Accession ID: MIRT005066 [miRNA, hsa-miR-190a-5p :: CDKN1B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-190aLinkOut: [miRBase ]
Description Homo sapiens miR-190a stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-190a-5p
Mature Sequence 15| UGAUAUGUUUGAUAUAUUAGGU |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-190a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDKN4, KIP1, MEN1B, MEN4, P27KIP1
Description cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Transcript NM_0040    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1B
(miRNA target sites are highlighted)
>CDKN1B|NM_0040|3'UTR
   1 ACAGCTCGAATTAAGAATATGTTTCCTTGTTTATCAGATACATCACTGCTTGATGAAGCAAGGAAGATATACATGAAAAT
  81 TTTAAAAATACATATCGCTGACTTCATGGAATGGACATCCTGTATAAGCACTGAAAAACAACAACACAATAACACTAAAA
 161 TTTTAGGCACTCTTAAATGATCTGCCTCTAAAAGCGTTGGATGTAGCATTATGCAATTAGGTTTTTCCTTATTTGCTTCA
 241 TTGTACTACCTGTGTATATAGTTTTTACCTTTTATGTAGCACATAAACTTTGGGGAAGGGAGGGCAGGGTGGGGCTGAGG
 321 AACTGACGTGGAGCGGGGTATGAAGAGCTTGCTTTGATTTACAGCAAGTAGATAAATATTTGACTTGCATGAAGAGAAGC
 401 AATTTTGGGGAAGGGTTTGAATTGTTTTCTTTAAAGATGTAATGTCCCTTTCAGAGACAGCTGATACTTCATTTAAAAAA
 481 ATCACAAAAATTTGAACACTGGCTAAAGATAATTGCTATTTATTTTTACAAGAAGTTTATTCTCATTTGGGAGATCTGGT
 561 GATCTCCCAAGCTATCTAAAGTTTGTTAGATAGCTGCATGTGGCTTTTTTAAAAAAGCAACAGAAACCTATCCTCACTGC
 641 CCTCCCCAGTCTCTCTTAAAGTTGGAATTTACCAGTTAATTACTCAGCAGAATGGTGATCACTCCAGGTAGTTTGGGGCA
 721 AAAATCCGAGGTGCTTGGGAGTTTTGAATGTTAAGAATTGACCATCTGCTTTTATTAAATTTGTTGACAAAATTTTCTCA
 801 TTTTCTTTTCACTTCGGGCTGTGTAAACACAGTCAAAATAATTCTAAATCCCTCGATATTTTTAAAGATCTGTAAGTAAC
 881 TTCACATTAAAAAATGAAATATTTTTTAATTTAAAGCTTACTCTGTCCATTTATCCACAGGAAAGTGTTATTTTTCAAGG
 961 AAGGTTCATGTAGAGAAAAGCACACTTGTAGGATAAGTGAAATGGATACTACATCTTTAAACAGTATTTCATTGCCTGTG
1041 TATGGAAAAACCATTTGAAGTGTACCTGTGTACATAACTCTGTAAAAACACTGAAAAATTATACTAACTTATTTATGTTA
1121 AAAGATTTTTTTTAATCTAGACAATATACAAGCCAAAGTGGCATGTTTTGTGCATTTGTAAATGCTGTGTTGGGTAGAAT
1201 AGGTTTTCCCCTCTTTTGTTAAATAATATGGCTATGCTTAAAAGGTTGCATACTGAGCCAAGTATAATTTTTTGTAATGT
1281 GTGAAAAAGATGCCAATTATTGTTACACATTAAGTAATCAATAAAGAAAACTTCCATAGCTATT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uggaUUAUAUAGUU----UGUAUAGu 5'
              || || |:||    ||||||| 
Target 5' catgAAAATTTTAAAAATACATATCg 3'
72 - 97 156.00 -7.30
2
miRNA  3' ugGAUUAUAUAGUUUGUAUAGu 5'
            || :| |||||:|:| ||| 
Target 5' tcCTTGTTTATCAGATACATCa 3'
24 - 45 128.00 -14.40
3
miRNA  3' ugGAUUAUAUAGUUUGUAUagu 5'
            ||  |||:| : |||||   
Target 5' acCTTTTATGTAGCACATAaac 3'
267 - 288 120.00 -9.52
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-190a-5p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... {This NonMTI is shown in Fig. 2A} ...

- le Sage, C. Nagel, R. Egan, D. A. Schrier, et al., 2007, EMBO J.

Article - le Sage, C. Nagel, R. Egan, D. A. Schrier, et al.
- EMBO J, 2007
MicroRNAs (miRNAs) are potent post-transcriptional regulators of protein coding genes. Patterns of misexpression of miRNAs in cancer suggest key functions of miRNAs in tumorigenesis. However, current bioinformatics tools do not entirely support the identification and characterization of the mode of action of such miRNAs. Here, we used a novel functional genetic approach and identified miR-221 and miR-222 (miR-221&222) as potent regulators of p27(Kip1), a cell cycle inhibitor and tumor suppressor. Using miRNA inhibitors, we demonstrate that certain cancer cell lines require high activity of miR-221&222 to maintain low p27(Kip1) levels and continuous proliferation. Interestingly, high levels of miR-221&222 appear in glioblastomas and correlate with low levels of p27(Kip1) protein. Thus, deregulated expression of miR-221&222 promotes cancerous growth by inhibiting the expression of p27(Kip1).
LinkOut: [PMID: 17627278]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
3 hsa-miR-190a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005066 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 2 1
MIRT021081 VEGFA vascular endothelial growth factor A 1 1
MIRT021082 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 2 1