Accession ID: MIRT005125 [miRNA, hsa-miR-30a-5p :: IDH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30aLinkOut: [miRBase ]
Description Homo sapiens miR-30a stem-loop
Comment The mature sequences miR-30 . Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736; mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30a-5p
Mature Sequence 6| UGUAAACAUCCUCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Expression Profile
Putative hsa-miR-30a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IDH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms IDCD, IDH, IDP, IDPC, PICD
Description isocitrate dehydrogenase 1 (NADP+), soluble
Transcript NM_0058    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IDH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IDH1
(miRNA target sites are highlighted)
>IDH1|NM_0058|3'UTR
   1 TAAGTTCATACCTGAGCTAAGAAGGATAATTGTCTTTTGGTAACTAGGTCTACAGGTTTACATTTTTCTGTGTTACACTC
  81 AAGGATAAAGGCAAAATCAATTTTGTAATTTGTTTAGAAGCCAGAGTTTATCTTTTCTATAAGTTTACAGCCTTTTTCTT
 161 ATATATACAGTTATTGCCACCTTTGTGAACATGGCAAGGGACTTTTTTACAATTTTTATTTTATTTTCTAGTACCAGCCT
 241 AGGAATTCGGTTAGTACTCATTTGTATTCACTGTCACTTTTTCTCATGTTCTAATTATAAATGACCAAAATCAAGATTGC
 321 TCAAAAGGGTAAATGATAGCCACAGTATTGCTCCCTAAAATATGCATAAAGTAGAAATTCACTGCCTTCCCCTCCTGTCC
 401 ATGACCTTGGGCACAGGGAAGTTCTGGTGTCATAGATATCCCGTTTTGTGAGGTAGAGCTGTGCATTAAACTTGCACATG
 481 ACTGGAACGAAGTATGAGTGCAACTCAAATGTGTTGAAGATACTGCAGTCATTTTTGTAAAGACCTTGCTGAATGTTTCC
 561 AATAGACTAAATACTGTTTAGGCCGCAGGAGAGTTTGGAATCCGGAATAAATACTACCTGGAGGTTTGTCCTCTCCATTT
 641 TTCTCTTTCTCCTCCTGGCCTGGCCTGAATATTATACTACTCTAAATAGCATATTTCATCCAAGTGCAATAATGTAAGCT
 721 GAATCTTTTTTGGACTTCTGCTGGCCTGTTTTATTTCTTTTATATAAATGTGATTTCTCAGAAATTGATATTAAACACTA
 801 TCTTATCTTCTCCTGAACTGTTGATTTTAATTAAAATTAAGTGCTAATTACCAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaAGGUCAGCUCCU-----ACAAAUgu 5'
            |||| | ||  |     ||||||  
Target 5' ttTCCAATAGACTAAATACTGTTTAgg 3'
556 - 582 132.00 -5.39
2
miRNA  3' gaaGGU-CAGCUCCUACAAAUGu 5'
             |:| ||| |  | |||||| 
Target 5' taaCTAGGTCTA-CAGGTTTACa 3'
41 - 62 122.00 -10.49
3
miRNA  3' gaaggucagcuccuaCAAAUGu 5'
                         |||||| 
Target 5' ttatcttttctataaGTTTACa 3'
128 - 149 120.00 -7.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30a-5p :: IDH1    [ Functional MTI ]
Validation Method pSILAC , Proteomics;Other
Conditions HeLa
Original Description (Extracted from the article) ... Provided by pSILAC database (http://psilac.mdc-berlin.de/) ...

- Selbach, M. Schwanhausser, B. Thierfelder, et al., 2008, Nature.

Article - Selbach, M. Schwanhausser, B. Thierfelder, et al.
