Accession ID: MIRT004969 [miRNA, hsa-miR-31-5p :: RET, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-31LinkOut: [miRBase ]
Synonyms MIRN31, hsa-mir-31, miR-31, MIR31
Description Homo sapiens miR-31 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-31-5p
Mature Sequence 8| AGGCAAGAUGCUGGCAUAGCU |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-31-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol RET LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDHF12, CDHR16, HSCR1, MEN2A, MEN2B, MTC1, PTC, RET-ELE1, RET51
Description ret proto-oncogene
Transcript NM_0209    LinkOut: [ RefSeq ]
Other Transcripts NM_0206   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on RET LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of RET
(miRNA target sites are highlighted)
>RET|NM_0209|3'UTR
   1 TAACATTTCTTTGTGAAAGGTAATGGACTCACAAGGGGAAGAAACATGCTGAGAATGGAAAGTCTACCGGCCCTTTCTTT
  81 GTGAACGTCACATTGGCCGAGCCGTGTTCAGTTCCCAGGTGGCAGACTCGTTTTTGGTAGTTTGTTTTAACTTCCAAGGT
 161 GGTTTTACTTCTGATAGCCGGTGATTTTCCCTCCTAGCAGACATGCCACACCGGGTAAGAGCTCTGAGTCTTAGTGGTTA
 241 AGCATTCCTTTCTCTTCAGTGCCCAGCAGCACCCAGTGTTGGTCTGTGTCCATCAGTGACCACCAACATTCTGTGTTCAC
 321 ATGTGTGGGTCCAACACTTACTACCTGGTGTATGAAATTGGACCTGAACTGTTGGATTTTTCTAGTTGCCGCCAAACAAG
 401 GCAAAAAAATTTAAACATGAAGCACACACACAAAAAAGGCAGTAGGAAAAATGCTGGCCCTGATGACCTGTCCTTATTCA
 481 GAATGAGAGACTGCGGGGGGGGCCTGGGGGTAGTGTCAATGCCCCTCCAGGGCTGGAGGGGAAGAGGGGCCCCGAGGATG
 561 GGCCTGGGCTCAGCATTCGAGATCTTGAGAATGATTTTTTTTTAATCATGCAACCTTTCCTTAGGAAGACATTTGGTTTT
 641 CATCATGATTAAGATGATTCCTAGATTTAGCACAATGGAGAGATTCCATGCCATCTTTACTATGTGGATGGTGGTATCAG
 721 GGAAGAGGGCTCACAAGACACATTTGTCCCCCGGGCCCACCACATCATCCTCACGTGTTCGGTACTGAGCAGCCACTACC
 801 CCTGATGAGAACAGTATGAAGAAAGGGGGCTGTTGGAGTCCCAGAATTGCTGACAGCAGAGGCTTTGCTGCTGTGAATCC
 881 CACCTGCCACCAGCCTGCAGCACACCCCACAGCCAAGTAGAGGCGAAAGCAGTGGCTCATCCTACCTGTTAGGAGCAGGT
 961 AGGGCTTGTACTCACTTTAATTTGAATCTTATCAACTTACTCATAAAGGGACAGGCTAGCTAGCTGTGTTAGAAGTAGCA
1041 ATGACAATGACCAAGGACTGCTACACCTCTGATTACAATTCTGATGTGAAAAAGATGGTGTTTGGCTCTTATAGAGCCTG
1121 TGTGAAAGGCCCATGGATCAGCTCTTCCTGTGTTTGTAATTTAATGCTGCTACAAGATGTTTCTGTTTCTTAGATTCTGA
1201 CCATGACTCATAAGCTTCTTGTCATTCTTCATTGCTTGTTTGTGGTCACAGATGCACAACACTCCTCCAGTCTTGTGGGG
1281 GCAGCTTTTGGGAAGTCTCAGCAGCTCTTCTGGCTGTGTTGTCAGCACTGTAACTTCGCAGAAAAGAGTCGGATTACCAA
1361 AACACTGCCTGCTCTTCAGACTTAAAGCACTGATAGGACTTAAAATAGTCTCATTCAAATACTGTATTTTATATAGGCAT
1441 TTCACAAAAACAGCAAAATTGTGGCATTTTGTGAGGCCAAGGCTTGGATGCGTGTGTAATAGAGCCTTGTGGTGTGTGCG
1521 CACACACCCAGAGGGAGAGTTTGAAAAATGCTTATTGGACACGTAACCTGGCTCTAATTTGGGCTGTTTTTCAGATACAC
1601 TGTGATAAGTTCTTTTACAAATATCTATAGACATGGTAAACTTTTGGTTTTCAGATATGCTTAATGATAGTCTTACTAAA
1681 TGCAGAAATAAGAATAAACTTTCTCAAATTATTAAAAATGCCTACACAGTAAGTGTGAATTGCTGCAACAGGTTTGTTCT
