Accession ID: MIRT005066 [miRNA, hsa-miR-190a-5p :: CDKN1B, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-190aLinkOut: [miRBase ]
Description Homo sapiens miR-190a stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-190a-5p
Mature Sequence 15| UGAUAUGUUUGAUAUAUUAGGU |36
Evidence Experimental
Experiments Cloned
Putative hsa-miR-190a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol CDKN1B LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CDKN4, KIP1, MEN1B, MEN4, P27KIP1
Description cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Transcript NM_004064    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on CDKN1B LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of CDKN1B
(miRNA target sites are highlighted)
>CDKN1B|NM_004064|3'UTR
   1 ACAGCTCGAATTAAGAATATGTTTCCTTGTTTATCAGATACATCACTGCTTGATGAAGCAAGGAAGATATACATGAAAAT
  81 TTTAAAAATACATATCGCTGACTTCATGGAATGGACATCCTGTATAAGCACTGAAAAACAACAACACAATAACACTAAAA
 161 TTTTAGGCACTCTTAAATGATCTGCCTCTAAAAGCGTTGGATGTAGCATTATGCAATTAGGTTTTTCCTTATTTGCTTCA
 241 TTGTACTACCTGTGTATATAGTTTTTACCTTTTATGTAGCACATAAACTTTGGGGAAGGGAGGGCAGGGTGGGGCTGAGG
 321 AACTGACGTGGAGCGGGGTATGAAGAGCTTGCTTTGATTTACAGCAAGTAGATAAATATTTGACTTGCATGAAGAGAAGC
 401 AATTTTGGGGAAGGGTTTGAATTGTTTTCTTTAAAGATGTAATGTCCCTTTCAGAGACAGCTGATACTTCATTTAAAAAA
 481 ATCACAAAAATTTGAACACTGGCTAAAGATAATTGCTATTTATTTTTACAAGAAGTTTATTCTCATTTGGGAGATCTGGT
 561 GATCTCCCAAGCTATCTAAAGTTTGTTAGATAGCTGCATGTGGCTTTTTTAAAAAAGCAACAGAAACCTATCCTCACTGC
 641 CCTCCCCAGTCTCTCTTAAAGTTGGAATTTACCAGTTAATTACTCAGCAGAATGGTGATCACTCCAGGTAGTTTGGGGCA
 721 AAAATCCGAGGTGCTTGGGAGTTTTGAATGTTAAGAATTGACCATCTGCTTTTATTAAATTTGTTGACAAAATTTTCTCA
 801 TTTTCTTTTCACTTCGGGCTGTGTAAACACAGTCAAAATAATTCTAAATCCCTCGATATTTTTAAAGATCTGTAAGTAAC
 881 TTCACATTAAAAAATGAAATATTTTTTAATTTAAAGCTTACTCTGTCCATTTATCCACAGGAAAGTGTTATTTTTCAAGG
 961 AAGGTTCATGTAGAGAAAAGCACACTTGTAGGATAAGTGAAATGGATACTACATCTTTAAACAGTATTTCATTGCCTGTG
1041 TATGGAAAAACCATTTGAAGTGTACCTGTGTACATAACTCTGTAAAAACACTGAAAAATTATACTAACTTATTTATGTTA
1121 AAAGATTTTTTTTAATCTAGACAATATACAAGCCAAAGTGGCATGTTTTGTGCATTTGTAAATGCTGTGTTGGGTAGAAT
1201 AGGTTTTCCCCTCTTTTGTTAAATAATATGGCTATGCTTAAAAGGTTGCATACTGAGCCAAGTATAATTTTTTGTAATGT
1281 GTGAAAAAGATGCCAATTATTGTTACACATTAAGTAATCAATAAAGAAAACTTCCATAGCTATT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uggaUUAUAUAGUU----UGUAUAGu 5'
              || || |:||    ||||||| 
Target 5' catgAAAATTTTAAAAATACATATCg 3'
72 - 97 156.00 -7.30
2
miRNA  3' ugGAUUAUAUAGUUUGUAUAGu 5'
            || :| |||||:|:| ||| 
Target 5' tcCTTGTTTATCAGATACATCa 3'
24 - 45 128.00 -14.40
3
miRNA  3' ugGAUUAUAUAGUUUGUAUagu 5'
            ||  |||:| : |||||   
Target 5' acCTTTTATGTAGCACATAaac 3'
267 - 288 120.00 -9.52
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-190a-5p :: CDKN1B    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HeLa
Location of target site 3'UTR
Original Description (Extracted from the article) ... {This NonMTI is shown in Fig. 2A} ...

- le Sage, C. Nagel, R. Egan, D. A. Schrier, et al., 2007, EMBO J.

Article - le Sage, C. Nagel, R. Egan, D. A. Schrier, et al.
