Accession ID: MIRT005035 [miRNA, hsa-miR-200b-3p :: MATR3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200bLinkOut: [miRBase ]
Description Homo sapiens miR-200b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200b-3p
Mature Sequence 57| UAAUACUGCCUGGUAAUGAUGA |78
Evidence Experimental
Experiments Northern
Putative hsa-miR-200b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200b-3p :: MATR3    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Other
Conditions H295R
Disease massive macronodular adrenocortical disease//adrenocortical carcinoma;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Interestingly, we detected miR-200b targeting directly Matrin 3 (MATR3) expression in an adrenocortical cancer cell line (H295R).// ...

- Bimpaki, E. I. Iliopoulos, D. Moraitis, A. et al., 2010, Clin Endocrinol (Oxf).

Article - Bimpaki, E. I. Iliopoulos, D. Moraitis, A. et al.
- Clin Endocrinol (Oxf), 2010
PURPOSE: Massive macronodular adrenocortical disease (MMAD) may be caused by aberrant microRNA expression. To determine the microRNA profile in MMAD and identify putative microRNA-gene target pairs involved in adrenal tumourigenesis. EXPERIMENTAL DESIGN: We performed microRNA microarray analysis in 10 patients with ACTH-independent Cushing syndrome caused by MMAD (ages 39-60 years) and four normal adrenal cortex samples were used as controls. Microarray data were validated by real-time polymerase chain reaction (qRT-PCR). Identification of potential microRNA-gene target pairs implicated in MMAD pathogenesis has been performed by integrating our microRNA data with previously obtained cDNA microarray data. Experimental validation of specific microRNA gene targets was performed by transfection experiments and luciferase assay. RESULTS: A total of 37 microRNAs were differentially expressed between MMAD and normal tissues; 16 microRNAs were down-regulated, including miR-200b and miR-203, whereas 21 microRNAs were up-regulated, miR-210 and miR-484 among them. Comparison of microRNA data with different clinicopathological parameters revealed miR-130a and miR-382 as putative diagnostic MMAD markers. Interestingly, we detected miR-200b targeting directly Matrin 3 (MATR3) expression in an adrenocortical cancer cell line (H295R). CONCLUSIONS: MicroRNAs appear to have distinct regulatory effects in MMAD, including an association with clinical presentation and severity of the disease, expressed by the degree of hypercortisolism. This is the first investigation of microRNAs in MMAD, a disease with complex pathogenesis; the data indicate that specific microRNAs such as miR-200b may play a significant role in MMAD formation and/or progression.
LinkOut: [PMID: 19849700]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
160 hsa-miR-200b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000198 PTPN12 protein tyrosine phosphatase, non-receptor type 12 3 1
MIRT000723 ZEB2 zinc finger E-box binding homeobox 2 5 18
MIRT000724 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT002482 SIP1 gem (nuclear organelle) associated protein 2 1 1
MIRT002483 ZEB1 zinc finger E-box binding homeobox 1 5 15
MIRT002987 RERE arginine-glutamic acid dipeptide (RE) repeats 2 1
MIRT003138 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003139 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT003599 EP300 E1A binding protein p300 2 1
MIRT003783 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 4 1
MIRT004008 GATA4 GATA binding protein 4 4 2
MIRT004009 FN1 fibronectin 1 5 2
MIRT004296 WASF3 WAS protein family, member 3 3 1
MIRT004623 ZFPM2 zinc finger protein, multitype 2 3 2
MIRT005035 MATR3 matrin 3 4 1
MIRT006163 RNF2 ring finger protein 2 4 1
MIRT006165 BMI1 BMI1 polycomb ring finger oncogene 4 2
MIRT006298 E2F3 E2F transcription factor 3 2 2
MIRT006440 VEGFA vascular endothelial growth factor A 2 1
MIRT006441 FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) 2 1
