Accession ID: MIRT005355 [miRNA, hsa-miR-149-3p :: AKT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-149LinkOut: [miRBase ]
Description Homo sapiens miR-149 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-149-3p
Mature Sequence 56| AGGGAGGGACGGGGGCUGUGC |76
Evidence Experimental
Experiments Cloned
Putative hsa-miR-149-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol AKT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AKT, MGC99656, PKB, PKB-ALPHA, PRKBA, RAC, RAC-ALPHA
Description v-akt murine thymoma viral oncogene homolog 1
Transcript NM_0051    LinkOut: [ RefSeq ]
Other Transcripts NM_0010144 , NM_0010144   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on AKT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of AKT1
(miRNA target sites are highlighted)
>AKT1|NM_0051|3'UTR
   1 TCGGCCAGCGGCACGGCCTGAGGCGGCGGTGGACTGCGCTGGACGATAGCTTGGAGGGATGGAGAGGCGGCCTCGTGCCA
  81 TGATCTGTATTTAATGGTTTTTATTTCTCGGGTGCATTTGAGAGAAGCCACGCTGTCCTCTCGAGCCCAGATGGAAAGAC
 161 GTTTTTGTGCTGTGGGCAGCACCCTCCCCCGCAGCGGGGTAGGGAAGAAAACTATCCTGCGGGTTTTAATTTATTTCATC
 241 CAGTTTGTTCTCCGGGTGTGGCCTCAGCCCTCAGAACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTAT
 321 GCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCT
 401 GTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTA
 481 TGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCAT
 561 CGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTA
 641 AATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCCTCCCCCTTCC
 721 CCTTCTGTGTCACAGTTCTTGGTGACTGTCCCACCGGGAGCCTCCCCCTCAGATGATCTCTCCACGGTAGCACTTGACCT
 801 TTTCGACGCTTAACCTTTCCGCTGTCGCCCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCAC
 881 GCCTCCTGGCCAGACGCTGCCGCTGCCGCTGCACCACGGCGTTTTTTTACAACATTCAACTTTAGTATTTTTACTATTAT
 961 AATATAATATGGAACCTTCCCTCCAAATTCTTCAATAAAAGTTGCTTTTCAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cguguCGGGGGCAGGGAGGGa 5'
               ||||| | ||||||| 
Target 5' ctgtcGCCCCAGGCCCTCCCt 3'
822 - 842 164.00 -27.70
2
miRNA  3' cgUGUCGGGGGCAGGGAGGGa 5'
            | |||||:|  ||:|||| 
Target 5' ggAAAGCCCTCCCCCTTCCCc 3'
702 - 722 151.00 -24.40
3
miRNA  3' cgUGUCGGGGGCAGGGAGGGa 5'
            :||||      ||||||| 
Target 5' ggGCAGC-----ACCCTCCCc 3'
174 - 189 142.00 -18.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-149-3p :: AKT1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions Be2C , HeLa , HEK293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... In this study, we identified Akt1 and E2F1 to be two direct targets of miR-149*// ...

- Lin, R. J. Lin, Y. C. Yu, A. L., 2010, Mol Carcinog.

Article - Lin, R. J. Lin, Y. C. Yu, A. L.
- Mol Carcinog, 2010
microRNAs (miRNAs) play vital roles in several biological processes, including apoptosis, by negatively regulating the expression of target genes. The molecular mechanisms of the key survival signal, Akt family, have been widely explored. However, it remains to be ascertained whether Akt1, the predominant isoform in most tissue, is a direct target of miRNA. In this study, we identified Akt1 and E2F1 to be two direct targets of miR-149* and b-Myb to be an indirect target by reporter assays and Western blot analyses. Ectopic expression of miR-149*-induced apoptosis in Be2C, a neuroblastoma cell line, and in HeLa cells. Silencing of Akt1 or E2F1 expression also led to similar apoptotic changes in these two cell lines, suggesting that the pro-apoptotic effects of miR-149* were exerted by repressing Akt1 and E2F1 expressions. Importantly, analysis of primary neuroblastoma samples revealed a significant inverse correlation of miR-149* with E2F1 expressions (P = 0.026). Interestingly, using the reporter assays, excess miR-149 introduced by transfection to simulated its preponderance in the in vivo condition, could not overcome the repressive function of miR-149* on the target genes. This implies that the pro-apoptotic function of miR-149* may not be dampened by its predominant cognate, miR-149, in vivo. Our findings not only provided the first evidence that Akt1 is a direct target of miRNA but also demonstrated that miR-149* is a pro-apoptotic miRNA by repressing the expression of Akt1 and E2F1. (c) 2010 Wiley-Liss, Inc.
LinkOut: [PMID: 20623644]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
4 hsa-miR-149-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005355 AKT1 v-akt murine thymoma viral oncogene homolog 1 4 1
MIRT005356 E2F1 E2F transcription factor 1 4 1
MIRT021213 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 3 1
MIRT038620 TGIF2 TGFB-induced factor homeobox 2 1 1