Accession ID: MIRT005035 [miRNA, hsa-miR-200b-3p :: MATR3, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-200bLinkOut: [miRBase ]
Description Homo sapiens miR-200b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-200b-3p
Mature Sequence 57| UAAUACUGCCUGGUAAUGAUGA |78
Evidence Experimental
Experiments Northern
Putative hsa-miR-200b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MATR3 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms DKFZp686K0542, DKFZp686K23100, KIAA0723, MGC9105, MPD2
Description matrin 3
Transcript NM_0188    LinkOut: [ RefSeq ]
Other Transcripts NM_1991   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MATR3 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MATR3
(miRNA target sites are highlighted)
>MATR3|NM_0188|3'UTR
   1 TAAGATGTGCAAGGAGATTTAATGATTTCAAAGAAAATAATGGTTCTTTGTTTTTAATGTTAACCTTTTTTAAATACAAT
  81 ACTGATAGTTAGAAGAAAACTATTGTACTCTTTTGTTTTAGTGGAGAAATAATAGATGTCTGTTCATGTGTTAAGTGTTA
 161 TAGCAAAAAAAATACACATATGGTTAAGTTAATGAATAGTTTTTGTTTTATCAGAATGGCAACAGACAGAAGTACTTTGT
 241 AGAGATTGACTTCCTAAGCTACTTAAGACAACTTGCACCACTAAGAAAAAAATGTAGAACCATTTGGAAAAATGAAATTT
 321 AGTAGTTCCAAGTTTCAAAGAAATGTCAACATTTTATTCCATTCAATAAAGAACAAAACCAATAGTGTTTTTATTACTTT
 401 CATCTGAAACATTCCATGTTTTAATCTGAGCCTTGCAGACTTTCATTTGGAGTTTGAACCCGTTTTGGTTGCATTTCATT
 481 TTTGGAGAACTTAATTAACGTGAGATTGGCAATTGAAATGCAGGTGCAGTTTTCTGTTAATGTCATGCTGTTGTTTAGGT
 561 AATAAGAAATATTAAGTAATTGGCTTTAGATTTTGTAATTTTTTTCCCTGAGTTCCTGCTAGATTTCGTATTCTAGTAGT
 641 CAATGTATTTTCAGTGAAATGCAAAAATATTCCCGTTATCTTTGACCAGTATTAATTTTTGAGATCTTACTGCTTGTCAC
 721 TTGAATCCCGTGATTGTCATACATCTCTGGTATAAGCAACATTTGATTTTTGAAGTGTGTAGACCATCTCTTCATATTTT
 801 CAAGATGTAATTTTACATTTCTGCATTTTTAAAACAGTTTGGCCATAATCCTAGATGCACGCTTCTAATTCATGTACCTG
 881 CACATGTGACCTTTGTGAACAGAAATTTGCATGTATAATTTGTGTTTACTTGTAACTTTCTGGTTATATACTGCTTATAT
 961 CTGTGGATTCAAGTTACTGAAGTGAATACCAATAAAAAGAAAACCCTAGGCCATGTTAATTGGTTATACATGTTTGGAAT
1041 GTTAACCAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' agUAGUAAUGGUCCGUCAUAAu 5'
            ||| ||: |   ||||||| 
Target 5' ttATCTTTGAC---CAGTATTa 3'
676 - 694 153.00 -8.70
2
miRNA  3' agUAGUAAUGGUCCGUCAUAAu 5'
            | ||  ||||  :|||:|| 
Target 5' agAACAAAACCA-ATAGTGTTt 3'
370 - 390 123.00 -9.60
3
miRNA  3' agUAG--UAAUGGUC-CGUCAUAAu 5'
            ||:  | |:| :| ||||| || 
Target 5' caATTGAAATGCAGGTGCAGTTTTc 3'
510 - 534 122.00 -7.66
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-200b-3p :: MATR3    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , qRT-PCR , Other
Conditions H295R
Disease massive macronodular adrenocortical disease//adrenocortical carcinoma;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Interestingly, we detected miR-200b targeting directly Matrin 3 (MATR3) expression in an adrenocortical cancer cell line (H295R).// ...

- Bimpaki, E. I. Iliopoulos, D. Moraitis, A. et al., 2010, Clin Endocrinol (Oxf).

Article - Bimpaki, E. I. Iliopoulos, D. Moraitis, A. et al.
