Accession ID: MIRT005025 [miRNA, hsa-miR-562 :: PSEN1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-562LinkOut: [miRBase ]
Synonyms MIRN562, hsa-mir-562, MIR562
Description Homo sapiens miR-562 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-562
Mature Sequence 61| AAAGUAGCUGUACCAUUUGC |80
Evidence Experimental
Experiments SAGE
Putative hsa-miR-562 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-562 :: PSEN1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions 293T
Location of target site 3'UTR
Tools used in this research miRBase Target Database , miRNAMap , TargetScan
Original Description (Extracted from the article) ... MET and PSEN1 luciferase levels were not significantly altered in this system (data not shown), but EYA1 expression was significantly decreased (P ≤ 0.005), indicating that it is a genuine target of miR-562 (Fig. 4). ...

- Drake, K. M. Ruteshouser, E. C. Natrajan, et al., 2009, Clin Cancer Res.

Article - Drake, K. M. Ruteshouser, E. C. Natrajan, et al.
- Clin Cancer Res, 2009
PURPOSE: Wilms' tumor is a childhood cancer of the kidney with an incidence of approximately 1 in 10,000. Cooccurrence of Wilms' tumor with 2q37 deletion syndrome, an uncommon constitutional chromosome abnormality, has been reported previously in three children. Given these are independently rare clinical entities, we hypothesized that 2q37 harbors a tumor suppressor gene important in Wilms' tumor pathogenesis. EXPERIMENTAL DESIGN: To test this, we performed loss of heterozygosity analysis in a panel of 226 sporadic Wilms' tumor samples and mutation analysis of candidate genes. RESULTS: Loss of heterozygosity was present in at least 4% of cases. Two tumors harbored homozygous deletions at 2q37.1, supporting the presence of a tumor suppressor gene that follows a classic two-hit model. However, no other evidence of second mutations was found, suggesting that heterozygous deletion alone may be sufficient to promote tumorigenesis in concert with other genomic abnormalities. We show that miR-562, a microRNA within the candidate region, is expressed only in kidney and colon and regulates EYA1, a critical gene for renal development. miR-562 expression is reduced in Wilms' tumor and may contribute to tumorigenesis by deregulating EYA1. Two other candidate regions were localized at 2q37.3 and 2qter, but available data from patients with constitutional deletions suggest that these probably do not confer a high risk for Wilms' tumor. CONCLUSIONS: Our data support the presence of a tumor suppressor gene at 2q37.1 and suggest that, in individuals with constitutional 2q37 deletions, any increased risk for developing Wilms' tumor likely correlates with deletions encompassing 2q37.1.
LinkOut: [PMID: 19789318]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
101 hsa-miR-562 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000035 EYA1 eyes absent homolog 1 (Drosophila) 2 1
MIRT005024 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT005025 PSEN1 presenilin 1 2 1
MIRT083461 RALGAPB Ral GTPase activating protein, beta subunit (non-catalytic) 1 2
MIRT087867 CBY1 chibby homolog 1 (Drosophila) 1 2
MIRT107692 RECK reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT175241 PSAT1 phosphoserine aminotransferase 1 1 3
MIRT193960 GLCE glucuronic acid epimerase 1 1
MIRT197417 KAT7 K(lysine) acetyltransferase 7 1 1
MIRT211195 FGF2 fibroblast growth factor 2 (basic) 1 3
MIRT310454 REST RE1-silencing transcription factor 1 1
MIRT443140 ZDHHC21 zinc finger, DHHC-type containing 21 1 1
MIRT443672 PDE3B phosphodiesterase 3B, cGMP-inhibited 1 1
MIRT445310 MLANA melan-A 1 1
MIRT446464 THAP1 THAP domain containing, apoptosis associated protein 1 1 2
MIRT446484 ZFAND4 zinc finger, AN1-type domain 4 1 1
MIRT449103 POLDIP2 polymerase (DNA-directed), delta interacting protein 2 1 1
MIRT455851 C9orf78 chromosome 9 open reading frame 78 1 1
MIRT457718 ZNF449 zinc finger protein 449 1 1
MIRT463503 ZC3H10 zinc finger CCCH-type containing 10 1 1
MIRT465088 TSPAN3 tetraspanin 3 1 1
MIRT467873 SLC23A1 solute carrier family 23 (nucleobase transporters), member 1 1 1
MIRT473981 LRRC58 leucine rich repeat containing 58 1 1
MIRT474261 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 1 1
MIRT486267 LINC00346 long intergenic non-protein coding RNA 346 1 2
