Accession ID: MIRT005065 [miRNA, hsa-miR-196a-5p :: CDKN1B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-196a-1LinkOut: [miRBase ]
Synonyms MIRN196-1, MIRN196A1, MIR196A1
Description Homo sapiens miR-196a-1 stem-loop
Comment Lagos-Quintana et al. .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-196a-5p
Mature Sequence 7| UAGGUAGUUUCAUGUUGUUGGG |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-196a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDKN4, KIP1, MEN1B, MEN4, P27KIP1
Description cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Transcript NM_004064    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1B
(miRNA target sites are highlighted)
>CDKN1B|NM_004064|3'UTR
   1 ACAGCTCGAATTAAGAATATGTTTCCTTGTTTATCAGATACATCACTGCTTGATGAAGCAAGGAAGATATACATGAAAAT
  81 TTTAAAAATACATATCGCTGACTTCATGGAATGGACATCCTGTATAAGCACTGAAAAACAACAACACAATAACACTAAAA
 161 TTTTAGGCACTCTTAAATGATCTGCCTCTAAAAGCGTTGGATGTAGCATTATGCAATTAGGTTTTTCCTTATTTGCTTCA
 241 TTGTACTACCTGTGTATATAGTTTTTACCTTTTATGTAGCACATAAACTTTGGGGAAGGGAGGGCAGGGTGGGGCTGAGG
 321 AACTGACGTGGAGCGGGGTATGAAGAGCTTGCTTTGATTTACAGCAAGTAGATAAATATTTGACTTGCATGAAGAGAAGC
 401 AATTTTGGGGAAGGGTTTGAATTGTTTTCTTTAAAGATGTAATGTCCCTTTCAGAGACAGCTGATACTTCATTTAAAAAA
 481 ATCACAAAAATTTGAACACTGGCTAAAGATAATTGCTATTTATTTTTACAAGAAGTTTATTCTCATTTGGGAGATCTGGT
 561 GATCTCCCAAGCTATCTAAAGTTTGTTAGATAGCTGCATGTGGCTTTTTTAAAAAAGCAACAGAAACCTATCCTCACTGC
 641 CCTCCCCAGTCTCTCTTAAAGTTGGAATTTACCAGTTAATTACTCAGCAGAATGGTGATCACTCCAGGTAGTTTGGGGCA
 721 AAAATCCGAGGTGCTTGGGAGTTTTGAATGTTAAGAATTGACCATCTGCTTTTATTAAATTTGTTGACAAAATTTTCTCA
 801 TTTTCTTTTCACTTCGGGCTGTGTAAACACAGTCAAAATAATTCTAAATCCCTCGATATTTTTAAAGATCTGTAAGTAAC
 881 TTCACATTAAAAAATGAAATATTTTTTAATTTAAAGCTTACTCTGTCCATTTATCCACAGGAAAGTGTTATTTTTCAAGG
 961 AAGGTTCATGTAGAGAAAAGCACACTTGTAGGATAAGTGAAATGGATACTACATCTTTAAACAGTATTTCATTGCCTGTG
1041 TATGGAAAAACCATTTGAAGTGTACCTGTGTACATAACTCTGTAAAAACACTGAAAAATTATACTAACTTATTTATGTTA
1121 AAAGATTTTTTTTAATCTAGACAATATACAAGCCAAAGTGGCATGTTTTGTGCATTTGTAAATGCTGTGTTGGGTAGAAT
1201 AGGTTTTCCCCTCTTTTGTTAAATAATATGGCTATGCTTAAAAGGTTGCATACTGAGCCAAGTATAATTTTTTGTAATGT
1281 GTGAAAAAGATGCCAATTATTGTTACACATTAAGTAATCAATAAAGAAAACTTCCATAGCTATT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ggguuguuGUACUUUGAUGGAu 5'
                  ||| : ||||||| 
Target 5' atttgcttCATTGTACTACCTg 3'
231 - 252 150.00 -11.20
2
miRNA  3' gggUUGUUGUACUU-UGAUGGAu 5'
             |:::| |||:| ||||| | 
Target 5' ataAGTGAAATGGATACTACATc 3'
993 - 1015 131.00 -8.52
3
miRNA  3' gggUUGUUGUACUUUGAUGGAu 5'
             ||||::||   |:|:||| 
Target 5' ttaAACAGTATTTCATTGCCTg 3'
1017 - 1038 131.00 -12.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196a-5p :: CDKN1B    [ Functional MTI ]
Validation Method Other
Article - le Sage, C. Nagel, R. Egan, D. A. Schrier, et al.