MIRT006442 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 3 2
MIRT006511 RND3 Rho family GTPase 3 3 3
MIRT006666 CCNE2 cyclin E2 1 1
MIRT006670 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT006671 XIAP X-linked inhibitor of apoptosis 3 1
MIRT007322 SMAD2 SMAD family member 2 1 1
MIRT007342 CREB1 cAMP responsive element binding protein 1 3 3
MIRT024121 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT024122 ELMO2 engulfment and cell motility 2 2 1
MIRT024123 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT024124 ERRFI1 ERBB receptor feedback inhibitor 1 1 1
MIRT024125 ERBB2IP erbb2 interacting protein 2 1
MIRT024126 WDR37 WD repeat domain 37 2 1
MIRT024127 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT024128 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT024129 HOXB5 homeobox B5 1 1
MIRT024130 RIN2 Ras and Rab interactor 2 1 1
MIRT024131 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT024132 KLF11 Kruppel-like factor 11 1 1
MIRT024133 SEPT7 septin 7 1 1
MIRT024134 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT046569 SUPV3L1 suppressor of var1, 3-like 1 (S. cerevisiae) 1 1
MIRT052923 MYB v-myb myeloblastosis viral oncogene homolog (avian) 3 1
MIRT053342 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 3 1
MIRT053529 SUZ12 suppressor of zeste 12 homolog (Drosophila) 3 2
MIRT053535 WNT1 wingless-type MMTV integration site family, member 1 4 1
MIRT053568 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 3 1
MIRT053569 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 3 1
MIRT053570 SP1 Sp1 transcription factor 3 1
MIRT053625 MSN moesin 3 1
MIRT054266 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT054267 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT054541 HFE hemochromatosis 2 1
MIRT054548 DLC1 deleted in liver cancer 1 2 1
MIRT054550 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 1
MIRT054683 FERMT2 fermitin family member 2 4 1
MIRT054844 RAB21 RAB21, member RAS oncogene family 3 2
MIRT054845 RAB3B RAB3B, member RAS oncogene family 3 2
MIRT054885 RAB18 RAB18, member RAS oncogene family 3 1
MIRT054886 RAB23 RAB23, member RAS oncogene family 3 1
MIRT054917 OXR1 oxidation resistance 1 3 1
MIRT063868 RASSF8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 1 3
MIRT080631 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT100486 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT106295 ZFHX4 zinc finger homeobox 4 1 3
MIRT108446 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT143030 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT157710 CAB39 calcium binding protein 39 1 1
MIRT159114 NRBP1 nuclear receptor binding protein 1 1 1
MIRT204208 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 1
MIRT209178 ZMAT3 zinc finger, matrin-type 3 1 1
MIRT212861 N4BP2 NEDD4 binding protein 2 1 1
MIRT218291 QKI QKI, KH domain containing, RNA binding 1 1
MIRT243811 ANKRD33B ankyrin repeat domain 33B 1 5
MIRT244404 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 2
MIRT245588 DDIT4 DNA-damage-inducible transcript 4 1 2
MIRT271934 KLHL42 kelch domain containing 5 1 3
MIRT296344 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT319179 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 1 1
MIRT329852 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 1
MIRT344584 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT437862 NOTCH1 notch 1 3 2
MIRT437874 BTC betacellulin 4 1
MIRT437988 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 4 3
MIRT438051 LOX lysyl oxidase 3 1
MIRT438165 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438166 SEC23A Sec23 homolog A (S. cerevisiae) 4 2
MIRT438204 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT438205 SUZ12 suppressor of zeste 12 homolog (Drosophila) 1 1
MIRT438291 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 1 1