- Nature, 2008
Animal microRNAs (miRNAs) regulate gene expression by inhibiting translation and/or by inducing degradation of target messenger RNAs. It is unknown how much translational control is exerted by miRNAs on a genome-wide scale. We used a new proteomic approach to measure changes in synthesis of several thousand proteins in response to miRNA transfection or endogenous miRNA knockdown. In parallel, we quantified mRNA levels using microarrays. Here we show that a single miRNA can repress the production of hundreds of proteins, but that this repression is typically relatively mild. A number of known features of the miRNA-binding site such as the seed sequence also govern repression of human protein synthesis, and we report additional target sequence characteristics. We demonstrate that, in addition to downregulating mRNA levels, miRNAs also directly repress translation of hundreds of genes. Finally, our data suggest that a miRNA can, by direct or indirect effects, tune protein synthesis from thousands of genes.
LinkOut: [PMID: 18668040]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
445 hsa-miR-30a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001946 BDNF brain-derived neurotrophic factor 2 1
MIRT002876 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 3 1
MIRT004509 BECN1 beclin 1, autophagy related 2 1
MIRT004785 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT005120 HNRNPM heterogeneous nuclear ribonucleoprotein M 2 1
MIRT005121 ELMOD2 ELMO/CED-12 domain containing 2 2 1
MIRT005122 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 2 1
MIRT005123 ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 2 1
MIRT005124 TMEM87A transmembrane protein 87A 2 1
MIRT005125 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 2 1
MIRT005126 SEC62 SEC62 homolog (S. cerevisiae) 2 1
MIRT005127 CHD1 chromodomain helicase DNA binding protein 1 2 1
MIRT005128 JUN jun oncogene 2 1
MIRT005129 SLC4A10 solute carrier family 4, sodium bicarbonate transporter, member 10 2 1
MIRT005130 NT5E 5'-nucleotidase, ecto (CD73) 2 1
MIRT005131 LMNB2 lamin B2 2 1
MIRT005132 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 2 1
MIRT005133 TMEM41B transmembrane protein 41B 2 1
MIRT005134 CPNE8 copine VIII 2 1
MIRT005135 MBNL1 muscleblind-like (Drosophila) 2 1
MIRT005136 KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 2 1
MIRT005137 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 2 1
MIRT005138 TMEM59 transmembrane protein 59 2 1
MIRT005139 TMED10 transmembrane emp24-like trafficking protein 10 (yeast) 2 1
MIRT005140 TMED3 transmembrane emp24 protein transport domain containing 3 2 1
MIRT005141 SLC38A1 solute carrier family 38, member 1 2 1
MIRT005142 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 2 1
MIRT005143 IFRD1 interferon-related developmental regulator 1 2 1
MIRT005144 PEX11B peroxisomal biogenesis factor 11 beta 2 1
MIRT005145 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 2 1
MIRT005146 SLC9A3R2 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2 2 1
MIRT005147 GPD2 glycerol-3-phosphate dehydrogenase 2 (mitochondrial) 2 1
MIRT005148 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 2 1
MIRT005149 PTGFRN prostaglandin F2 receptor negative regulator 2 1
MIRT005150 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 2 1
MIRT005151 NCEH1 neutral cholesterol ester hydrolase 1 2 1
MIRT005152 SEC23A Sec23 homolog A (S. cerevisiae) 2 1
MIRT005153 PBRM1 polybromo 1 2 1
MIRT005154 MLLT11 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 2 1
MIRT005155 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 2 1
MIRT005156 DPY19L1 dpy-19-like 1 (C. elegans) 2 1
MIRT005157 C1D C1D nuclear receptor corepressor 2 1
MIRT005158 LTN1 ring finger protein 160 2 1
MIRT005159 NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 2 1
MIRT005160 SLC38A2 solute carrier family 38, member 2 2 1