- EMBO J, 2007
MicroRNAs (miRNAs) are potent post-transcriptional regulators of protein coding genes. Patterns of misexpression of miRNAs in cancer suggest key functions of miRNAs in tumorigenesis. However, current bioinformatics tools do not entirely support the identification and characterization of the mode of action of such miRNAs. Here, we used a novel functional genetic approach and identified miR-221 and miR-222 (miR-221&222) as potent regulators of p27(Kip1), a cell cycle inhibitor and tumor suppressor. Using miRNA inhibitors, we demonstrate that certain cancer cell lines require high activity of miR-221&222 to maintain low p27(Kip1) levels and continuous proliferation. Interestingly, high levels of miR-221&222 appear in glioblastomas and correlate with low levels of p27(Kip1) protein. Thus, deregulated expression of miR-221&222 promotes cancerous growth by inhibiting the expression of p27(Kip1).
LinkOut: [PMID: 17627278]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196a-5p :: CDKN1B    [ Functional MTI ]
Validation Method
Article - Hafner, M. Landthaler, M. Burger, L. et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196a-5p :: CDKN1B    [ Functional MTI ]
Validation Method
Article - Sun, M. Liu, X. H. Li, J. H. Yang, J. S. et al.
- Mol Cancer Ther, 2012
Aberrant expression of miR-196a has been frequently reported in cancer studies. However, the expression and mechanism of its function in gastric cancer remains unclear. Quantitative real-time PCR was carried out to detect the relative expression of miR-196a in gastric cancer cell lines and tissues. SGC7901 cells were treated with miR-196a inhibitors, mimics, or pCDNA/miR-196a to investigate the role of miR-196a in cell proliferation. Higher expression of miR-196a in gastric cancer tissues was associated with tumor size, a higher clinical stage, and was also correlated with shorter overall survival of patients with gastric cancer. Exogenous downregulation of miR-196a expression significantly suppressed the in vitro cell-cycle progression, proliferation, and colony formation of gastric cancer cells, and ectopic miR-196a expression significantly enhanced the development of tumors in nude mice. Luciferase assays revealed that miR-196a inhibited p27(kip1) expression by targeting one binding site in the 3'-untranslated region (3'-UTR) of p27(kip1) mRNA. qPCR and Western blot assays verified that miR-196a reduced p27(kip1) expression at both mRNA and protein levels. The p27(kip1)-mediated repression in cell proliferation was reverted by exogenous miR-196a expression. A reverse correlation between miR-196a and p27(kip1) expression was noted in gastric cancer tissues. Our study shows that aberrant overexpression of miR-196a and consequent downregulation of p27(kip1) could contribute to gastric carcinogenesis and would be targets for gastric cancer therapies and further developed as potential prognostic factors.
LinkOut: [PMID: 22343731]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-196a-5p :: CDKN1B    [ Functional MTI ]
Validation Method
Article - Whisnant, A. W. Bogerd, H. P. Flores, O. et al.