MIRT438476 DDX53 DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 1 1
MIRT444900 PHF14 PHD finger protein 14 1 2
MIRT447579 CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) 1 1
MIRT449890 ZNF621 zinc finger protein 621 1 1
MIRT450413 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT451990 FKBP5 FK506 binding protein 5 1 1
MIRT473906 M6PR mannose-6-phosphate receptor (cation dependent) 1 4
MIRT474749 KIF13A kinesin family member 13A 1 3
MIRT478184 DENND5B DENN/MADD domain containing 5B 1 1
MIRT488806 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT497728 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 1 1
MIRT498688 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT499209 TJAP1 tight junction associated protein 1 (peripheral) 1 1
MIRT499298 TPD52L1 tumor protein D52-like 1 1 1
MIRT499786 CASP2 caspase 2, apoptosis-related cysteine peptidase 1 1
MIRT499851 AVPR1A arginine vasopressin receptor 1A 1 2
MIRT499929 GPX8 glutathione peroxidase 8 (putative) 1 1
MIRT499960 ABI2 abl-interactor 2 1 1
MIRT500165 CLEC2D C-type lectin domain family 2, member D 1 4
MIRT500609 UBE2D1 ubiquitin-conjugating enzyme E2D 1 1 3
MIRT500743 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT500827 TCEB1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) 1 1
MIRT500837 TBK1 TANK-binding kinase 1 1 1
MIRT501488 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT501594 PLCG1 phospholipase C, gamma 1 1 1
MIRT501842 NCOA2 nuclear receptor coactivator 2 1 1
MIRT502084 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT502178 JUN jun proto-oncogene 1 1
MIRT502837 CELF1 CUGBP, Elav-like family member 1 1 1
MIRT502959 CCNT2 cyclin T2 1 1
MIRT503131 BAG4 BCL2-associated athanogene 4 1 1
MIRT505280 TUBB2A tubulin, beta 2A class IIa 1 1
MIRT505430 TCF7L2 transcription factor 7-like 2 (T-cell specific, HMG-box) 1 2
MIRT511849 GPATCH8 G patch domain containing 8 1 2
MIRT513408 LMNB1 lamin B1 1 2
MIRT528183 C6orf47 chromosome 6 open reading frame 47 1 1
MIRT530669 TRIM56 tripartite motif containing 56 1 1
MIRT530836 MAPK7 mitogen-activated protein kinase 7 1 1
MIRT531134 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT531393 TXNDC16 thioredoxin domain containing 16 1 1
MIRT533348 UNC119B unc-119 homolog B (C. elegans) 1 1
MIRT533791 TMEM119 transmembrane protein 119 1 1
MIRT533975 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 1
MIRT535530 PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT535670 NLGN4X neuroligin 4, X-linked 1 1
MIRT537615 ERMP1 endoplasmic reticulum metallopeptidase 1 1 1
MIRT540709 PDPK1 3-phosphoinositide dependent protein kinase-1 1 2
MIRT549052 CAMSAP2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT557648 GATA6 GATA binding protein 6 1 1
MIRT557786 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT558564 CRLF3 cytokine receptor-like factor 3 1 2
MIRT558829 CDCA4 cell division cycle associated 4 1 1
MIRT564438 YEATS4 YEATS domain containing 4 1 1
MIRT566768 MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 1 1
MIRT568295 BBX bobby sox homolog (Drosophila) 1 1
MIRT570299 ARPC3 actin related protein 2/3 complex, subunit 3, 21kDa 1 1
MIRT571758 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT573139 ABT1 activator of basal transcription 1 1 1
MIRT616923 PPM1H protein phosphatase, Mg2+/Mn2+ dependent, 1H 1 1
MIRT640091 INO80D INO80 complex subunit D 1 1
MIRT640649 IGF2 insulin-like growth factor 2 (somatomedin A) 1 1
MIRT661419 FAM216B family with sequence similarity 216, member B 1 1
MIRT664728 PTPN4 protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 1 1
MIRT686617 TMEM70 transmembrane protein 70 1 1
MIRT686764 STX16 syntaxin 16 1 1
MIRT699807 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT701748 MTDH metadherin 1 1
MIRT711054 IRS1 insulin receptor substrate 1 1 1
MIRT721943 NGRN neugrin, neurite outgrowth associated 1 1
MIRT723590 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*