Accession ID: MIRT005355 [miRNA, hsa-miR-149-3p :: AKT1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-149LinkOut: [miRBase ]
Description Homo sapiens miR-149 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-149-3p
Mature Sequence 56| AGGGAGGGACGGGGGCUGUGC |76
Evidence Experimental
Experiments Cloned
Putative hsa-miR-149-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol AKT1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms AKT, PKB, PKB-ALPHA, PRKBA, RAC, RAC-ALPHA
Description v-akt murine thymoma viral oncogene homolog 1
Transcript NM_005163    LinkOut: [ RefSeq ]
Other Transcripts NM_001014432 , NM_001014431   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on AKT1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of AKT1
(miRNA target sites are highlighted)
>AKT1|NM_005163|3'UTR
   1 TCGGCCAGCGGCACGGCCTGAGGCGGCGGTGGACTGCGCTGGACGATAGCTTGGAGGGATGGAGAGGCGGCCTCGTGCCA
  81 TGATCTGTATTTAATGGTTTTTATTTCTCGGGTGCATTTGAGAGAAGCCACGCTGTCCTCTCGAGCCCAGATGGAAAGAC
 161 GTTTTTGTGCTGTGGGCAGCACCCTCCCCCGCAGCGGGGTAGGGAAGAAAACTATCCTGCGGGTTTTAATTTATTTCATC
 241 CAGTTTGTTCTCCGGGTGTGGCCTCAGCCCTCAGAACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTAT
 321 GCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCT
 401 GTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTA
 481 TGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCAT
 561 CGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTA
 641 AATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCCTCCCCCTTCC
 721 CCTTCTGTGTCACAGTTCTTGGTGACTGTCCCACCGGGAGCCTCCCCCTCAGATGATCTCTCCACGGTAGCACTTGACCT
 801 TTTCGACGCTTAACCTTTCCGCTGTCGCCCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCAC
 881 GCCTCCTGGCCAGACGCTGCCGCTGCCGCTGCACCACGGCGTTTTTTTACAACATTCAACTTTAGTATTTTTACTATTAT
 961 AATATAATATGGAACCTTCCCTCCAAATTCTTCAATAAAAGTTGCTTTTCAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cguguCGGGGGCAGGGAGGGa 5'
               ||||| | ||||||| 
Target 5' ctgtcGCCCCAGGCCCTCCCt 3'
822 - 842 164.00 -27.70
2
miRNA  3' cgUGUCGGGGGCAGGGAGGGa 5'
            | |||||:|  ||:|||| 
Target 5' ggAAAGCCCTCCCCCTTCCCc 3'
702 - 722 151.00 -24.40
3
miRNA  3' cgUGUCGGGGGCAGGGAGGGa 5'
            :||||      ||||||| 
Target 5' ggGCAGC-----ACCCTCCCc 3'
174 - 189 142.00 -18.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-149-3p :: AKT1    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions Be2C , HeLa , HEK293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... In this study, we identified Akt1 and E2F1 to be two direct targets of miR-149*// ...

- Lin, R. J. Lin, Y. C. Yu, A. L., 2010, Mol Carcinog.

Article - Lin, R. J. Lin, Y. C. Yu, A. L.
- Mol Carcinog, 2010
microRNAs (miRNAs) play vital roles in several biological processes, including apoptosis, by negatively regulating the expression of target genes. The molecular mechanisms of the key survival signal, Akt family, have been widely explored. However, it remains to be ascertained whether Akt1, the predominant isoform in most tissue, is a direct target of miRNA. In this study, we identified Akt1 and E2F1 to be two direct targets of miR-149* and b-Myb to be an indirect target by reporter assays and Western blot analyses. Ectopic expression of miR-149*-induced apoptosis in Be2C, a neuroblastoma cell line, and in HeLa cells. Silencing of Akt1 or E2F1 expression also led to similar apoptotic changes in these two cell lines, suggesting that the pro-apoptotic effects of miR-149* were exerted by repressing Akt1 and E2F1 expressions. Importantly, analysis of primary neuroblastoma samples revealed a significant inverse correlation of miR-149* with E2F1 expressions (P = 0.026). Interestingly, using the reporter assays, excess miR-149 introduced by transfection to simulated its preponderance in the in vivo condition, could not overcome the repressive function of miR-149* on the target genes. This implies that the pro-apoptotic function of miR-149* may not be dampened by its predominant cognate, miR-149, in vivo. Our findings not only provided the first evidence that Akt1 is a direct target of miRNA but also demonstrated that miR-149* is a pro-apoptotic miRNA by repressing the expression of Akt1 and E2F1. (c) 2010 Wiley-Liss, Inc.