- MBio, 2013
The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000228872.4 | 3UTR | UUUUUCCUUAUUUGCUUCAUUGUACUACCUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000228872.4 | 3UTR | UUUUCCUUAUUUGCUUCAUUGUACUACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
297 hsa-miR-196a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000218 BMP4 bone morphogenetic protein 4 1 1
MIRT000219 SPRR2C small proline-rich protein 2C (pseudogene) 3 2
MIRT000220 S100A9 S100 calcium binding protein A9 3 2
MIRT000221 KRT5 keratin 5 3 2
MIRT000709 ANXA1 annexin A1 4 1
MIRT002266 HOXB8 homeobox B8 5 7
MIRT002940 HOXA7 homeobox A7 4 5
MIRT002941 HOXD8 homeobox D8 3 3
MIRT002942 HOXC8 homeobox C8 5 12
MIRT004244 HOXB7 homeobox B7 4 1
MIRT004718 BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 5 2
MIRT004719 HMOX1 heme oxygenase (decycling) 1 4 1
MIRT005065 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 5 5
MIRT006802 HMGA1 high mobility group AT-hook 1 4 3
MIRT006803 HMGA2 high mobility group AT-hook 2 4 4
MIRT006906 HOXA5 homeobox A5 4 2
MIRT026026 IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 1 1
MIRT026027 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT026028 SRRT serrate RNA effector molecule homolog (Arabidopsis) 1 5
MIRT026029 DIEXF digestive organ expansion factor homolog (zebrafish) 1 1
MIRT026030 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT026031 NR4A1 nuclear receptor subfamily 4, group A, member 1 1 1
MIRT026032 ABT1 activator of basal transcription 1 1 1
MIRT026033 SPATA2 spermatogenesis associated 2 1 1
MIRT026034 NHLRC3 NHL repeat containing 3 1 1
MIRT026035 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT026036 CEP120 centrosomal protein 120kDa 1 1
MIRT026037 PHC3 polyhomeotic homolog 3 (Drosophila) 1 1
MIRT026038 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT026039 C9orf41 chromosome 9 open reading frame 41 1 1
MIRT026040 PNP purine nucleoside phosphorylase 1 1
MIRT026041 COPS3 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) 1 1
MIRT026042 NUP50 nucleoporin 50kDa 1 1
MIRT026043 ZNF763 zinc finger protein 763 1 1
MIRT026044 FOXJ3 forkhead box J3 1 1
MIRT026045 BIN3 bridging integrator 3 1 1
MIRT026046 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT026047 RAD9A RAD9 homolog A (S. pombe) 1 1
MIRT026048 PCGF3 polycomb group ring finger 3 1 1
MIRT026049 KATNAL1 katanin p60 subunit A-like 1 1 1
MIRT026050 SLC10A7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT026051 LBR lamin B receptor 1 1
MIRT026052 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT026053 GLMN glomulin, FKBP associated protein 1 1
MIRT026054 STK40 serine/threonine kinase 40 1 1
MIRT026055 TMEM135 transmembrane protein 135 1 1
MIRT026056 GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 1 2
MIRT026057 POLR2D polymerase (RNA) II (DNA directed) polypeptide D 1 3
MIRT026058 LGR4 leucine-rich repeat containing G protein-coupled receptor 4 1 1
MIRT026059 IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 1 2
MIRT026060 ESPL1 extra spindle pole bodies homolog 1 (S. cerevisiae) 1 1
MIRT026061 RFX5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT026062 SYT9 synaptotagmin IX 1 1
MIRT026063 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT026064 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT026065 SMCR7L Smith-Magenis syndrome chromosome region, candidate 7-like 1 4
MIRT026066 SLC30A6 solute carrier family 30 (zinc transporter), member 6 1 2
MIRT026067 RAB31 RAB31, member RAS oncogene family 1 1
MIRT026068 KPNA5 karyopherin alpha 5 (importin alpha 6) 1 1
MIRT026069 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 1 1
MIRT026070 TIMM23 translocase of inner mitochondrial membrane 23 homolog (yeast) 1 1
MIRT026071 IGDCC4 immunoglobulin superfamily, DCC subclass, member 4 1 3
MIRT026072 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT026073 CCNT2 cyclin T2 1 1
MIRT026074 CCND2 cyclin D2 1 1
MIRT026075 USP24 ubiquitin specific peptidase 24 1 1
MIRT026076 TRPC3 transient receptor potential cation channel, subfamily C, member 3 1 2
MIRT026077 SMC3 structural maintenance of chromosomes 3 1 1
MIRT026078 TMEM2 transmembrane protein 2 1 1
MIRT026079 RDH10 retinol dehydrogenase 10 (all-trans) 1 1