MIRT005161 PTPRK protein tyrosine phosphatase, receptor type, K 2 1
MIRT005162 WNT5A wingless-type MMTV integration site family, member 5A 2 1
MIRT005163 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 2 1
MIRT005164 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 2 1
MIRT005165 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 2 1
MIRT005166 STMN1 stathmin 1 2 1
MIRT005167 MET met proto-oncogene (hepatocyte growth factor receptor) 2 1
MIRT005168 P4HA2 prolyl 4-hydroxylase, alpha polypeptide II 2 1
MIRT005169 LRRC8C leucine rich repeat containing 8 family, member C 2 1
MIRT005170 MPDU1 mannose-P-dolichol utilization defect 1 2 1
MIRT005171 THEM4 thioesterase superfamily member 4 2 1
MIRT005172 RAD23B RAD23 homolog B (S. cerevisiae) 2 1
MIRT005173 CNPY4 canopy 4 homolog (zebrafish) 2 1
MIRT005174 KRT85 keratin 85 2 1
MIRT005175 PGM1 phosphoglucomutase 1 2 1
MIRT005176 SLC12A4 solute carrier family 12 (potassium/chloride transporters), member 4 2 1
MIRT005177 PTRH1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) 2 1
MIRT005178 CDCP1 CUB domain containing protein 1 2 1
MIRT005179 ADPGK ADP-dependent glucokinase 2 1
MIRT005180 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 2 1
MIRT005181 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 2 1
MIRT005182 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 2 1
MIRT005183 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 2 1
MIRT005184 NT5C3 5'-nucleotidase, cytosolic III 2 1
MIRT005185 TMCO1 transmembrane and coiled-coil domains 1 2 1
MIRT005186 TMED7 transmembrane emp24 protein transport domain containing 7 2 1
MIRT005187 TMED2 transmembrane emp24 domain trafficking protein 2 2 1
MIRT005188 PPP2R4 protein phosphatase 2A activator, regulatory subunit 4 2 1
MIRT005189 CEP72 centrosomal protein 72kDa 2 1
MIRT005190 MTX3 metaxin 3 2 1
MIRT005191 STRN striatin, calmodulin binding protein 2 1
MIRT005192 SEC11C SEC11 homolog C (S. cerevisiae) 2 1
MIRT005193 RRP36 chromosome 6 open reading frame 153 2 1
MIRT005194 RBMS1 RNA binding motif, single stranded interacting protein 1 2 1
MIRT005195 TBCB tubulin folding cofactor B 2 1
MIRT005196 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 2 1
MIRT005197 RAB27B RAB27B, member RAS oncogene family 2 1
MIRT005198 PPP3CA protein phosphatase 3, catalytic subunit, alpha isozyme 2 1
MIRT005199 STX7 syntaxin 7 2 1
MIRT005200 UAP1 UDP-N-acteylglucosamine pyrophosphorylase 1 2 1
MIRT005201 LIMCH1 LIM and calponin homology domains 1 2 1
MIRT005202 DOCK7 dedicator of cytokinesis 7 2 1
MIRT005203 SYPL1 synaptophysin-like 1 2 1
MIRT005204 NCL nucleolin 2 1
MIRT005205 NUCB1 nucleobindin 1 2 1
MIRT005206 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 2 1
MIRT005207 FXR2 fragile X mental retardation, autosomal homolog 2 2 1
MIRT005208 C5orf15 chromosome 5 open reading frame 15 2 1
MIRT005209 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 2 1
MIRT005210 PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) 2 1
MIRT005211 ANPEP alanyl (membrane) aminopeptidase 2 1
MIRT005212 MYO10 myosin X 2 1
MIRT005213 MAT2A methionine adenosyltransferase II, alpha 2 1
MIRT005214 CTSL1 cathepsin L1 2 1
MIRT005215 FRG1 FSHD region gene 1 2 1
MIRT005216 WDR82 WD repeat domain 82 2 1
MIRT005217 CBFB core-binding factor, beta subunit 2 1
MIRT006319 SMAD1 SMAD family member 1 2 1
MIRT006563 DTL denticleless homolog (Drosophila) 3 1
MIRT006606 Snai1 snail homolog 1 (Drosophila) 2 1
MIRT006760 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT007097 PIK3CD phosphoinositide-3-kinase, catalytic, delta polypeptide 3 1
MIRT007218 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT007238 SEPT7 septin 7 1 1
MIRT007276 AVEN apoptosis, caspase activation inhibitor 1 1
MIRT007277 FOXD1 forkhead box D1 1 1
MIRT007296 TUBB4B tubulin, beta 2C 1 1
MIRT007297 NEUROD1 neurogenic differentiation 1 1 1