LinkOut: [PMID: 20623644]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
610 hsa-miR-149-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005355 AKT1 v-akt murine thymoma viral oncogene homolog 1 4 1
MIRT005356 E2F1 E2F transcription factor 1 4 1
MIRT021213 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 3 1
MIRT038620 TGIF2 TGFB-induced factor homeobox 2 1 1
MIRT054856 FGFR1 fibroblast growth factor receptor 1 3 1
MIRT054858 GPC1 glypican 1 3 1
MIRT083268 ZCCHC3 zinc finger, CCHC domain containing 3 1 2
MIRT112194 BTG2 BTG family, member 2 1 1
MIRT115283 JUN jun proto-oncogene 1 1
MIRT115514 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT119860 NRBP1 nuclear receptor binding protein 1 1 1
MIRT131869 IER5 immediate early response 5 1 2
MIRT149384 CARM1 coactivator-associated arginine methyltransferase 1 1 1
MIRT160008 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT177157 ARL5B ADP-ribosylation factor-like 5B 1 2
MIRT260096 KLHL21 kelch-like 21 (Drosophila) 1 1
MIRT260344 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 1 3
MIRT266407 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT294637 ZNF548 zinc finger protein 548 1 1
MIRT339328 SESN2 sestrin 2 1 1
MIRT386422 CCL22 chemokine (C-C motif) ligand 22 1 2
MIRT441470 BEST3 bestrophin 3 1 1
MIRT442284 CCDC108 coiled-coil domain containing 108 1 2
MIRT446758 ZNF491 zinc finger protein 491 1 1
MIRT449230 RAD51B RAD51 homolog B (S. cerevisiae) 1 1
MIRT451010 MYH14 myosin, heavy chain 14, non-muscle 1 4
MIRT451100 ZNF584 zinc finger protein 584 1 1
MIRT451413 TJP3 tight junction protein 3 1 2
MIRT451567 CIAPIN1 cytokine induced apoptosis inhibitor 1 1 1
MIRT451743 CES3 carboxylesterase 3 1 1
MIRT451950 TMPRSS5 transmembrane protease, serine 5 1 1
MIRT452325 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 1 1
MIRT452419 QDPR quinoid dihydropteridine reductase 1 1
MIRT452570 ZFP69B zinc finger protein 643 1 1
MIRT452864 LAX1 lymphocyte transmembrane adaptor 1 1 1
MIRT452929 DISC1 disrupted in schizophrenia 1 1 1
MIRT453055 TANGO2 chromosome 22 open reading frame 25 1 2
MIRT453105 HOXC4 homeobox C4 1 1
MIRT453244 FTSJ3 FtsJ homolog 3 (E. coli) 1 1
MIRT453303 ZNF394 zinc finger protein 394 1 1
MIRT453336 PLEKHG2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 1 1
MIRT453547 PRR12 proline rich 12 1 1
MIRT453601 ZNF557 zinc finger protein 557 1 1
MIRT453802 KBTBD12 kelch repeat and BTB (POZ) domain containing 12 1 1
MIRT453994 CECR1 cat eye syndrome chromosome region, candidate 1 1 1
MIRT454091 TMEM209 transmembrane protein 209 1 1
MIRT454213 HLA-A major histocompatibility complex, class I, A 1 1
MIRT454294 ZNF134 zinc finger protein 134 1 1
MIRT454457 PPP2R2B protein phosphatase 2, regulatory subunit B, beta 1 1
MIRT454476 SLC29A1 solute carrier family 29 (nucleoside transporters), member 1 1 1
MIRT454662 FBXL18 F-box and leucine-rich repeat protein 18 1 1
MIRT454790 STOML3 stomatin (EPB72)-like 3 1 1
MIRT455126 TBC1D25 TBC1 domain family, member 25 1 1
MIRT455316 TTLL9 tubulin tyrosine ligase-like family, member 9 1 1
MIRT456124 SAMD10 sterile alpha motif domain containing 10 1 1
MIRT456153 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT456476 SERAC1 serine active site containing 1 1 1
MIRT456559 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 1 1
MIRT456725 TMEM239 transmembrane protein 239 1 2
MIRT457391 CAMK2A calcium/calmodulin-dependent protein kinase II alpha 1 1
MIRT457429 NOL10 nucleolar protein 10 1 1
MIRT457493 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT458005 MRPL12 mitochondrial ribosomal protein L12 1 1
MIRT458137 TLCD2 TLC domain containing 2 1 1
MIRT458597 KCTD2 potassium channel tetramerisation domain containing 2 1 1
MIRT459033 ZNF490 zinc finger protein 490 1 2
MIRT459125 FADS6 fatty acid desaturase domain family, member 6 1 1
MIRT459323 HAVCR2 hepatitis A virus cellular receptor 2 1 1
MIRT459394 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT459422 FAM83B family with sequence similarity 83, member B 1 1
MIRT459568 NLGN2 neuroligin 2 1 1
MIRT459607 KCNK3 potassium channel, subfamily K, member 3 1 1
MIRT459669 VPS37C vacuolar protein sorting 37 homolog C (S. cerevisiae) 1 1
MIRT459918 HHIP hedgehog interacting protein 1 2
MIRT459984 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT460488 FAM105A family with sequence similarity 105, member A 1 3
MIRT460592 FEM1A fem-1 homolog a (C. elegans) 1 1
MIRT460651 IGFBP4 insulin-like growth factor binding protein 4 1 1
MIRT460680 RNF157 ring finger protein 157 1 1
MIRT460712 FN3KRP fructosamine 3 kinase related protein 1 1
MIRT460881 UBE2S ubiquitin-conjugating enzyme E2S 1 1
MIRT460928 NOA1 nitric oxide associated 1 1 2
MIRT461081 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
MIRT461598 DPH2 DPH2 homolog (S. cerevisiae) 1 1
MIRT461862 ZNF317 zinc finger protein 317 1 1
MIRT462187 ACADL acyl-CoA dehydrogenase, long chain 1 1
MIRT462453 GCDH glutaryl-CoA dehydrogenase 1 1
