Accession ID: MIRT005025 [miRNA, hsa-miR-562 :: PSEN1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-562LinkOut: [miRBase ]
Synonyms MIRN562, hsa-mir-562, MIR562
Description Homo sapiens miR-562 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-562
Mature Sequence 61| AAAGUAGCUGUACCAUUUGC |80
Evidence Experimental
Experiments SAGE
Putative hsa-miR-562 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol PSEN1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AD3, FAD, PS1, S182
Description presenilin 1
Transcript NM_0000    LinkOut: [ RefSeq ]
Other Transcripts NM_0073   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on PSEN1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of PSEN1
(miRNA target sites are highlighted)
>PSEN1|NM_0000|3'UTR
   1 TAGCATATTTGCGGTTAGAATCCCATGGATGTTTCTTCTTTGACTATAACAAAATCTGGGGAGGACAAAGGTGATTTTCC
  81 TGTGTCCACATCTAACAAAGTCAAGATTCCCGGCTGGACTTTTGCAGCTTCCTTCCAAGTCTTCCTGACCACCTTGCACT
 161 ATTGGACTTTGGAAGGAGGTGCCTATAGAAAACGATTTTGAACATACTTCATCGCAGTGGACTGTGTCCCTCGGTGCAGA
 241 AACTACCAGATTTGAGGGACGAGGTCAAGGAGATATGATAGGCCCGGAAGTTGCTGTGCCCCATCAGCAGCTTGACGCGT
 321 GGTCACAGGACGATTTCACTGACACTGCGAACTCTCAGGACTACCGTTACCAAGAGGTTAGGTGAAGTGGTTTAAACCAA
 401 ACGGAACTCTTCATCTTAAACTACACGTTGAAAATCAACCCAATAATTCTGTATTAACTGAATTCTGAACTTTTCAGGAG
 481 GTACTGTGAGGAAGAGCAGGCACCAGCAGCAGAATGGGGAATGGAGAGGTGGGCAGGGGTTCCAGCTTCCCTTTGATTTT
 561 TTGCTGCAGACTCATCCTTTTTAAATGAGACTTGTTTTCCCCTCTCTTTGAGTCAAGTCAAATATGTAGATTGCCTTTGG
 641 CAATTCTTCTTCTCAAGCACTGACACTCATTACCGTCTGTGATTGCCATTTCTTCCCAAGGCCAGTCTGAACCTGAGGTT
 721 GCTTTATCCTAAAAGTTTTAACCTCAGGTTCCAAATTCAGTAAATTTTGGAAACAGTACAGCTATTTCTCATCAATTCTC
 801 TATCATGTTGAAGTCAAATTTGGATTTTCCACCAAATTCTGAATTTGTAGACATACTTGTACGCTCACTTGCCCCAGATG
 881 CCTCCTCTGTCCTCATTCTTCTCTCCCACACAAGCAGTCTTTTTCTACAGCCAGTAAGGCAGCTCTGTCGTGGTAGCAGA
 961 TGGTCCCATTATTCTAGGGTCTTACTCTTTGTATGATGAAAAGAATGTGTTATGAATCGGTGCTGTCAGCCCTGCTGTCA
1041 GACCTTCTTCCACAGCAAATGAGATGTATGCCCAAAGACGGTAGAATTAAAGAAGAGTAAAATGGCTGTTGAAGCACTTT
1121 CTGTCCTGGTATTTTGTTTTTGCTTTTGCCACACAGTAGCTCAGAATTTGAACAAATAGCCAAAAGCTGGTGGTTGATGA
1201 ATTATGAACTAGTTGTATCAACACAAAGCAAGAGTTGGGGAAAGCCATATTTAACTTGGTGAGCTGTGGGAGAACCTGGT
1281 GGCAGAAGGAGAACCAACTGCCAAGGGGAAAGAGAAGGGGCCTCCAGCAGCGAAGGGGATACAGTGAGCTAATGATGTCA
1361 AGGAGGAGTTTCAGGTTATTCTCGTCAGCTCCACAAATGGGTGCTTTGTGGTCTCTGCCCGCGTTACCTTTCCTCTCAAT
1441 GTACCTTTGTGTGAACTGGGCAGTGGAGGTGCCTGCTGCAGTTACCATGGAGTTCAGGCTCTGGGCAGCTCAGTCAGGCA
1521 AAACACACAAACAGCCATCAGCCTGTGTGGGCTCAGGGCACCTCTGGACAAAGGCTTGTGGGGCATAACCTTCTTTACCA
1601 CAGAGAGCCCTTAGCTATGCTGATCAGACCGTAAGCGTTTATGAGAAACTTAGTTTCCTCCTGTGGCTGAGGAGGGGCCA
1681 GCTTTTTCTTCTTTTGCCTGCTGTTTTCTCTCCCAATCTATGATATGATATGACCTGGTTTGGGGCTGTCTTTGGTGTTT
1761 AGAATATTTGTTTTCTGTCCCAGGATATTTCTTATAAGAACCTAACTTCAAGAGTAGTGTGCGAGTACTGATCTGAATTT