MIRT007359 ABL1 c-abl oncogene 1, receptor tyrosine kinase 2 1
MIRT028389 CD44 CD44 molecule (Indian blood group) 1 1
MIRT028390 CDC123 cell division cycle 123 homolog (S. cerevisiae) 1 1
MIRT028391 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family) 1 1
MIRT028392 SARS seryl-tRNA synthetase 1 1
MIRT028393 RAB34 RAB34, member RAS oncogene family 1 1
MIRT028394 DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 1 1
MIRT028395 PPID peptidylprolyl isomerase D 1 1
MIRT028396 SEC11A SEC11 homolog A (S. cerevisiae) 1 1
MIRT028397 UTP11L UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) 1 1
MIRT028398 MOSPD2 motile sperm domain containing 2 1 1
MIRT028399 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT028400 KIF5B kinesin family member 5B 1 1
MIRT028401 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT028402 YBX3 cold shock domain protein A 1 1
MIRT028403 NDEL1 nudE nuclear distribution gene E homolog (A. nidulans)-like 1 1 1
MIRT028404 UBE2H ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) 1 1
MIRT028405 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 1 1
MIRT028406 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 1 1
MIRT028407 TOM1 target of myb1 (chicken) 1 1
MIRT028408 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 1 1
MIRT028409 SOD2 superoxide dismutase 2, mitochondrial 1 1
MIRT028410 ESRRA estrogen-related receptor alpha 1 1
MIRT028411 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT028412 SCAF1 SR-related CTD-associated factor 1 1 1
MIRT028413 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT028414 MPP2 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) 1 1
MIRT028415 SMN2 survival of motor neuron 2, centromeric 1 1
MIRT028416 EFTUD1 elongation factor Tu GTP binding domain containing 1 1 1
MIRT028417 KRT7 keratin 7 1 1
MIRT028418 PHLDA2 pleckstrin homology-like domain, family A, member 2 1 1
MIRT028419 RHOF ras homolog gene family, member F (in filopodia) 1 1
MIRT028420 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT028421 ARF6 ADP-ribosylation factor 6 1 1
MIRT028422 OGFOD1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT028423 DNAJA4 DnaJ (Hsp40) homolog, subfamily A, member 4 1 1
MIRT028424 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT028425 NXT1 NTF2-like export factor 1 1 1
MIRT028426 SCYL1 SCY1-like 1 (S. cerevisiae) 1 1
MIRT028427 HK1 hexokinase 1 1 1
MIRT028428 PCNT pericentrin 1 1
MIRT028429 TRRAP transformation/transcription domain-associated protein 1 1
MIRT028430 AK1 adenylate kinase 1 1 1
MIRT028431 TGFBI transforming growth factor, beta-induced, 68kDa 1 1
MIRT028432 PDLIM7 PDZ and LIM domain 7 (enigma) 1 1
MIRT028433 C16orf62 chromosome 16 open reading frame 62 1 1
MIRT028434 CIRBP cold inducible RNA binding protein 1 1
MIRT028435 EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa 1 1
MIRT028436 GNG5 guanine nucleotide binding protein (G protein), gamma 5 1 1
MIRT028437 HEATR2 HEAT repeat containing 2 1 1
MIRT028438 TLDC1 KIAA1609 1 1
MIRT028439 TNPO3 transportin 3 1 1
MIRT028440 MGST2 microsomal glutathione S-transferase 2 1 1
MIRT028441 JUP junction plakoglobin 1 1
MIRT028442 DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 1 1
MIRT028443 CPSF3 cleavage and polyadenylation specific factor 3, 73kDa 1 1
MIRT028444 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT028445 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT028446 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 1 1
MIRT028447 SDCBP syndecan binding protein (syntenin) 1 1
MIRT028448 SEC24B SEC24 family, member B (S. cerevisiae) 1 1
MIRT028449 LSM12 LSM12 homolog (S. cerevisiae) 1 1
MIRT028450 CAST calpastatin 1 1
MIRT028451 FDX1 ferredoxin 1 1 1
MIRT028452 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT028453 NOL8 nucleolar protein 8 1 1
MIRT028454 TMEM192 transmembrane protein 192 1 1