MIRT462995 ZNF740 zinc finger protein 740 1 1
MIRT463328 ZFHX3 zinc finger homeobox 3 1 1
MIRT463860 WNT7B wingless-type MMTV integration site family, member 7B 1 1
MIRT464062 WAC WW domain containing adaptor with coiled-coil 1 1
MIRT464319 UST uronyl-2-sulfotransferase 1 1
MIRT464824 UBE2B ubiquitin-conjugating enzyme E2B 1 1
MIRT465410 TP53 tumor protein p53 1 1
MIRT466083 TMEM184C transmembrane protein 184C 1 1
MIRT466526 TBXA2R thromboxane A2 receptor 1 1
MIRT467081 SRRD SRR1 domain containing 1 1
MIRT467154 SREBF2 sterol regulatory element binding transcription factor 2 1 1
MIRT468102 SH3TC2 SH3 domain and tetratricopeptide repeats 2 1 1
MIRT468290 SFT2D2 SFT2 domain containing 2 1 2
MIRT468764 SCD stearoyl-CoA desaturase (delta-9-desaturase) 1 1
MIRT468916 RPS6KA4 ribosomal protein S6 kinase, 90kDa, polypeptide 4 1 1
MIRT469162 RNF111 ring finger protein 111 1 1
MIRT469212 RICTOR RPTOR independent companion of MTOR, complex 2 1 1
MIRT469749 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT470598 POTEM POTE ankyrin domain family, member M 1 1
MIRT470628 POTEG POTE ankyrin domain family, member G 1 1
MIRT470773 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT470885 PLXND1 plexin D1 1 1
MIRT470985 PITPNA phosphatidylinositol transfer protein, alpha 1 1
MIRT471225 PHAX phosphorylated adaptor for RNA export 1 1
MIRT471255 PGM2L1 phosphoglucomutase 2-like 1 1 1
MIRT471305 PGAM4 phosphoglycerate mutase family member 4 1 1
MIRT471475 PDE7B phosphodiesterase 7B 1 1
MIRT471773 NUP43 nucleoporin 43kDa 1 2
MIRT472063 NOVA2 neuro-oncological ventral antigen 2 1 1
MIRT472178 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT472221 NGFR nerve growth factor receptor 1 1
MIRT472294 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT473076 MORN4 MORN repeat containing 4 1 1
MIRT473096 MLXIP MLX interacting protein 1 1
MIRT473204 MINK1 misshapen-like kinase 1 1 1
MIRT473497 MBD6 methyl-CpG binding domain protein 6 1 1
MIRT473547 MAVS mitochondrial antiviral signaling protein 1 1
MIRT473574 MAT2A methionine adenosyltransferase II, alpha 1 3
MIRT473633 MARK2 MAP/microtubule affinity-regulating kinase 2 1 1
MIRT474000 LRRC20 leucine rich repeat containing 20 1 1
MIRT474842 KHSRP KH-type splicing regulatory protein 1 2
MIRT474999 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT475136 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT475583 HMGXB4 HMG box domain containing 4 1 1
MIRT477306 EPHB2 EPH receptor B2 1 1
MIRT477378 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT477951 DPM2 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit 1 1
MIRT478292 DDX19A DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A 1 2
MIRT478479 CYP20A1 cytochrome P450, family 20, subfamily A, polypeptide 1 1 1
MIRT478594 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 1 1
MIRT478630 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT478843 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT479015 COL5A1 collagen, type V, alpha 1 1 1
MIRT479120 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 2
MIRT479174 CLSPN claspin 1 1
MIRT480148 CALR calreticulin 1 1
MIRT481402 ASXL1 additional sex combs like 1 (Drosophila) 1 1
MIRT482025 AMER1 family with sequence similarity 123B 1 1
MIRT482149 AK2 adenylate kinase 2 1 1
MIRT482354 AGO2 eukaryotic translation initiation factor 2C, 2 1 6
MIRT482814 TRAF6 TNF receptor-associated factor 6, E3 ubiquitin protein ligase 1 1
MIRT483267 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 2
MIRT483332 CHRDL1 chordin-like 1 1 4
MIRT483624 NAV2 neuron navigator 2 1 1
MIRT483658 QSOX2 quiescin Q6 sulfhydryl oxidase 2 1 2
MIRT483809 CYP2W1 cytochrome P450, family 2, subfamily W, polypeptide 1 1 3
MIRT483861 EMID1 EMI domain containing 1 1 1
MIRT484199 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 1 2
MIRT484281 AIP aryl hydrocarbon receptor interacting protein 1 2
MIRT484357 GATA6 GATA binding protein 6 1 5
MIRT484418 SNX19 sorting nexin 19 1 1
MIRT484431 RAB7A RAB7A, member RAS oncogene family 1 2
MIRT484577 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 1 1
MIRT484845 ZNF70 zinc finger protein 70 1 3
MIRT485269 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT485928 PGPEP1 pyroglutamyl-peptidase I 1 3
MIRT485992 YIPF2 Yip1 domain family, member 2 1 1
MIRT486093 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 2
MIRT486115 INO80E INO80 complex subunit E 1 1
MIRT486311 SIPA1 signal-induced proliferation-associated 1 1 1
MIRT486377 TIGD5 tigger transposable element derived 5 1 1
MIRT486435 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 1 1
MIRT486725 MGAT5B mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B 1 2
MIRT486791 PARP11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT486891 TSPYL4 TSPY-like 4 1 2
MIRT487041 C10orf55 chromosome 10 open reading frame 55 1 1
MIRT487131 NCOR2 nuclear receptor corepressor 2 1 1
MIRT487157 LINGO3 leucine rich repeat and Ig domain containing 3 1 1