1761 CAGGAGGGTAAGAACTCCAGGTCTAAACAGCTGACCCAGTGATGGGGAATTTATCCTTGACCAATTTATCCTTGACCAAT
1841 AACCTAATTGTCTATTCCTGAGTTATAAAAGTCCCCATCCTTATTAGCTCTACTGGAATTTTCATACACGTAAATGCAGA
1921 AGTTACTAAGTATTAAGTATTACTGAGTATTAAGTAGTAATCTGTCAGTTATTAAAATTTGTAAAATCTATTTATGAAAG
2001 GTCATTAAACCAGATCATGTTCCTTTTTTTGTAATCAAGGTGACTAAGAAAATCAGTTGTGTAAATAAAATCATGTATCA
2081 TAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucGAUACGG-----UCGUAGAACGGa 5'
            | ||| |     ||| |||||:| 
Target 5' gaCCATGACTCATAAGCTTCTTGTCa 3'
1199 - 1224 139.00 -10.70
2
miRNA  3' ucgaUACGGUCGUAGAACgga 5'
              || | || ||||||   
Target 5' cagcATTCGAG-ATCTTGaga 3'
571 - 590 116.00 -9.42
3
miRNA  3' ucGAUACGGUCGUAGAACGga 5'
            ||   ||||  |||||:  
Target 5' caCTCCTCCAG--TCTTGTgg 3'
1260 - 1278 115.00 -9.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-31-5p :: RET    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Other
Conditions MDA-MB-231 , MCF-7
Disease breast cancer metastasis;
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... Guided by this gene ontology analysis, we cloned the 3'UTRs of 16 putative miR-31 targets from these overrepresented categories, including several implicated in tumor invasion (Sahai and Marshall, 2002; McClatchey, 2003), into a luciferase construct.//{This MTI is not shown in Fig. 4} ...

- Valastyan, S. Reinhardt, F. Benaich, N. et al., 2009, Cell.

Article - Valastyan, S. Reinhardt, F. Benaich, N. et al.
- Cell, 2009
MicroRNAs are well suited to regulate tumor metastasis because of their capacity to coordinately repress numerous target genes, thereby potentially enabling their intervention at multiple steps of the invasion-metastasis cascade. We identify a microRNA exemplifying these attributes, miR-31, whose expression correlates inversely with metastasis in human breast cancer patients. Overexpression of miR-31 in otherwise-aggressive breast tumor cells suppresses metastasis. We deploy a stable microRNA sponge strategy to inhibit miR-31 in vivo; this allows otherwise-nonaggressive breast cancer cells to metastasize. These phenotypes do not involve confounding influences on primary tumor development and are specifically attributable to miR-31-mediated inhibition of several steps of metastasis, including local invasion, extravasation or initial survival at a distant site, and metastatic colonization. Such pleiotropy is achieved via coordinate repression of a cohort of metastasis-promoting genes, including RhoA. Indeed, RhoA re-expression partially reverses miR-31-imposed metastasis suppression. These findings indicate that miR-31 uses multiple mechanisms to oppose metastasis.