MIRT028455 DYNC1LI1 dynein, cytoplasmic 1, light intermediate chain 1 2 2
MIRT028456 RETSAT retinol saturase (all-trans-retinol 13,14-reductase) 1 1
MIRT028457 BCL2L1 BCL2-like 1 1 1
MIRT028458 NCKAP1 NCK-associated protein 1 1 1
MIRT028459 LDLR low density lipoprotein receptor 1 1
MIRT028460 REEP5 receptor accessory protein 5 1 1
MIRT028461 CPOX coproporphyrinogen oxidase 1 1
MIRT028462 ATP6V1C1 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 1 1
MIRT028463 GLIPR1 GLI pathogenesis-related 1 1 1
MIRT028464 DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 1 1
MIRT028465 CCPG1 cell cycle progression 1 1 1
MIRT028466 MARCH5 membrane-associated ring finger (C3HC4) 5 1 1
MIRT028467 RND3 Rho family GTPase 3 1 1
MIRT028468 DERL1 Der1-like domain family, member 1 1 1
MIRT028469 RAB14 RAB14, member RAS oncogene family 1 1
MIRT028470 ACP2 acid phosphatase 2, lysosomal 1 1
MIRT028471 OSBPL8 oxysterol binding protein-like 8 1 1
MIRT028472 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT028473 RRM2 ribonucleotide reductase M2 1 1
MIRT028474 ITGA6 integrin, alpha 6 1 1
MIRT028475 DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT028476 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT028477 RHOB ras homolog gene family, member B 1 1
MIRT028478 MTDH metadherin 1 1
MIRT028479 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 1 1
MIRT028480 MAN2B1 mannosidase, alpha, class 2B, member 1 1 1
MIRT028481 GRPEL2 GrpE-like 2, mitochondrial (E. coli) 1 1
MIRT028482 TUBB3 tubulin, beta 3 1 1
MIRT028483 TM9SF1 transmembrane 9 superfamily member 1 1 1
MIRT028484 USP5 ubiquitin specific peptidase 5 (isopeptidase T) 1 1
MIRT028485 KRT77 keratin 77 1 1
MIRT028486 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 1 1
MIRT028487 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT028488 SON SON DNA binding protein 1 1
MIRT028489 GPRC5A G protein-coupled receptor, family C, group 5, member A 1 1
MIRT028490 GTF2H2C general transcription factor IIH, polypeptide 2C 1 1
MIRT028491 GLRX glutaredoxin (thioltransferase) 1 1
MIRT028492 SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 1 1
MIRT028493 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT028494 SUCLA2 succinate-CoA ligase, ADP-forming, beta subunit 1 1
MIRT028495 KPNA1 karyopherin alpha 1 (importin alpha 5) 1 1
MIRT028496 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT028497 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT028498 GNG2 guanine nucleotide binding protein (G protein), gamma 2 1 1
MIRT028499 KRT6B keratin 6B 1 1
MIRT028500 RRP15 ribosomal RNA processing 15 homolog (S. cerevisiae) 1 1
MIRT028501 PPOX protoporphyrinogen oxidase 1 1
MIRT028502 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT028503 DHX8 DEAH (Asp-Glu-Ala-His) box polypeptide 8 1 1
MIRT028504 RPRD1B regulation of nuclear pre-mRNA domain containing 1B 1 1
MIRT028505 GTF2H2 general transcription factor IIH, polypeptide 2, 44kDa 1 1
MIRT028506 PRIM1 primase, DNA, polypeptide 1 (49kDa) 1 1
MIRT028507 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT028508 NT5C1B 5'-nucleotidase, cytosolic IB 1 1
MIRT028509 SLC12A2 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 1 1
MIRT028510 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT028511 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT028512 PRMT1 protein arginine methyltransferase 1 1 1
MIRT028513 MAK16 MAK16 homolog (S. cerevisiae) 1 1
MIRT028514 TRIO triple functional domain (PTPRF interacting) 1 1
MIRT028515 YRDC yrdC domain containing (E. coli) 1 1
MIRT028516 TICAM2 toll-like receptor adaptor molecule 2 1 1
MIRT028517 NFU1 NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) 1 1
MIRT028518 CDC20 cell division cycle 20 homolog (S. cerevisiae) 1 1
MIRT028519 MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein 1 1