MIRT026080 C11orf57 chromosome 11 open reading frame 57 1 3
MIRT026081 FAM127A family with sequence similarity 127, member A 1 2
MIRT026082 PRUNE2 prune homolog 2 (Drosophila) 1 2
MIRT026083 SPRYD4 SPRY domain containing 4 1 1
MIRT026084 TMEM161B transmembrane protein 161B 1 1
MIRT026085 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT026086 FAM104A family with sequence similarity 104, member A 1 1
MIRT026087 RAB7L1 RAB7, member RAS oncogene family-like 1 1 1
MIRT026088 ITGAV integrin, alpha V 1 1
MIRT026089 CPD carboxypeptidase D 1 1
MIRT026090 ZNF354B zinc finger protein 354B 1 1
MIRT026091 TMEM194A transmembrane protein 194A 1 1
MIRT026092 EPHA7 EPH receptor A7 1 1
MIRT026093 KIAA1804 mixed lineage kinase 4 1 1
MIRT026094 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 1 1
MIRT026095 TSPAN12 tetraspanin 12 1 1
MIRT026096 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT026097 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT026098 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 1
MIRT026099 CCDC47 coiled-coil domain containing 47 1 1
MIRT026100 HAND1 heart and neural crest derivatives expressed 1 1 1
MIRT026101 LLGL1 lethal giant larvae homolog 1 (Drosophila) 1 1
MIRT048150 PGAM1 phosphoglycerate mutase 1 (brain) 1 1
MIRT048151 PSMC3 proteasome (prosome, macropain) 26S subunit, ATPase, 3 1 1
MIRT048152 TMX2 thioredoxin-related transmembrane protein 2 1 1
MIRT048153 KLHL7 kelch-like 7 (Drosophila) 1 1
MIRT048154 RFC2 replication factor C (activator 1) 2, 40kDa 1 1
MIRT048155 GLUL glutamate-ammonia ligase 1 1
MIRT048156 NRXN1 neurexin 1 1 1
MIRT048157 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT048158 HIST2H4B histone cluster 2, H4b 1 1
MIRT048159 SPEN spen homolog, transcriptional regulator (Drosophila) 1 1
MIRT048160 TAF15 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa 1 1
MIRT048161 SAP18 Sin3A-associated protein, 18kDa 1 1
MIRT048162 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 1
MIRT048163 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT048164 TSKU tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) 1 1
MIRT048165 KMT2C myeloid/lymphoid or mixed-lineage leukemia 3 1 1
MIRT048166 LYRM2 LYR motif containing 2 1 1
MIRT048167 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT048168 C19orf55 chromosome 19 open reading frame 55 1 1
MIRT048169 LRP2 low density lipoprotein receptor-related protein 2 1 1
MIRT048170 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT048171 NKX6-1 NK6 homeobox 1 1 1
MIRT048172 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT048173 RPS2 ribosomal protein S2 1 1
MIRT048174 RBMX RNA binding motif protein, X-linked 1 1
MIRT048175 ZFP64 zinc finger protein 64 homolog (mouse) 1 1
MIRT048176 REEP2 receptor accessory protein 2 1 1
MIRT048177 MED13 mediator complex subunit 13 1 1
MIRT048178 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048179 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT048180 DNTTIP2 deoxynucleotidyltransferase, terminal, interacting protein 2 1 1
MIRT048181 VDAC3 voltage-dependent anion channel 3 1 1
MIRT048182 ZNF529 zinc finger protein 529 1 1
MIRT048183 EWSR1 Ewing sarcoma breakpoint region 1 1 1
MIRT048184 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT048185 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048186 APP amyloid beta (A4) precursor protein 1 1
MIRT048187 PROSER1 proline and serine rich 1 1 1
MIRT048188 HIST1H2BB histone cluster 1, H2bb 1 1
MIRT048189 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT048190 TUBA1B tubulin, alpha 1b 1 1
MIRT048191 USP19 ubiquitin specific peptidase 19 1 1
MIRT048192 COX3 cytochrome c oxidase III 1 1
MIRT048193 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 1 1
MIRT048194 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT048195 MRPL35 mitochondrial ribosomal protein L35 1 1
MIRT048196 KCTD1 potassium channel tetramerisation domain containing 1 1 1
MIRT048197 UBE2C ubiquitin-conjugating enzyme E2C 1 1
MIRT048198 ZNF581 zinc finger protein 581 1 1
MIRT048199 CNOT11 chromosome 2 open reading frame 29 1 1
MIRT048200 POTEG POTE ankyrin domain family, member G 1 1
MIRT048201 MTRF1L mitochondrial translational release factor 1-like 1 1
MIRT048202 SRP9 signal recognition particle 9kDa 1 3