MIRT487229 CBS cystathionine-beta-synthase 1 2
MIRT487333 SREBF1 sterol regulatory element binding transcription factor 1 1 2
MIRT487415 CACNB1 calcium channel, voltage-dependent, beta 1 subunit 1 1
MIRT487552 TM6SF2 transmembrane 6 superfamily member 2 1 2
MIRT487581 FAM83H family with sequence similarity 83, member H 1 2
MIRT487612 C20orf96 chromosome 20 open reading frame 96 1 1
MIRT487682 B3GALT5 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 1 2
MIRT487693 CDK14 cyclin-dependent kinase 14 1 1
MIRT487833 CLSTN1 calsyntenin 1 1 3
MIRT487876 CASZ1 castor zinc finger 1 1 2
MIRT487901 CST9 cystatin 9 (testatin) 1 1
MIRT488095 DLGAP3 discs, large (Drosophila) homolog-associated protein 3 1 2
MIRT488189 MAT1A methionine adenosyltransferase I, alpha 1 1
MIRT488236 DNLZ DNL-type zinc finger 1 1
MIRT488280 PARS2 prolyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT488412 NKX6-2 NK6 homeobox 2 1 2
MIRT488532 GPATCH3 G patch domain containing 3 1 1
MIRT488688 NAT9 N-acetyltransferase 9 (GCN5-related, putative) 1 1
MIRT489041 PRPF4B PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1 1
MIRT489053 STARD3 StAR-related lipid transfer (START) domain containing 3 1 1
MIRT489117 PPFIA3 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 1 1
MIRT489171 ANKRD45 ankyrin repeat domain 45 1 2
MIRT489226 ASCL2 achaete-scute complex homolog 2 (Drosophila) 1 2
MIRT489259 TTLL1 tubulin tyrosine ligase-like family, member 1 1 2
MIRT489284 RBM8A RNA binding motif protein 8A 1 4
MIRT489360 SYNGR1 synaptogyrin 1 1 2
MIRT489475 SLITRK5 SLIT and NTRK-like family, member 5 1 1
MIRT489507 CRLF3 cytokine receptor-like factor 3 1 2
MIRT489575 SSBP2 single-stranded DNA binding protein 2 1 1
MIRT489699 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT489795 KRT80 keratin 80 1 2
MIRT489850 ATP2A3 ATPase, Ca++ transporting, ubiquitous 1 1
MIRT490075 PRRT2 proline-rich transmembrane protein 2 1 2
MIRT490133 FN3K fructosamine 3 kinase 1 1
MIRT490178 TMEM63C transmembrane protein 63C 1 1
MIRT490206 PKNOX2 PBX/knotted 1 homeobox 2 1 1
MIRT490279 ZNF562 zinc finger protein 562 1 2
MIRT490287 ISL2 ISL LIM homeobox 2 1 1
MIRT490301 HOXB13 homeobox B13 1 1
MIRT490608 SLC47A1 solute carrier family 47, member 1 1 2
MIRT490680 SSTR1 somatostatin receptor 1 1 1
MIRT490752 SRCIN1 SRC kinase signaling inhibitor 1 1 1
MIRT490915 STRN4 striatin, calmodulin binding protein 4 1 1
MIRT491094 MSI1 musashi homolog 1 (Drosophila) 1 2
MIRT491127 PTPRE protein tyrosine phosphatase, receptor type, E 1 1
MIRT491205 MLLT1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 1 3
MIRT491228 KCNA5 potassium voltage-gated channel, shaker-related subfamily, member 5 1 1
MIRT491266 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT491393 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT491404 C1D C1D nuclear receptor corepressor 1 1
MIRT491510 CREBL2 cAMP responsive element binding protein-like 2 1 1
MIRT491554 YAE1D1 Yae1 domain containing 1 1 1
MIRT491667 AQP2 aquaporin 2 (collecting duct) 1 1
MIRT491685 MNT MAX binding protein 1 2
MIRT491735 SEMA3F sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F 1 1
MIRT491818 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT492157 STK11 serine/threonine kinase 11 1 2
MIRT492475 RASD1 RAS, dexamethasone-induced 1 1 2
MIRT492685 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT492729 PHF12 PHD finger protein 12 1 1
MIRT492843 NRGN neurogranin (protein kinase C substrate, RC3) 1 1
MIRT492879 NFIX nuclear factor I/X (CCAAT-binding transcription factor) 1 2
MIRT492908 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT492935 NEUROD2 neuronal differentiation 2 1 1
MIRT493222 MEX3A mex-3 homolog A (C. elegans) 1 1
MIRT493674 HAP1 huntingtin-associated protein 1 1 1
MIRT493876 FAM73B family with sequence similarity 73, member B 1 2
MIRT494032 DUSP7 dual specificity phosphatase 7 1 2
MIRT494172 CNOT6L CCR4-NOT transcription complex, subunit 6-like 1 1
MIRT494367 SOLH small optic lobes homolog (Drosophila) 1 1
MIRT494467 BTF3L4 basic transcription factor 3-like 4 1 3
MIRT494507 BDNF-AS BDNF antisense RNA 1 1
MIRT494622 ASB6 ankyrin repeat and SOCS box containing 6 1 2
MIRT494661 ARL8A ADP-ribosylation factor-like 8A 1 1
MIRT494699 ARHGAP31 Rho GTPase activating protein 31 1 1
MIRT494793 ANKRD13B ankyrin repeat domain 13B 1 2
MIRT494941 IFFO2 intermediate filament family orphan 2 1 1
MIRT496592 TAGLN transgelin 1 1
MIRT497042 DYRK1B dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B 1 1
MIRT498593 KRT8 keratin 8 1 1
MIRT498733 SNTN sentan, cilia apical structure protein 1 3
MIRT499390 PLCG2 phospholipase C, gamma 2 (phosphatidylinositol-specific) 1 2
MIRT499800 LONRF3 LON peptidase N-terminal domain and ring finger 3 1 1
MIRT499988 HIST1H2BD histone cluster 1, H2bd 1 2
MIRT500447 ZFP36L1 zinc finger protein 36, C3H type-like 1 1 1
MIRT501890 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 2