- EMBO J, 2007
MicroRNAs (miRNAs) are potent post-transcriptional regulators of protein coding genes. Patterns of misexpression of miRNAs in cancer suggest key functions of miRNAs in tumorigenesis. However, current bioinformatics tools do not entirely support the identification and characterization of the mode of action of such miRNAs. Here, we used a novel functional genetic approach and identified miR-221 and miR-222 (miR-221&222) as potent regulators of p27(Kip1), a cell cycle inhibitor and tumor suppressor. Using miRNA inhibitors, we demonstrate that certain cancer cell lines require high activity of miR-221&222 to maintain low p27(Kip1) levels and continuous proliferation. Interestingly, high levels of miR-221&222 appear in glioblastomas and correlate with low levels of p27(Kip1) protein. Thus, deregulated expression of miR-221&222 promotes cancerous growth by inhibiting the expression of p27(Kip1).
LinkOut: [PMID: 17627278]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
60 hsa-miR-190a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005066 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 2 1
MIRT021081 VEGFA vascular endothelial growth factor A 1 1
MIRT021082 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 2
MIRT054652 KCNQ5 potassium voltage-gated channel, KQT-like subfamily, member 5 2 1
MIRT066965 ATXN7L3B ataxin 7-like 3B 1 1
MIRT192448 SPRED1 sprouty-related, EVH1 domain containing 1 1 1
MIRT250412 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT306292 KLHL24 kelch-like 24 (Drosophila) 1 1
MIRT355844 SGMS2 sphingomyelin synthase 2 1 2
MIRT437446 MARK2 MAP/microtubule affinity-regulating kinase 2 3 1
MIRT438368 IGF1 insulin-like growth factor 1 (somatomedin C) 2 1
MIRT444673 CDKL2 cyclin-dependent kinase-like 2 (CDC2-related kinase) 1 1
MIRT446390 PCDHB11 protocadherin beta 11 1 1
MIRT446636 SDC3 syndecan 3 1 1
MIRT449411 TRIM5 tripartite motif containing 5 1 1
MIRT449561 GPC5 glypican 5 1 1
MIRT469929 PTPRJ protein tyrosine phosphatase, receptor type, J 1 3
MIRT473737 MAP3K9 mitogen-activated protein kinase kinase kinase 9 1 1
MIRT474211 LDHA lactate dehydrogenase A 1 1
MIRT474584 KLF6 Kruppel-like factor 6 1 1
MIRT476733 FOXN2 forkhead box N2 1 1
MIRT478457 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 1 1
MIRT495328 ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif, 8 1 2
MIRT498616 MTRNR2L10 MT-RNR2-like 10 1 6
MIRT501735 OVOL1 ovo-like 1(Drosophila) 1 1
MIRT501850 MTRNR2L8 MT-RNR2-like 8 1 7
MIRT504679 CYGB cytoglobin 1 2
MIRT506518 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 3
MIRT507985 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 2
MIRT508445 ZNF608 zinc finger protein 608 1 2
MIRT511367 IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) 1 2
MIRT520516 TRA2B transformer 2 beta homolog (Drosophila) 1 1
MIRT524570 CALML4 calmodulin-like 4 1 2
MIRT531897 INVS inversin 1 2
MIRT533917 TATDN2 TatD DNase domain containing 2 1 1
MIRT537504 FAM13B family with sequence similarity 13, member B 1 1
MIRT541690 CCDC160 coiled-coil domain containing 160 1 4
MIRT544420 ZNF460 zinc finger protein 460 1 2
MIRT544616 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT545077 IL7R interleukin 7 receptor 1 1
MIRT545850 ZNF264 zinc finger protein 264 1 2
MIRT547435 MED4 mediator complex subunit 4 1 1
MIRT550158 ZNF223 zinc finger protein 223 1 2
MIRT553949 STAMBP STAM binding protein 1 1
MIRT554396 SERP1 stress-associated endoplasmic reticulum protein 1 1 1
MIRT555668 PGAM4 phosphoglycerate mutase family member 4 1 2
MIRT564195 PM20D2 peptidase M20 domain containing 2 1 1
MIRT566791 MKL2 MKL/myocardin-like 2 1 1
MIRT566844 LRRC58 leucine rich repeat containing 58 1 1
MIRT572515 KIAA0232 KIAA0232 1 1
MIRT607429 NOTCH2NL notch 2 N-terminal like 1 5
MIRT627780 RAB30 RAB30, member RAS oncogene family 1 1
MIRT635160 ENO4 enolase family member 4 1 1
MIRT642160 ADCYAP1R1 adenylate cyclase activating polypeptide 1 (pituitary) receptor type I 1 1
MIRT646206 DUSP10 dual specificity phosphatase 10 1 1
MIRT657008 KCNMB4 potassium large conductance calcium-activated channel, subfamily M, beta member 4 1 1
MIRT665818 TMEM161B transmembrane protein 161B 1 1
MIRT667489 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT707099 ZNF850 zinc finger protein 850 1 1
MIRT708720 PTPLAD2 protein tyrosine phosphatase-like A domain containing 2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*