MIRT048203 BCORL1 BCL6 corepressor-like 1 1 1
MIRT048204 NRBP1 nuclear receptor binding protein 1 1 1
MIRT048205 LRRC41 leucine rich repeat containing 41 1 1
MIRT048206 ATP6 ATP synthase F0 subunit 6 1 1
MIRT048207 FKTN fukutin 1 1
MIRT048208 RANBP9 RAN binding protein 9 1 1
MIRT048209 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT048210 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT048211 ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 1 1
MIRT048212 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT048213 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT048214 HAUS6 HAUS augmin-like complex, subunit 6 1 1
MIRT048215 CKAP2L cytoskeleton associated protein 2-like 1 1
MIRT048216 IFNGR1 interferon gamma receptor 1 1 1
MIRT048217 ANXA7 annexin A7 1 1
MIRT048218 ENAH enabled homolog (Drosophila) 1 1
MIRT048219 FOXO1 forkhead box O1 4 2
MIRT048220 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT048221 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 1
MIRT048222 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT048223 SLC25A17 solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17 1 1
MIRT048224 ZNF398 zinc finger protein 398 1 1
MIRT048225 RASSF7 Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 1 1
MIRT048226 SBF1 SET binding factor 1 1 1
MIRT048227 TP53RK TP53 regulating kinase 1 1
MIRT048228 MED12 mediator complex subunit 12 1 1
MIRT048229 FLNA filamin A, alpha 1 1
MIRT048230 CCNE2 cyclin E2 1 1
MIRT048231 CANX calnexin 1 1
MIRT048232 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT048233 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT048234 KIF18B kinesin family member 18B 1 1
MIRT048235 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT048236 SH3GL3 SH3-domain GRB2-like 3 1 1
MIRT048237 VCP valosin containing protein 1 1
MIRT048238 ETV3 ets variant 3 1 1
MIRT048239 BCS1L BC1 (ubiquinol-cytochrome c reductase) synthesis-like 1 1
MIRT048240 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT048241 ZCCHC11 zinc finger, CCHC domain containing 11 1 1
MIRT048242 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT048243 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT048244 ACTB actin, beta 1 1
MIRT048245 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT048246 EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa 1 1
MIRT048247 GMFB glia maturation factor, beta 1 1
MIRT048248 PALLD palladin, cytoskeletal associated protein 1 1
MIRT048249 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT048250 VCL vinculin 1 1
MIRT048251 IPO5 importin 5 1 1
MIRT048252 PATL1 protein associated with topoisomerase II homolog 1 (yeast) 1 1
MIRT048253 NAP1L4 nucleosome assembly protein 1-like 4 1 1
MIRT048254 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT048255 TUBB tubulin, beta class I 1 1
MIRT048256 CCND1 cyclin D1 1 1
MIRT048257 GID8 GID complex subunit 8 homolog (S. cerevisiae) 1 1
MIRT048258 VDAC2 voltage-dependent anion channel 2 1 1
MIRT048259 SLC6A8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT048260 FXR2 fragile X mental retardation, autosomal homolog 2 1 1
MIRT048261 SCN11A sodium channel, voltage-gated, type XI, alpha subunit 1 1
MIRT048262 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 1 1
MIRT048263 ATG9A autophagy related 9A 1 1
MIRT048264 NOTCH2 notch 2 1 1
MIRT048265 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 1 1
MIRT048266 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT048267 OAT ornithine aminotransferase 1 1
MIRT048268 TRAP1 TNF receptor-associated protein 1 1 1
MIRT048269 SKI v-ski sarcoma viral oncogene homolog (avian) 1 1
MIRT048270 GLTP glycolipid transfer protein 1 1
MIRT048271 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT048272 LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT048273 GRIK4 glutamate receptor, ionotropic, kainate 4 1 1
MIRT048274 PDE6D phosphodiesterase 6D, cGMP-specific, rod, delta 1 1
MIRT048275 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT048276 SAR1B SAR1 homolog B (S. cerevisiae) 1 2
MIRT048277 MAP4 microtubule-associated protein 4 1 1
MIRT048278 RAB21 RAB21, member RAS oncogene family 1 1
MIRT048279 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 1 1
MIRT048280 OGFRL1 opioid growth factor receptor-like 1 1 1
