Accession ID: MIRT005025 [miRNA, hsa-miR-562 :: PSEN1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-562LinkOut: [miRBase ]
Synonyms MIRN562, hsa-mir-562, MIR562
Description Homo sapiens miR-562 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-562
Mature Sequence 61| AAAGUAGCUGUACCAUUUGC |80
Evidence Experimental
Experiments SAGE
Putative hsa-miR-562 Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-562 :: PSEN1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions 293T
Location of target site 3'UTR
Tools used in this research miRBase Target Database , miRNAMap , TargetScan
Original Description (Extracted from the article) ... MET and PSEN1 luciferase levels were not significantly altered in this system (data not shown), but EYA1 expression was significantly decreased (P ≤ 0.005), indicating that it is a genuine target of miR-562 (Fig. 4). ...

- Drake, K. M. Ruteshouser, E. C. Natrajan, et al., 2009, Clin Cancer Res.

Article - Drake, K. M. Ruteshouser, E. C. Natrajan, et al.
- Clin Cancer Res, 2009
PURPOSE: Wilms' tumor is a childhood cancer of the kidney with an incidence of approximately 1 in 10,000. Cooccurrence of Wilms' tumor with 2q37 deletion syndrome, an uncommon constitutional chromosome abnormality, has been reported previously in three children. Given these are independently rare clinical entities, we hypothesized that 2q37 harbors a tumor suppressor gene important in Wilms' tumor pathogenesis. EXPERIMENTAL DESIGN: To test this, we performed loss of heterozygosity analysis in a panel of 226 sporadic Wilms' tumor samples and mutation analysis of candidate genes. RESULTS: Loss of heterozygosity was present in at least 4% of cases. Two tumors harbored homozygous deletions at 2q37.1, supporting the presence of a tumor suppressor gene that follows a classic two-hit model. However, no other evidence of second mutations was found, suggesting that heterozygous deletion alone may be sufficient to promote tumorigenesis in concert with other genomic abnormalities. We show that miR-562, a microRNA within the candidate region, is expressed only in kidney and colon and regulates EYA1, a critical gene for renal development. miR-562 expression is reduced in Wilms' tumor and may contribute to tumorigenesis by deregulating EYA1. Two other candidate regions were localized at 2q37.3 and 2qter, but available data from patients with constitutional deletions suggest that these probably do not confer a high risk for Wilms' tumor. CONCLUSIONS: Our data support the presence of a tumor suppressor gene at 2q37.1 and suggest that, in individuals with constitutional 2q37 deletions, any increased risk for developing Wilms' tumor likely correlates with deletions encompassing 2q37.1.
LinkOut: [PMID: 19789318]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
3 hsa-miR-562 Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000035 EYA1 eyes absent homolog 1 (Drosophila) 2 1
MIRT005024 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT005025 PSEN1 presenilin 1 2 1