repressor. Co-treatment with decitabine and doxorubicin results first in increased OCT4 and mir-145, then a decrease in both, suggesting that OCT4 and mir-145 regulate each other. The novel strategy presented here provides a regulatable system to produce Oct4(+) cells for transformation studies and provides a unique method to study the effects of endogenous Oct4 in cancer cells and the surrounding somatic cells.
LinkOut: [PMID: 22486352]