LinkOut: [PMID: 19524507]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
88 hsa-miR-31-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000088 RHOA ras homolog gene family, member A 4 3
MIRT000490 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 3 1
MIRT000491 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 3 1
MIRT001180 FOXP3 forkhead box P3 4 1
MIRT004019 SELE selectin E 3 1
MIRT004597 CASR calcium-sensing receptor 1 1
MIRT004968 YY1 YY1 transcription factor 3 1
MIRT004969 RET ret proto-oncogene 3 1
MIRT004970 NUMB numb homolog (Drosophila) 3 1
MIRT004971 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 3 1
MIRT004972 KLF13 Kruppel-like factor 13 3 1
MIRT004973 JAZF1 JAZF zinc finger 1 3 1
MIRT004974 HOXC13 homeobox C13 3 1
MIRT004975 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT004976 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 4 1
MIRT004977 MPRIP myosin phosphatase Rho interacting protein 3 1
MIRT004978 MMP16 matrix metallopeptidase 16 (membrane-inserted) 4 1
MIRT004979 RDX radixin 4 1
MIRT004980 CXCL12 chemokine (C-X-C motif) ligand 12 3 1
MIRT004981 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 3 1
MIRT004984 FZD3 frizzled homolog 3 (Drosophila) 4 1
MIRT005456 DMD dystrophin 4 1
MIRT005566 TIAM1 T-cell lymphoma invasion and metastasis 1 4 1
MIRT005707 ICAM1 intercellular adhesion molecule 1 1 1
MIRT005874 DKK1 dickkopf homolog 1 (Xenopus laevis) 4 1
MIRT005875 DACT3 dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) 4 1
MIRT006026 WASF3 WAS protein family, member 3 2 1
MIRT006468 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 3 2
MIRT006567 SATB2 SATB homeobox 2 1 1
MIRT007286 PRKCE protein kinase C, epsilon 1 1
MIRT007292 RASA1 RAS p21 protein activator (GTPase activating protein) 1 3 1
MIRT007319 STK40 serine/threonine kinase 40 2 2
MIRT007327 MCM2 minichromosome maintenance complex component 2 1 1
MIRT007328 CDK1 cyclin-dependent kinase 1 1 1
MIRT007367 CREG1 cellular repressor of E1A-stimulated genes 1 3 1
MIRT028387 Lats2 large tumor suppressor 2 1 1
MIRT035519 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT035528 MET met proto-oncogene (hepatocyte growth factor receptor) 1 2
MIRT049857 PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2 1 1
MIRT049858 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT049859 RPS7 ribosomal protein S7 1 1
MIRT049860 MED12 mediator complex subunit 12 1 1
MIRT049861 CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 1 1
MIRT049862 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT049863 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT049864 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT049865 HEATR2 HEAT repeat containing 2 1 1
MIRT049866 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT049867 RPA1 replication protein A1, 70kDa 1 1
MIRT049868 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT049869 AKAP8L A kinase (PRKA) anchor protein 8-like 1 1
MIRT049870 FLNA filamin A, alpha 1 1
MIRT049871 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT049872 NDFIP2 Nedd4 family interacting protein 2 1 1
MIRT049873 TRIB3 tribbles homolog 3 (Drosophila) 1 1
MIRT049874 NUP188 nucleoporin 188kDa 1 1
MIRT049875 RPS4Y1 ribosomal protein S4, Y-linked 1 1 1
MIRT049876 GLI2 GLI family zinc finger 2 1 1
MIRT049877 RPL37A ribosomal protein L37a 1 1
MIRT049878 EXOSC5 exosome component 5 1 1
MIRT049879 DDX19A DEAD (Asp-Glu-Ala-As) box polypeptide 19A 1 1
MIRT049880 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT049881 NOL9 nucleolar protein 9 1 1
MIRT049882 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT049883 FAM134C family with sequence similarity 134, member C 1 1
MIRT049884 PEX19 peroxisomal biogenesis factor 19 1 1
MIRT049885 SMEK2 SMEK homolog 2, suppressor of mek1 (Dictyostelium) 1 1
MIRT049886 TRRAP transformation/transcription domain-associated protein 1 1
MIRT049887 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT049888 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT049889 NOP56 NOP56 ribonucleoprotein homolog (yeast) 1 1
MIRT049890 PCSK1N proprotein convertase subtilisin/kexin type 1 inhibitor 1 1
MIRT049891 ZNF275 zinc finger protein 275 1 1
MIRT049892 C2CD5 KIAA0528 1 1
MIRT049893 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT049894 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT049895 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT049896 GYG1 glycogenin 1 1 1
MIRT049897 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT049898 LRRC59 leucine rich repeat containing 59 1 1
MIRT049899 GHITM growth hormone inducible transmembrane protein 1 1
MIRT049900 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT049901 MYO1D myosin ID 1 1
MIRT049902 STOML2 stomatin (EPB72)-like 2 1 1
MIRT049903 EXOC6 exocyst complex component 6 1 1
MIRT049904 HOXA7 homeobox A7 1 1
MIRT049905 SFXN1 sideroflexin 1 1 1
MIRT049906 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1