MIRT503423 SLC25A45 solute carrier family 25, member 45 1 3
MIRT507785 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1 1
MIRT508895 METTL14 methyltransferase like 14 1 1
MIRT509632 RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 1 2
MIRT510112 IRAK3 interleukin-1 receptor-associated kinase 3 1 4
MIRT510144 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 1 2
MIRT510629 TMEM167A transmembrane protein 167A 1 2
MIRT511026 NRF1 nuclear respiratory factor 1 1 1
MIRT512366 CPM carboxypeptidase M 1 2
MIRT512905 UBL4A ubiquitin-like 4A 1 1
MIRT514350 DNAH17 dynein, axonemal, heavy chain 17 1 2
MIRT515022 SUMF2 sulfatase modifying factor 2 1 1
MIRT515255 DUSP28 dual specificity phosphatase 28 1 1
MIRT516213 RPP30 ribonuclease P/MRP 30kDa subunit 1 1
MIRT516676 ZNF860 zinc finger protein 860 1 2
MIRT518383 ZNF250 zinc finger protein 250 1 1
MIRT518943 LSG1 large subunit GTPase 1 homolog (S. cerevisiae) 1 1
MIRT519914 ZFAND4 zinc finger, AN1-type domain 4 1 1
MIRT519953 ZCCHC8 zinc finger, CCHC domain containing 8 1 1
MIRT520329 UBXN2A UBX domain protein 2A 1 1
MIRT520618 TMEM41B transmembrane protein 41B 1 1
MIRT520671 TMEM11 transmembrane protein 11 1 1
MIRT520861 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT521451 RAD51 RAD51 homolog (S. cerevisiae) 1 1
MIRT522339 NCKIPSD NCK interacting protein with SH3 domain 1 4
MIRT523489 GNG4 guanine nucleotide binding protein (G protein), gamma 4 1 1
MIRT523681 FOPNL FGFR1OP N-terminal like 1 1
MIRT523725 FBXW2 F-box and WD repeat domain containing 2 1 2
MIRT523877 ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) 1 2
MIRT524058 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 1 1
MIRT524180 DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 1 1
MIRT524937 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT526838 PHC1 polyhomeotic homolog 1 (Drosophila) 1 1
MIRT527089 VSTM5 V-set and transmembrane domain containing 5 1 1
MIRT540688 BMP3 bone morphogenetic protein 3 1 1
MIRT541763 KLF8 Kruppel-like factor 8 1 1
MIRT544293 TSPYL1 TSPY-like 1 1 1
MIRT549413 ADAR adenosine deaminase, RNA-specific 1 1
MIRT553370 TRIM44 tripartite motif containing 44 1 1
MIRT561758 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT562830 GCFC2 GC-rich sequence DNA-binding factor 2 1 1
MIRT562910 DNAH10OS dynein, axonemal, heavy chain 10 opposite strand 1 1
MIRT564460 SLC35E2 solute carrier family 35, member E2 1 2
MIRT568902 ATP6V1B1 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 1 1
MIRT569121 ONECUT3 one cut homeobox 3 1 1
MIRT569233 SUSD1 sushi domain containing 1 1 1
MIRT569726 GPR173 G protein-coupled receptor 173 1 1
MIRT570285 ARPC3 actin related protein 2/3 complex, subunit 3, 21kDa 1 1
MIRT570478 THRA thyroid hormone receptor, alpha 1 1
MIRT570855 GPRC5C G protein-coupled receptor, family C, group 5, member C 1 1
MIRT571199 C9orf62 chromosome 9 open reading frame 62 1 1
MIRT571323 TPCN2 two pore segment channel 2 1 1
MIRT572084 EXOC8 exocyst complex component 8 1 1
MIRT572127 DNAJC24 DnaJ (Hsp40) homolog, subfamily C, member 24 1 1
MIRT573005 RPP25 ribonuclease P/MRP 25kDa subunit 1 1
MIRT573492 IQSEC3 IQ motif and Sec7 domain 3 1 1
MIRT573660 HES6 hairy and enhancer of split 6 (Drosophila) 1 1
MIRT574066 RAB11B RAB11B, member RAS oncogene family 1 1
MIRT574352 ZBTB37 zinc finger and BTB domain containing 37 1 1
MIRT576454 Itga11 integrin alpha 11 1 1
MIRT608048 UBLCP1 ubiquitin-like domain containing CTD phosphatase 1 1 1
MIRT608253 ITGA11 integrin, alpha 11 1 1
MIRT613669 KIAA1210 KIAA1210 1 1
MIRT615643 ATF6 activating transcription factor 6 1 1
MIRT618582 RRAD Ras-related associated with diabetes 1 1
MIRT618870 MBL2 mannose-binding lectin (protein C) 2, soluble 1 1
MIRT618970 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT619120 CD40LG CD40 ligand 1 1
MIRT619181 SLC16A4 solute carrier family 16, member 4 (monocarboxylic acid transporter 5) 1 1
MIRT620307 AQP6 aquaporin 6, kidney specific 1 1
MIRT620692 RFTN2 raftlin family member 2 1 1
MIRT621647 UBXN2B UBX domain protein 2B 1 1
MIRT622005 STK4 serine/threonine kinase 4 1 1
MIRT622430 NUDT19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 1 1
MIRT622581 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 1
MIRT622812 PGAM5 phosphoglycerate mutase family member 5 1 2
MIRT624794 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT624976 ZNF665 zinc finger protein 665 1 2
MIRT625487 SMAD9 SMAD family member 9 1 1
MIRT626605 ACAA2 acetyl-CoA acyltransferase 2 1 1
MIRT626717 TRIM65 tripartite motif containing 65 1 1
MIRT626983 LINC00598 long intergenic non-protein coding RNA 598 1 1
MIRT627495 STRIP2 striatin interacting protein 2 1 1
MIRT628512 ZNF878 zinc finger protein 878 1 1
MIRT628542 ZNF701 zinc finger protein 701 1 1
MIRT628599 TMEM251 transmembrane protein 251 1 1
MIRT628826 SLC25A34 solute carrier family 25, member 34 1 1
MIRT628905 IGSF6 immunoglobulin superfamily, member 6 1 1
MIRT628967 UBE2D4 ubiquitin-conjugating enzyme E2D 4 (putative) 1 1