1841 AAATTAAAATTGGCTTATATTAGGCAGTCACAGACAGGAAAAATAAGAGCTATGCAAAGAAAGGGGGATTTAAAGTAGTA
1921 GGTTCTATCATCTCAATTCATTTTTTTCCATGAAATCCCTTCTTCCAAGATTCATTCCCTCTCTCAGACATGTGCTAGCA
2001 TGGGTATTATCATTGAGAAAGCACAGCTACAGCAAAGCCACCTGAATAGCAATTTGTGATTGGAAGCATTCTTGAGGGAT
2081 CCCTAATCTAGAGTAATTTATTTGTGTAAGGATCCCAAATGTGTTGCACCTTTCATGATACATTTCTTCTCTGAAGAGGG
2161 TACGTGGGGTGTGTGTATTTAAATCCATCCTATGTATTACTGATTGTCCTGTGTAGAAAGATGGCAATTATTCTGTCTCT
2241 TTCTCCAAGTTTGAGCCACATCTCAGCCACATTGTTAGACAGTGTACAGAGAACCTATCTTTCCTTTTTTTTTTTTTAAA
2321 GGACAGGATTTTGCTGTGTTGCCCAGGCTAGACTTGAACTCCTGGGCTCAAGTAATCCACCTCAGCCTGAGTAGCTGAGA
2401 CTACAGCCCATCTTATTTCTTTAAATCATTCATCTCAGGCAGAGAACTTTTCCCTCAAACATTCTTTTTAGAATTAGTTC
2481 AGTCATTCCTAAAACATCCAAATGCTAGTCTTCCACCATGAAAAATAGATTGTCACTGGAAAGAACAGTAGCAATTTCCA
2561 TAAGGATGTGCCTTCACTCACACGGGACAGGCGGTGGTTATAGAGTCGGGCAAAACCAGCAGTAGAGTATGACCAGCCAA
2641 GCCAATCTGCTTAATAAAAAGATGGAAGACAGTAAGGAAGGAAAGTAGCCACTAAGAGTCTGAGTCTGACTGGGCTACAG
2721 AATAAAGGGTATTTATGGACAGAATGTCATTACATGCCTATGGGAATACCAATCATATTTGGAAGATTTGCAGATTTTTT
2801 TTCAGAGAGGAAAGACTCACCTTCCTGTTTTTGGTTCTCAGTAGGTTCGTGTGTGTTCCTAGAATCACAGCTCTGACTCC
2881 AAATGACTCAATTTCTCAATTAGAAAAAGTAGAAGCTTTCTAAGCAACTTGGAAGAAAACAGTCATAAGTAAGCAATTTG
2961 TTGATTTTACTACAGAAGCAACAACTGAAGAGGCAGTGTTTTTACTTTCAGACTCCGGGATTCCCATTCTGTAGTCTCTC
3041 TGCTTTTAAAAACCCTCCTTTTGCAATAGATGCCCAAACAGATGATGTTTATTACTTGTTATTTACGTGGCCTCAGACAG
3121 TGTATGTATTCTCGATATAACTTGTAGAGTGTGAAATATAAGTTTAACTACCAAATAAGGTCTCCCAGGGTTAGATGACT
3201 GCGGGAAGCCTTTGATCCCAACCCCCAAGGCTTTGTATATTTGATCATTTGTGATCTAACCCTGGAAGAAAAAGAGCTCA
3281 GAAACCACTATGAAAAAATTTGTTCAGTGTTTTCTGTGTTCCCGTAGGTTCTGGAGTCTGAGGATGCAAAGATGAATAAG
3361 ATAAATTCTCAGAATGTAGTTATAATCTCTTGTTTTCTGGTATATGCCATCTTTCTTTAACTTCTCTAAAATATTGGGTA
3441 TTTGTCAAATAACCACTTTTAACAGTTACCATTACTGAGGGCTTATACATTGGTGTTATAAAAGTGACTTGATTCAGAAA
3521 TCAATCCATTCAGTAAAGTACTCCTTCTCTAAATTTGCTGTTATGTCTATAAGGAACAGTTTGACCTGCCCTTCTCCTCA
3601 CCTCCTCACCTGCCTTCCAACATTGAATTTGGAAGGAGACGTGAAAATTGGACATTTGGTTTTGCCCTTGGGCTGGAAAC
3681 TATCATATAATCATAAGTTTGAGCCTAGAAGTGATCCTTGTGATCTTCTCACCTCTTTAAATTCCCACAACACAAGAGAT
3761 TAAAAACAGAGGTTTCAGCTCTTCATAGTGCGTTGTGAAATGGCTGGCCAGAGTGTACCAACAAAGCTGTCATCGGGCTC
3841 ACAGCTCAGAGACATCTGCATGTGATCATCTGCATAGTCCTCTCCTCTAACGGGAAACACCTCAGATTTGCATATAAAAA
3921 AGCACCCTGGTGCTGAAATGAACCCCTTTCTTGAACATCAAAGCTGTCTCCCACAGCCTTGGGCAGCAGGGTGCCTCTTA
4001 GTGGATGTGCTGGGTCCACCCTGAGCCCTGACATGTGGTGGCAGCATTGCCAGTTGGTCTGTGTGTCTGTGTAGCAGGGA
4081 CGATTTCCCAGAAAGCAATTTTCCTTTTGAAATACGTAATTGTTGAGACTAGGCAGTTTCAAAGTCAGCTGCATATAGTA
4161 GCAAGTACAGGACTGTCTTGTTTTTGGTGTCCTTGGAGGTGCTGGGGTGAGGGTTTCAGTGGGATCATTTACTCTCACAT
4241 GTTGTCTGCCTTCTGCTTCTGTGGACACTGCTTTGTACTTAATTCAGACAGACTGTGAATACACCTTTTTTATAAATACC