MIRT028520 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT028521 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT028522 HINT3 histidine triad nucleotide binding protein 3 1 1
MIRT028523 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT028524 RBMS3 RNA binding motif, single stranded interacting protein 3 1 1
MIRT028525 EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa 1 1
MIRT028526 PLIN3 perilipin 3 1 1
MIRT028527 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT028528 IFRD2 interferon-related developmental regulator 2 1 1
MIRT028529 INTS6 integrator complex subunit 6 1 1
MIRT028530 URM1 ubiquitin related modifier 1 homolog (S. cerevisiae) 1 1
MIRT028531 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT028532 CSNK1G1 casein kinase 1, gamma 1 1 1
MIRT028533 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT028534 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT028535 KIF11 kinesin family member 11 1 1
MIRT028536 LARP4 La ribonucleoprotein domain family, member 4 1 1
MIRT028537 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide 1 1
MIRT028538 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT028539 KIDINS220 kinase D-interacting substrate, 220kDa 1 1
MIRT028540 ATL2 atlastin GTPase 2 1 1
MIRT028541 DSG2 desmoglein 2 1 1
MIRT028542 FXR1 fragile X mental retardation, autosomal homolog 1 1 1
MIRT028543 VIM vimentin 1 1
MIRT028544 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT028545 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT028546 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT028547 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 1 1
MIRT028548 SAMD9 sterile alpha motif domain containing 9 1 1
MIRT028549 RBM34 RNA binding motif protein 34 1 1
MIRT028550 PAIP1 poly(A) binding protein interacting protein 1 1 1
MIRT028551 EXOSC10 exosome component 10 1 1
MIRT028552 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT028553 MAP2K3 mitogen-activated protein kinase kinase 3 1 1
MIRT028554 ITGB4 integrin, beta 4 1 1
MIRT028555 TPBG trophoblast glycoprotein 1 1
MIRT028556 UBL3 ubiquitin-like 3 1 1
MIRT028557 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT028558 RPP40 ribonuclease P/MRP 40kDa subunit 1 1
MIRT028559 PTMS parathymosin 1 1
MIRT028560 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 1 1
MIRT028561 PPP2R5C protein phosphatase 2, regulatory subunit B', gamma 1 1
MIRT028562 PES1 pescadillo homolog 1, containing BRCT domain (zebrafish) 1 1
MIRT028563 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT028564 SLC38A5 solute carrier family 38, member 5 1 1
MIRT028565 CORO1C coronin, actin binding protein, 1C 1 1
MIRT028566 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT028567 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT028568 FAM96A family with sequence similarity 96, member A 1 1
MIRT028569 CPSF1 cleavage and polyadenylation specific factor 1, 160kDa 1 1
MIRT028570 TRIP12 thyroid hormone receptor interactor 12 1 1
MIRT028571 RPP14 ribonuclease P/MRP 14kDa subunit 1 1
MIRT028572 MAP1LC3B2 microtubule-associated protein 1 light chain 3 beta 2 1 1
MIRT028573 NOP14 NOP14 nucleolar protein homolog (yeast) 1 1
MIRT028574 STUB1 STIP1 homology and U-box containing protein 1 1 1
MIRT028575 SNX3 sorting nexin 3 1 1
MIRT028576 HECTD1 HECT domain containing 1 1 1
MIRT028577 WDR74 WD repeat domain 74 1 1
MIRT028578 MRPS5 mitochondrial ribosomal protein S5 1 1
MIRT028579 TIMM10 translocase of inner mitochondrial membrane 10 homolog (yeast) 1 1
MIRT028580 ZFPL1 zinc finger protein-like 1 1 1
MIRT028581 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) 1 1
MIRT028582 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 1 1
MIRT028583 RBM5 RNA binding motif protein 5 1 1
MIRT028584 LARP4B La ribonucleoprotein domain family, member 4B 1 1
MIRT028585 SF3B3 splicing factor 3b, subunit 3, 130kDa 1 1
MIRT028586 OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT028587 TBC1D4 TBC1 domain family, member 4 1 1