MIRT629017 OSBPL10 oxysterol binding protein-like 10 1 1
MIRT629068 KIF1C kinesin family member 1C 1 1
MIRT629198 PAPOLA poly(A) polymerase alpha 1 1
MIRT629354 TMPRSS11BNL TMPRSS11B N terminal-like 1 1
MIRT629456 WIZ widely interspaced zinc finger motifs 1 1
MIRT629704 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT629746 SCD5 stearoyl-CoA desaturase 5 1 1
MIRT629905 SPATA5 spermatogenesis associated 5 1 1
MIRT629962 GLP2R glucagon-like peptide 2 receptor 1 1
MIRT630032 MTL5 metallothionein-like 5, testis-specific (tesmin) 1 1
MIRT630398 MYH9 myosin, heavy chain 9, non-muscle 1 2
MIRT631141 SYNJ2 synaptojanin 2 1 1
MIRT631392 COL4A3BP collagen, type IV, alpha 3 (Goodpasture antigen) binding protein 1 1
MIRT631567 TRAF3IP2 TRAF3 interacting protein 2 1 1
MIRT631624 PCDHB11 protocadherin beta 11 1 1
MIRT631943 CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 1 2
MIRT632454 SGTB small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta 1 1
MIRT632663 NAV1 neuron navigator 1 1 1
MIRT632696 MTMR10 myotubularin related protein 10 1 1
MIRT632749 MED28 mediator complex subunit 28 1 1
MIRT632839 IGF1 insulin-like growth factor 1 (somatomedin C) 1 1
MIRT632918 FRRS1 ferric-chelate reductase 1 1 1
MIRT633038 DNAL1 dynein, axonemal, light chain 1 1 1
MIRT633389 FBXW8 F-box and WD repeat domain containing 8 1 1
MIRT633449 KLLN killin, p53-regulated DNA replication inhibitor 1 1
MIRT633872 ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 1 1
MIRT633917 DNAH9 dynein, axonemal, heavy chain 9 1 1
MIRT633959 GRWD1 glutamate-rich WD repeat containing 1 1 1
MIRT634051 NUP155 nucleoporin 155kDa 1 1
MIRT634275 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 1 1
MIRT634382 RAP2B RAP2B, member of RAS oncogene family 1 1
MIRT634444 PDE7A phosphodiesterase 7A 1 1
MIRT634581 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 1 2
MIRT634705 DSEL dermatan sulfate epimerase-like 1 1
MIRT634777 CD3D CD3d molecule, delta (CD3-TCR complex) 1 1
MIRT635033 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT636079 ZNF280C zinc finger protein 280C 1 1
MIRT636709 ARSK arylsulfatase family, member K 1 1
MIRT637448 ZNF324B zinc finger protein 324B 1 1
MIRT637591 PLD6 phospholipase D family, member 6 1 1
MIRT637682 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT637894 SLC19A3 solute carrier family 19, member 3 1 2
MIRT638363 RBMS2 RNA binding motif, single stranded interacting protein 2 1 2
MIRT638605 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT638832 CRTAP cartilage associated protein 1 1
MIRT638886 CEP97 centrosomal protein 97kDa 1 2
MIRT639664 PPEF2 protein phosphatase, EF-hand calcium binding domain 2 1 2
MIRT645002 POLR2J3 polymerase (RNA) II (DNA directed) polypeptide J3 1 1
MIRT645068 UQCRQ ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa 1 1
MIRT646958 UPK3BL uroplakin 3B-like 1 1
MIRT648308 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa 1 2
MIRT649052 SLC1A2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1 1
MIRT649894 SLFN12L schlafen family member 12-like 1 1
MIRT650205 DOCK7 dedicator of cytokinesis 7 1 1
MIRT652055 TTC39B tetratricopeptide repeat domain 39B 1 1
MIRT654798 PRICKLE1 prickle homolog 1 (Drosophila) 1 1
MIRT655931 NDUFA4P1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa, pseudogene 1 1 1
MIRT657723 GPC4 glypican 4 1 1
MIRT659310 CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa 1 1
MIRT659852 CAPZB capping protein (actin filament) muscle Z-line, beta 1 1
MIRT661484 CHMP1B charged multivesicular body protein 1B 1 1
MIRT661915 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT661982 DSN1 DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) 1 2
MIRT662075 ZNF284 zinc finger protein 284 1 1
MIRT662501 ANGPT4 angiopoietin 4 1 1
MIRT662670 LRRC47 leucine rich repeat containing 47 1 1
MIRT663175 FGFR1OP FGFR1 oncogene partner 1 1
MIRT663386 ZNF770 zinc finger protein 770 1 2
MIRT664001 WDR75 WD repeat domain 75 1 1
MIRT664168 APOBEC3F apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F 1 1
MIRT664498 POLR3K polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa 1 1
MIRT665066 CCDC77 coiled-coil domain containing 77 1 1
MIRT665089 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT665726 TMTC1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT665931 TBC1D19 TBC1 domain family, member 19 1 2
MIRT666098 SSR1 signal sequence receptor, alpha 1 1
MIRT666851 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT667391 MOB1B MOB kinase activator 1B 1 1
MIRT667584 LONRF2 LON peptidase N-terminal domain and ring finger 2 1 1
MIRT667905 ING1 inhibitor of growth family, member 1 1 1
MIRT667986 HECTD3 HECT domain containing E3 ubiquitin protein ligase 3 1 1
MIRT668206 GCNT4 glucosaminyl (N-acetyl) transferase 4, core 2 1 1
MIRT668287 FOSL2 FOS-like antigen 2 1 1
MIRT668394 FAT3 FAT tumor suppressor homolog 3 (Drosophila) 1 1
MIRT668451 FAM208A family with sequence similarity 208, member A 1 1