MIRT048281 GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) 1 1
MIRT048282 NRDE2 NRDE-2, necessary for RNA interference, domain containing 1 1
MIRT048283 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT053067 NTN4 netrin 4 2 1
MIRT054025 RDX radixin 4 3
MIRT056750 ARID5B AT rich interactive domain 5B (MRF1-like) 1 1
MIRT057645 LCOR ligand dependent nuclear receptor corepressor 1 2
MIRT076226 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 3
MIRT083303 ZCCHC3 zinc finger, CCHC domain containing 3 1 1
MIRT095769 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 5
MIRT187720 SUOX sulfite oxidase 1 1
MIRT191923 CALM1 calmodulin 1 (phosphorylase kinase, delta) 1 1
MIRT205504 SP100 SP100 nuclear antigen 1 1
MIRT209857 ACVR2B activin A receptor, type IIB 1 1
MIRT229841 YIPF6 Yip1 domain family, member 6 1 1
MIRT230833 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT235376 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT251626 KCNJ2 potassium inwardly-rectifying channel, subfamily J, member 2 1 1
MIRT252333 SALL3 sal-like 3 (Drosophila) 1 1
MIRT255317 CDV3 CDV3 homolog (mouse) 1 1
MIRT324734 ACER2 alkaline ceramidase 2 1 1
MIRT386075 ZNF609 zinc finger protein 609 1 1
MIRT402060 ATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1 2
MIRT437422 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 3 1
MIRT437980 TYMS thymidylate synthetase 1 1
MIRT437981 NRP2 neuropilin 2 1 1
MIRT437982 LSP1 lymphocyte-specific protein 1 1 1
MIRT439104 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT447143 KIF27 kinesin family member 27 1 1
MIRT447559 C14orf37 chromosome 14 open reading frame 37 1 1
MIRT449961 FMNL3 formin-like 3 1 1
MIRT465087 TSPAN3 tetraspanin 3 1 1
MIRT470426 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT472726 MTUS1 microtubule associated tumor suppressor 1 1 3
MIRT473801 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT474507 KLHDC8B kelch domain containing 8B 1 1
MIRT474917 KCTD21 potassium channel tetramerisation domain containing 21 1 1
MIRT486549 DCTN4 dynactin 4 (p62) 1 1
MIRT492430 RGL2 ral guanine nucleotide dissociation stimulator-like 2 1 1
MIRT493925 FAM127B family with sequence similarity 127, member B 1 2
MIRT500972 SPTSSA serine palmitoyltransferase, small subunit A 1 1
MIRT501431 RAB11FIP4 RAB11 family interacting protein 4 (class II) 1 1
MIRT502410 GATA6 GATA binding protein 6 1 4
MIRT506368 NUP155 nucleoporin 155kDa 1 3
MIRT507497 E2F7 E2F transcription factor 7 1 3
MIRT520041 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 3
MIRT522366 NAP1L1 nucleosome assembly protein 1-like 1 1 2
MIRT531281 SLC7A7 solute carrier family 7 (amino acid transporter light chain, y+L system), member 7 1 1
MIRT543674 FAM135A family with sequence similarity 135, member A 1 1
MIRT545199 HIST1H2BD histone cluster 1, H2bd 1 1
MIRT546336 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT546452 SLC9A7 solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 1 1
MIRT546787 RCC2 regulator of chromosome condensation 2 1 2
MIRT547253 NXPE3 neurexophilin and PC-esterase domain family, member 3 1 1
MIRT547454 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT547581 LRIG3 leucine-rich repeats and immunoglobulin-like domains 3 1 2
MIRT547902 HOXA9 homeobox A9 1 2
MIRT549503 ABHD2 abhydrolase domain containing 2 1 1
MIRT549583 ZNF850 zinc finger protein 850 1 1
MIRT551888 MMS22L MMS22-like, DNA repair protein 1 1
MIRT552125 MED10 mediator complex subunit 10 1 1
MIRT554188 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT555552 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT556285 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT556980 HSPA4L heat shock 70kDa protein 4-like 1 1
MIRT559183 BRAP BRCA1 associated protein 1 1
MIRT561215 ZSWIM1 zinc finger, SWIM-type containing 1 1 1
MIRT562352 EXOC8 exocyst complex component 8 1 1
MIRT565603 SLC35G1 solute carrier family 35, member G1 1 1
MIRT575599 Gnl1 guanine nucleotide binding protein-like 1 1 1
MIRT610363 GNL1 guanine nucleotide binding protein-like 1 1 1
MIRT617860 FMO4 flavin containing monooxygenase 4 1 1
MIRT698193 TMEM66 transmembrane protein 66 1 1
MIRT704411 CTPS1 CTP synthase 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*