MIRT487457 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT488988 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT492064 TMEM245 transmembrane protein 245 1 1
MIRT493856 FOXN3 forkhead box N3 1 2
MIRT494160 COL4A1 collagen, type IV, alpha 1 1 3
MIRT496030 ZBED3 zinc finger, BED-type containing 3 1 1
MIRT496429 ACTRT3 actin-related protein T3 1 1
MIRT500319 ZNF622 zinc finger protein 622 1 4
MIRT503320 FICD FIC domain containing 1 2
MIRT507842 CCNT1 cyclin T1 1 2
MIRT510327 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 2
MIRT511972 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 2
MIRT515965 C9orf156 chromosome 9 open reading frame 156 1 1
MIRT518014 RPL4 ribosomal protein L4 1 2
MIRT520770 TCF23 transcription factor 23 1 1
MIRT521764 PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 1 3
MIRT523926 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT525666 NHSL2 NHS-like 2 1 1
MIRT530028 KIAA1875 KIAA1875 1 1
MIRT530617 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT532308 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT534164 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT536009 MED13 mediator complex subunit 13 1 1
MIRT544849 BASP1 brain abundant, membrane attached signal protein 1 1 2
MIRT546442 SNX5 sorting nexin 5 1 1
MIRT547526 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 2
MIRT548172 FRAT2 frequently rearranged in advanced T-cell lymphomas 2 1 1
MIRT551470 TRIM59 tripartite motif containing 59 1 1
MIRT554046 SOX6 SRY (sex determining region Y)-box 6 1 1
MIRT555163 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT557817 FOXO1 forkhead box O1 1 2
MIRT558505 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 1 2
MIRT570626 MAP1B microtubule-associated protein 1B 1 1
MIRT574803 EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 1 1
MIRT618245 PGBD4 piggyBac transposable element derived 4 1 1
MIRT618696 CAMK1D calcium/calmodulin-dependent protein kinase ID 1 1
MIRT619008 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT621246 SIGLEC9 sialic acid binding Ig-like lectin 9 1 2
MIRT626895 ANGEL1 angel homolog 1 (Drosophila) 1 1
MIRT633820 WDR92 WD repeat domain 92 1 1
MIRT648371 CYB5A cytochrome b5 type A (microsomal) 1 1
MIRT654653 PTAFR platelet-activating factor receptor 1 1
MIRT657175 INTU inturned planar cell polarity effector homolog (Drosophila) 1 1
MIRT657204 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT658875 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT666725 RBFOX1 RNA binding protein, fox-1 homolog (C. elegans) 1 1 1
MIRT670794 ASB16 ankyrin repeat and SOCS box containing 16 1 1
MIRT671793 RGS17 regulator of G-protein signaling 17 1 1
MIRT675536 RPL37 ribosomal protein L37 1 1
MIRT676183 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT676319 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT676663 LRRC27 leucine rich repeat containing 27 1 1
MIRT676681 ICA1L islet cell autoantigen 1,69kDa-like 1 1
MIRT677499 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT677899 DCP1A DCP1 decapping enzyme homolog A (S. cerevisiae) 1 1
MIRT678022 SPIC Spi-C transcription factor (Spi-1/PU.1 related) 1 1
MIRT678033 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT678366 PPAP2B phosphatidic acid phosphatase type 2B 1 1
MIRT678650 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT679090 PURB purine-rich element binding protein B 1 1
MIRT679123 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 1 1
MIRT682794 BLOC1S3 biogenesis of lysosomal organelles complex-1, subunit 3 1 1
MIRT683193 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT684602 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT685422 ACAD8 acyl-CoA dehydrogenase family, member 8 1 1
MIRT687838 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT688030 GPN2 GPN-loop GTPase 2 1 1
MIRT688650 CREM cAMP responsive element modulator 1 1
MIRT691398 NRIP1 nuclear receptor interacting protein 1 1 1
MIRT696029 NDUFS3 NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) 1 1
MIRT704001 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT712240 RCC2 regulator of chromosome condensation 2 1 1
MIRT714615 EXO5 exonuclease 5 1 1
MIRT722608 CCDC152 coiled-coil domain containing 152 1 1
MIRT722880 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT724407 WWC1 WW and C2 domain containing 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*