MIRT028588 TMED1 transmembrane emp24 protein transport domain containing 1 1 1
MIRT028589 GATC glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) 1 1
MIRT028590 MAP1LC3B microtubule-associated protein 1 light chain 3 beta 1 1
MIRT028591 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 1 1
MIRT028592 ATXN10 ataxin 10 1 1
MIRT028593 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT028594 NDUFAF1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 1 1
MIRT028595 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT028596 UFM1 ubiquitin-fold modifier 1 1 1
MIRT028597 ATOX1 ATX1 antioxidant protein 1 homolog (yeast) 1 1
MIRT028598 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT028599 REXO4 REX4, RNA exonuclease 4 homolog (S. cerevisiae) 1 1
MIRT028600 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT028601 PDCD10 programmed cell death 10 1 1
MIRT028602 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT028603 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT028604 PSME4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT028605 FAF2 Fas associated factor family member 2 1 1
MIRT028606 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT028607 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 1 1
MIRT028608 FBN1 fibrillin 1 1 1
MIRT028609 VAMP3 vesicle-associated membrane protein 3 (cellubrevin) 1 1
MIRT028610 RBFOX1 ataxin 2-binding protein 1 1 1
MIRT028611 PPP1R12A protein phosphatase 1, regulatory (inhibitor) subunit 12A 1 1
MIRT028612 RAB21 RAB21, member RAS oncogene family 1 1
MIRT028613 STX16 syntaxin 16 1 1
MIRT028614 CAT catalase 1 1
MIRT028615 MAN1A2 mannosidase, alpha, class 1A, member 2 1 1
MIRT028616 ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 1 1
MIRT028617 POLR2B polymerase (RNA) II (DNA directed) polypeptide B, 140kDa 1 1
MIRT028618 RUNX2 runt-related transcription factor 2 2 1
MIRT028619 PAK1IP1 PAK1 interacting protein 1 1 1
MIRT028620 HIST1H1A histone cluster 1, H1a 1 1
MIRT028621 AK2 adenylate kinase 2 1 1
MIRT028622 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028623 USE1 unconventional SNARE in the ER 1 homolog (S. cerevisiae) 1 1
MIRT028624 ITPRIP inositol 1,4,5-triphosphate receptor interacting protein 1 1
MIRT028625 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT028626 ZNF638 zinc finger protein 638 1 1
MIRT028627 CPSF4 cleavage and polyadenylation specific factor 4, 30kDa 1 1
MIRT028628 TELO2 TEL2, telomere maintenance 2, homolog (S. cerevisiae) 1 1
MIRT028629 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 1 1
MIRT028630 GGCT gamma-glutamylcyclotransferase 1 1
MIRT028631 TAPBP TAP binding protein (tapasin) 1 1
MIRT028632 TIMM9 translocase of inner mitochondrial membrane 9 homolog (yeast) 1 1
MIRT028633 ARG1 arginase, liver 1 1
MIRT028634 CSNK1G2 casein kinase 1, gamma 2 1 1
MIRT028635 WDR12 WD repeat domain 12 1 1
MIRT028636 LIG3 ligase III, DNA, ATP-dependent 1 1
MIRT028637 KCNN4 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1 1
MIRT028638 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT028639 POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa 1 1
MIRT028640 DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 2 2
MIRT028641 PHB2 prohibitin 2 1 1
MIRT028642 DNAJC3 DnaJ (Hsp40) homolog, subfamily C, member 3 1 1
MIRT028643 SAMHD1 SAM domain and HD domain 1 1 1
MIRT028644 GABARAPL2 GABA(A) receptor-associated protein-like 2 1 1
MIRT028645 THBS1 thrombospondin 1 1 1
MIRT028646 PYCR2 pyrroline-5-carboxylate reductase family, member 2 1 1
MIRT028647 APEH N-acylaminoacyl-peptide hydrolase 1 1
MIRT028648 ME3 malic enzyme 3, NADP(+)-dependent, mitochondrial 1 1
MIRT028649 PRKCDBP protein kinase C, delta binding protein 1 1
MIRT028650 ANXA1 annexin A1 1 1
MIRT028651 BAX BCL2-associated X protein 1 1
MIRT028652 NIP7 nuclear import 7 homolog (S. cerevisiae) 1 1