4321 TTTCAAATTCTTGGTAAGATATAATTTTGATAGCTGATTGCAGATTTTCTGTATTTGTCAGATTAATAAAGACTGCATGA
4401 ATCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-562 :: PSEN1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions 293T
Location of target site 3'UTR
Tools used in this research miRBase Target Database , miRNAMap , TargetScan
Original Description (Extracted from the article) ... MET and PSEN1 luciferase levels were not significantly altered in this system (data not shown), but EYA1 expression was significantly decreased (P ≤ 0.005), indicating that it is a genuine target of miR-562 (Fig. 4). ...

- Drake, K. M. Ruteshouser, E. C. Natrajan, et al., 2009, Clin Cancer Res.

Article - Drake, K. M. Ruteshouser, E. C. Natrajan, et al.
- Clin Cancer Res, 2009
PURPOSE: Wilms' tumor is a childhood cancer of the kidney with an incidence of approximately 1 in 10,000. Cooccurrence of Wilms' tumor with 2q37 deletion syndrome, an uncommon constitutional chromosome abnormality, has been reported previously in three children. Given these are independently rare clinical entities, we hypothesized that 2q37 harbors a tumor suppressor gene important in Wilms' tumor pathogenesis. EXPERIMENTAL DESIGN: To test this, we performed loss of heterozygosity analysis in a panel of 226 sporadic Wilms' tumor samples and mutation analysis of candidate genes. RESULTS: Loss of heterozygosity was present in at least 4% of cases. Two tumors harbored homozygous deletions at 2q37.1, supporting the presence of a tumor suppressor gene that follows a classic two-hit model. However, no other evidence of second mutations was found, suggesting that heterozygous deletion alone may be sufficient to promote tumorigenesis in concert with other genomic abnormalities. We show that miR-562, a microRNA within the candidate region, is expressed only in kidney and colon and regulates EYA1, a critical gene for renal development. miR-562 expression is reduced in Wilms' tumor and may contribute to tumorigenesis by deregulating EYA1. Two other candidate regions were localized at 2q37.3 and 2qter, but available data from patients with constitutional deletions suggest that these probably do not confer a high risk for Wilms' tumor. CONCLUSIONS: Our data support the presence of a tumor suppressor gene at 2q37.1 and suggest that, in individuals with constitutional 2q37 deletions, any increased risk for developing Wilms' tumor likely correlates with deletions encompassing 2q37.1.
LinkOut: [PMID: 19789318]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
3 hsa-miR-562 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000035 EYA1 eyes absent homolog 1 (Drosophila) 2 1
MIRT005024 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT005025 PSEN1 presenilin 1 2 1