MIRT669006 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT669460 ATL3 atlastin GTPase 3 1 1
MIRT669668 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT669898 KIAA0754 KIAA0754 1 2
MIRT669984 SSR3 signal sequence receptor, gamma (translocon-associated protein gamma) 1 1
MIRT670161 SLC29A4 solute carrier family 29 (nucleoside transporters), member 4 1 1
MIRT670246 TRIM13 tripartite motif containing 13 1 1
MIRT670283 CBY3 chibby homolog 3 (Drosophila) 1 1
MIRT670364 ULBP3 UL16 binding protein 3 1 2
MIRT670636 BVES blood vessel epicardial substance 1 1
MIRT670740 HOOK3 hook homolog 3 (Drosophila) 1 1
MIRT670779 TRIM66 tripartite motif containing 66 1 1
MIRT670922 DESI1 desumoylating isopeptidase 1 1 1
MIRT671375 TMPPE transmembrane protein with metallophosphoesterase domain 1 1
MIRT671407 ERCC6L2 excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2 1 1
MIRT671437 TOX4 TOX high mobility group box family member 4 1 1
MIRT671662 TRUB2 TruB pseudouridine (psi) synthase homolog 2 (E. coli) 1 2
MIRT671719 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT672044 SMTNL2 smoothelin-like 2 1 1
MIRT672146 PLEKHH1 pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 1 1
MIRT672407 SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 1 1
MIRT672516 GGCX gamma-glutamyl carboxylase 1 1
MIRT672581 RNF24 ring finger protein 24 1 1
MIRT672801 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT673208 C10orf76 chromosome 10 open reading frame 76 1 1
MIRT673381 ZNF124 zinc finger protein 124 1 1
MIRT673504 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 1 3
MIRT673862 CAPN7 calpain 7 1 1
MIRT673936 ZNF500 zinc finger protein 500 1 1
MIRT673991 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 1 1
MIRT674091 PLEKHA1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 1 1
MIRT674133 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT674307 THAP5 THAP domain containing 5 1 1
MIRT674379 POLR3D polymerase (RNA) III (DNA directed) polypeptide D, 44kDa 1 1
MIRT674651 NKRF NFKB repressing factor 1 1
MIRT674672 PLCE1 phospholipase C, epsilon 1 1 1
MIRT674734 ZNF451 zinc finger protein 451 1 2
MIRT674788 NPR1 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 1 1
MIRT674902 RASSF9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT675026 SNX1 sorting nexin 1 1 1
MIRT675351 KLHL26 kelch-like 26 (Drosophila) 1 1
MIRT675425 CLEC7A C-type lectin domain family 7, member A 1 1
MIRT675506 HSD17B12 hydroxysteroid (17-beta) dehydrogenase 12 1 1
MIRT675746 AHR aryl hydrocarbon receptor 1 1
MIRT675870 ATP1B4 ATPase, Na+/K+ transporting, beta 4 polypeptide 1 1
MIRT676000 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT676222 TMEM91 transmembrane protein 91 1 1
MIRT677308 CPSF2 cleavage and polyadenylation specific factor 2, 100kDa 1 1
MIRT677839 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT677877 ABI2 abl-interactor 2 1 1
MIRT677975 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 1 1
MIRT678185 CRCP CGRP receptor component 1 1
MIRT678283 PTRH2 peptidyl-tRNA hydrolase 2 1 1
MIRT679470 RHOF ras homolog family member F (in filopodia) 1 1
MIRT679522 RAB36 RAB36, member RAS oncogene family 1 1
MIRT679922 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 1 1
MIRT680039 OSBPL2 oxysterol binding protein-like 2 1 2
MIRT680255 NDUFA7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa 1 1
MIRT680288 AKIP1 A kinase (PRKA) interacting protein 1 1 1
MIRT680508 PRIM2 primase, DNA, polypeptide 2 (58kDa) 1 1
MIRT680638 KIAA1456 KIAA1456 1 1
MIRT680828 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT680880 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like 1 1
MIRT681007 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 1 1
MIRT681129 INTS7 integrator complex subunit 7 1 1
MIRT681167 IBA57 IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae) 1 1
MIRT681229 DUSP19 dual specificity phosphatase 19 1 1
MIRT681312 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT681349 BRI3BP BRI3 binding protein 1 1
MIRT681616 F2RL2 coagulation factor II (thrombin) receptor-like 2 1 1
MIRT681786 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT681899 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT682092 ITGA3 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 1 2
MIRT682145 SMS spermine synthase 1 1
MIRT682171 SLC38A7 solute carrier family 38, member 7 1 1
MIRT682228 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT682351 PLEKHB2 pleckstrin homology domain containing, family B (evectins) member 2 1 1
MIRT682375 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT682544 EXOSC2 exosome component 2 1 1
MIRT682629 COX6B1 cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) 1 1
MIRT683550 HAVCR1 hepatitis A virus cellular receptor 1 1 1
MIRT683651 ZNF695 zinc finger protein 695 1 1
MIRT684450 MFSD4 major facilitator superfamily domain containing 4 1 1
MIRT684864 ZNF749 zinc finger protein 749 1 1