MIRT028653 PKM pyruvate kinase, muscle 1 1
MIRT028654 GLRX3 glutaredoxin 3 1 1
MIRT028655 VWA8 KIAA0564 1 1
MIRT028656 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT028657 UTP6 UTP6, small subunit (SSU) processome component, homolog (yeast) 1 1
MIRT028658 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT028659 CAPN2 calpain 2, (m/II) large subunit 1 1
MIRT028660 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 1 1
MIRT028661 RBFOX2 RNA binding motif protein 9 1 1
MIRT028662 LSM1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT028663 CSNK1G3 casein kinase 1, gamma 3 1 1
MIRT028664 PRPF4B PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1 1
MIRT028665 PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme 1 1
MIRT028666 SLC33A1 solute carrier family 33 (acetyl-CoA transporter), member 1 1 1
MIRT028667 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT028668 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT028669 ATP8A2 ATPase, aminophospholipid transporter, class I, type 8A, member 2 1 1
MIRT028670 IKBIP IKBKB interacting protein 1 1
MIRT028671 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT028672 GMFB glia maturation factor, beta 1 1
MIRT028673 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 1 1
MIRT028674 WDR75 WD repeat domain 75 1 1
MIRT028675 UHRF2 ubiquitin-like with PHD and ring finger domains 2 1 1
MIRT028676 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT028677 GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa 1 1
MIRT028678 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT028679 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 1
MIRT028680 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 1 1
MIRT028681 PICALM phosphatidylinositol binding clathrin assembly protein 1 1
MIRT028682 ERLIN1 ER lipid raft associated 1 1 1
MIRT049927 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 1 1
MIRT049928 EXOC2 exocyst complex component 2 1 1
MIRT049929 CAMKV CaM kinase-like vesicle-associated 1 1
MIRT049930 HDGF hepatoma-derived growth factor 1 1
MIRT049931 THUMPD1 THUMP domain containing 1 1 1
MIRT049932 PTBP1 polypyrimidine tract binding protein 1 1 1
MIRT049933 ITPRIPL2 inositol 1,4,5-triphosphate receptor interacting protein-like 2 1 1
MIRT049934 CLEC4D C-type lectin domain family 4, member D 1 1
MIRT049935 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT049936 NOL9 nucleolar protein 9 1 1
MIRT049937 TUBA1B tubulin, alpha 1b 1 1
MIRT049938 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT049939 ANKRD26 ankyrin repeat domain 26 1 1
MIRT049940 CARS cysteinyl-tRNA synthetase 1 1
MIRT049941 ZNF324 zinc finger protein 324 1 1
MIRT049942 XPO7 exportin 7 1 1
MIRT049943 TPI1 triosephosphate isomerase 1 1 1
MIRT049944 RPN2 ribophorin II 1 1
MIRT049945 RPS17 ribosomal protein S17 1 1
MIRT049946 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT049947 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT049948 HDAC1 histone deacetylase 1 1 1
MIRT049949 ERP44 endoplasmic reticulum protein 44 1 1
MIRT049950 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT049951 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 1 1
MIRT049952 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT049953 TRIM28 tripartite motif-containing 28 1 1
MIRT049954 USP16 ubiquitin specific peptidase 16 1 1
MIRT049955 MRPL28 mitochondrial ribosomal protein L28 1 1
MIRT049956 PNMA2 paraneoplastic antigen MA2 1 1
MIRT049957 XPOT exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT049958 DROSHA ribonuclease type III, nuclear 1 1
MIRT049959 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT049960 PCNA proliferating cell nuclear antigen 1 1
MIRT049961 LRRN1 leucine rich repeat neuronal 1 1 1
MIRT049962 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT049963 EEF2 eukaryotic translation elongation factor 2 1 1