- Clin Endocrinol (Oxf), 2010
PURPOSE: Massive macronodular adrenocortical disease (MMAD) may be caused by aberrant microRNA expression. To determine the microRNA profile in MMAD and identify putative microRNA-gene target pairs involved in adrenal tumourigenesis. EXPERIMENTAL DESIGN: We performed microRNA microarray analysis in 10 patients with ACTH-independent Cushing syndrome caused by MMAD (ages 39-60 years) and four normal adrenal cortex samples were used as controls. Microarray data were validated by real-time polymerase chain reaction (qRT-PCR). Identification of potential microRNA-gene target pairs implicated in MMAD pathogenesis has been performed by integrating our microRNA data with previously obtained cDNA microarray data. Experimental validation of specific microRNA gene targets was performed by transfection experiments and luciferase assay. RESULTS: A total of 37 microRNAs were differentially expressed between MMAD and normal tissues; 16 microRNAs were down-regulated, including miR-200b and miR-203, whereas 21 microRNAs were up-regulated, miR-210 and miR-484 among them. Comparison of microRNA data with different clinicopathological parameters revealed miR-130a and miR-382 as putative diagnostic MMAD markers. Interestingly, we detected miR-200b targeting directly Matrin 3 (MATR3) expression in an adrenocortical cancer cell line (H295R). CONCLUSIONS: MicroRNAs appear to have distinct regulatory effects in MMAD, including an association with clinical presentation and severity of the disease, expressed by the degree of hypercortisolism. This is the first investigation of microRNAs in MMAD, a disease with complex pathogenesis; the data indicate that specific microRNAs such as miR-200b may play a significant role in MMAD formation and/or progression.
LinkOut: [PMID: 19849700]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
42 hsa-miR-200b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000198 PTPN12 protein tyrosine phosphatase, non-receptor type 12 3 1
MIRT000723 ZEB2 zinc finger E-box binding homeobox 2 5 12
MIRT000724 BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 3 3
MIRT002482 SIP1 survival of motor neuron protein interacting protein 1 1 1
MIRT002483 ZEB1 zinc finger E-box binding homeobox 1 5 10
MIRT002987 RERE arginine-glutamic acid dipeptide (RE) repeats 2 1
MIRT003138 Zeb2 zinc finger E-box binding homeobox 2 3 1
MIRT003139 Zeb1 zinc finger E-box binding homeobox 1 3 1
MIRT003599 EP300 E1A binding protein p300 2 1
MIRT003783 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 4 1
MIRT004008 GATA4 GATA binding protein 4 2 1
MIRT004009 FN1 fibronectin 1 2 1
MIRT004296 WASF3 WAS protein family, member 3 3 1
MIRT004623 ZFPM2 zinc finger protein, multitype 2 3 1
MIRT005035 MATR3 matrin 3 4 1
MIRT006163 RNF2 ring finger protein 2 4 1
MIRT006165 BMI1 BMI1 polycomb ring finger oncogene 4 1
MIRT006298 E2F3 E2F transcription factor 3 2 2
MIRT006440 VEGFA vascular endothelial growth factor A 2 1
MIRT006441 FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) 2 1
MIRT006442 KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 2 1
MIRT006511 RND3 Rho family GTPase 3 1 1
MIRT006666 CCNE2 cyclin E2 1 1
MIRT006670 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT006671 XIAP X-linked inhibitor of apoptosis 3 1
MIRT007322 SMAD2 SMAD family member 2 1 1
MIRT007342 CREB1 cAMP responsive element binding protein 1 3 2
MIRT024121 KLHL20 kelch-like 20 (Drosophila) 2 1
MIRT024122 ELMO2 engulfment and cell motility 2 2 1
MIRT024123 PTPRD protein tyrosine phosphatase, receptor type, D 2 1
MIRT024124 ERRFI1 ERBB receptor feedback inhibitor 1 1 1
MIRT024125 ERBB2IP erbb2 interacting protein 2 1
MIRT024126 WDR37 WD repeat domain 37 2 1
MIRT024127 TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) 1 1
MIRT024128 VAC14 Vac14 homolog (S. cerevisiae) 1 1
MIRT024129 HOXB5 homeobox B5 1 1
MIRT024130 RIN2 Ras and Rab interactor 2 1 1
MIRT024131 RASSF2 Ras association (RalGDS/AF-6) domain family member 2 1 1
MIRT024132 KLF11 Kruppel-like factor 11 1 1
MIRT024133 SEPT7 septin 7 1 1
MIRT024134 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 1 1
MIRT046569 SUPV3L1 suppressor of var1, 3-like 1 (S. cerevisiae) 1 1