MIRT684964 MINOS1 mitochondrial inner membrane organizing system 1 1 1
MIRT685055 GEMIN4 gem (nuclear organelle) associated protein 4 1 1
MIRT685103 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 1 1
MIRT685818 SLC27A1 solute carrier family 27 (fatty acid transporter), member 1 1 1
MIRT685919 MOCS3 molybdenum cofactor synthesis 3 1 1
MIRT686673 TMEM120B transmembrane protein 120B 1 1
MIRT687126 QPCTL glutaminyl-peptide cyclotransferase-like 1 1
MIRT687747 KIAA1328 KIAA1328 1 1
MIRT688070 GLUL glutamate-ammonia ligase 1 1
MIRT688777 CDH7 cadherin 7, type 2 1 1
MIRT688950 ATXN3 ataxin 3 1 1
MIRT689692 TMPRSS12 transmembrane (C-terminal) protease, serine 12 1 1
MIRT689747 PRR13 proline rich 13 1 1
MIRT689943 MANSC1 MANSC domain containing 1 1 1
MIRT690100 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT690198 C5orf45 chromosome 5 open reading frame 45 1 1
MIRT690256 CAMLG calcium modulating ligand 1 1
MIRT690427 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT691119 ADIPOQ adiponectin, C1Q and collagen domain containing 1 1
MIRT691239 DFNB59 deafness, autosomal recessive 59 1 1
MIRT691306 ZNF681 zinc finger protein 681 1 1
MIRT691375 GP5 glycoprotein V (platelet) 1 1
MIRT691810 WARS tryptophanyl-tRNA synthetase 1 1
MIRT692154 CEP104 centrosomal protein 104kDa 1 1
MIRT692355 AGTRAP angiotensin II receptor-associated protein 1 1
MIRT692583 NCMAP noncompact myelin associated protein 1 1
MIRT692657 ZMYM1 zinc finger, MYM-type 1 1 1
MIRT692753 NDUFS5 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) 1 1
MIRT693102 SCNM1 sodium channel modifier 1 1 1
MIRT693262 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT693304 SYTL3 synaptotagmin-like 3 1 1
MIRT693397 ZNF460 zinc finger protein 460 1 1
MIRT693495 MOB3A MOB kinase activator 3A 1 1
MIRT693542 ZNF708 zinc finger protein 708 1 1
MIRT693570 PIGR polymeric immunoglobulin receptor 1 1
MIRT694497 AGBL5 ATP/GTP binding protein-like 5 1 1
MIRT694742 LLGL1 lethal giant larvae homolog 1 (Drosophila) 1 1
MIRT694873 ZNF417 zinc finger protein 417 1 1
MIRT695080 ZNF17 zinc finger protein 17 1 1
MIRT695465 COX18 cytochrome c oxidase assembly homolog 18 (yeast) 1 1
MIRT695731 ZNF117 zinc finger protein 117 1 1
MIRT695906 MED16 mediator complex subunit 16 1 1
MIRT696270 TACO1 translational activator of mitochondrially encoded cytochrome c oxidase I 1 1
MIRT696520 C3 complement component 3 1 1
MIRT696571 TTC21B tetratricopeptide repeat domain 21B 1 1
MIRT696653 AGXT2 alanine--glyoxylate aminotransferase 2 1 1
MIRT696799 DHODH dihydroorotate dehydrogenase (quinone) 1 1
MIRT696829 PLLP plasmolipin 1 1
MIRT696973 CCDC80 coiled-coil domain containing 80 1 1
MIRT697093 GPKOW G patch domain and KOW motifs 1 1
MIRT697171 INMT indolethylamine N-methyltransferase 1 1
MIRT697214 ZYG11A zyg-11 homolog A (C. elegans) 1 1
MIRT697340 ZNF641 zinc finger protein 641 1 1
MIRT697590 YME1L1 YME1-like 1 (S. cerevisiae) 1 1
MIRT698627 TES testis derived transcript (3 LIM domains) 1 1
MIRT698958 SPAST spastin 1 1
MIRT699092 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT699440 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT699562 SIT1 signaling threshold regulating transmembrane adaptor 1 1 1
MIRT700334 RAB4A RAB4A, member RAS oncogene family 1 1
MIRT700366 RAB33B RAB33B, member RAS oncogene family 1 1
MIRT700467 PURB purine-rich element binding protein B 1 1
MIRT701688 MYADM myeloid-associated differentiation marker 1 1
MIRT701766 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT703187 GPBP1 GC-rich promoter binding protein 1 1 1
MIRT703214 GOLGA3 golgin A3 1 1
MIRT703370 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT703434 FYTTD1 forty-two-three domain containing 1 1 1
MIRT703610 FBXO45 F-box protein 45 1 1
MIRT703709 FAM134A family with sequence similarity 134, member A 1 1
MIRT703819 EVI5 ecotropic viral integration site 5 1 1
MIRT703923 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT704243 DHDDS dehydrodolichyl diphosphate synthase 1 1
MIRT704654 CLCC1 chloride channel CLIC-like 1 1 1
MIRT704940 CCDC120 coiled-coil domain containing 120 1 1
MIRT705169 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT705539 ARL10 ADP-ribosylation factor-like 10 1 1
MIRT705669 ANKRD40 ankyrin repeat domain 40 1 1
MIRT706152 ZNF674 zinc finger protein 674 1 1
MIRT706481 SNX27 sorting nexin family member 27 1 1
MIRT708785 CD200R1 CD200 receptor 1 1 1
MIRT708846 SCAND3 SCAN domain containing 3 1 1
MIRT709845 SNX12 sorting nexin 12 1 1
MIRT710446 BTNL3 butyrophilin-like 3 1 1
MIRT711093 OGG1 8-oxoguanine DNA glycosylase 1 1
MIRT711335 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT713370 STK35 serine/threonine kinase 35 1 1
MIRT717126 SOWAHA sosondowah ankyrin repeat domain family member A 1 1
MIRT717410 ZCCHC24 zinc finger, CCHC domain containing 24 1 1
MIRT722233 ZNF503 zinc finger protein 503 1 1
MIRT722671 RRM2 ribonucleotide reductase M2 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*