Accession ID: MIRT005371 [miRNA, hsa-miR-146b-5p :: KIT, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-146bLinkOut: [miRBase ]
Description Homo sapiens miR-146b stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-146b-5p
Mature Sequence 9| UGAGAACUGAAUUCCAUAGGCU |30
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-146b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KIT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-Kit, CD117, PBT, SCFR
Description v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Transcript NM_0002    LinkOut: [ RefSeq ]
Other Transcripts NM_0010937   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KIT LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KIT
(miRNA target sites are highlighted)
>KIT|NM_0002|3'UTR
   1 GCAGAATCAGTGTTTGGGTCACCCCTCCAGGAATGATCTCTTCTTTTGGCTTCCATGATGGTTATTTTCTTTTCTTTCAA
  81 CTTGCATCCAACTCCAGGATAGTGGGCACCCCACTGCAATCCTGTCTTTCTGAGCACACTTTAGTGGCCGATGATTTTTG
 161 TCATCAGCCACCATCCTATTGCAAAGGTTCCAACTGTATATATTCCCAATAGCAACGTAGCTTCTACCATGAACAGAAAA
 241 CATTCTGATTTGGAAAAAGAGAGGGAGGTATGGACTGGGGGCCAGAGTCCTTTCCAAGGCTTCTCCAATTCTGCCCAAAA
 321 ATATGGTTGATAGTTTACCTGAATAAATGGTAGTAATCACAGTTGGCCTTCAGAACCATCCATAGTAGTATGATGATACA
 401 AGATTAGAAGCTGAAAACCTAAGTCCTTTATGTGGAAAACAGAACATCATTAGAACAAAGGACAGAGTATGAACACCTGG
 481 GCTTAAGAAATCTAGTATTTCATGCTGGGAATGAGACATAGGCCATGAAAAAAATGATCCCCAAGTGTGAACAAAAGATG
 561 CTCTTCTGTGGACCACTGCATGAGCTTTTATACTACCGACCTGGTTTTTAAATAGAGTTTGCTATTAGAGCATTGAATTG
 641 GAGAGAAGGCCTCCCTAGCCAGCACTTGTATATACGCATCTATAAATTGTCCGTGTTCATACATTTGAGGGGAAAACACC
 721 ATAAGGTTTCGTTTCTGTATACAACCCTGGCATTATGTCCACTGTGTATAGAAGTAGATTAAGAGCCATATAAGTTTGAA
 801 GGAAACAGTTAATACCATTTTTTAAGGAAACAATATAACCACAAAGCACAGTTTGAACAAAATCTCCTCTTTTAGCTGAT
 881 GAACTTATTCTGTAGATTCTGTGGAACAAGCCTATCAGCTTCAGAATGGCATTGTACTCAATGGATTTGATGCTGTTTGA
 961 CAAAGTTACTGATTCACTGCATGGCTCCCACAGGAGTGGGAAAACACTGCCATCTTAGTTTGGATTCTTATGTAGCAGGA
1041 AATAAAGTATAGGTTTAGCCTCCTTCGCAGGCATGTCCTGGACACCGGGCCAGTATCTATATATGTGTATGTACGTTTGT
1121 ATGTGTGTAGACAAATATTTGGAGGGGTATTTTTGCCCTGAGTCCAAGAGGGTCCTTTAGTACCTGAAAAGTAACTTGGC
1201 TTTCATTATTAGTACTGCTCTTGTTTCTTTTCACATAGCTGTCTAGAGTAGCTTACCAGAAGCTTCCATAGTGGTGCAGA
1281 GGAAGTGGAAGGCATCAGTCCCTATGTATTTGCAGTTCACCTGCACTTAAGGCACTCTGTTATTTAGACTCATCTTACTG
1361 TACCTGTTCCTTAGACCTTCCATAATGCTACTGTCTCACTGAAACATTTAAATTTTACCCTTTAGACTGTAGCCTGGATA
1441 TTATTCTTGTAGTTTACCTCTTTAAAAACAAAACAAAACAAAACAAAAAACTCCCCTTCCTCACTGCCCAATATAAAAGG
1521 CAAATGTGTACATGGCAGAGTTTGTGTGTTGTCTTGAAAGATTCAGGTATGTTGCCTTTATGGTTTCCCCCTTCTACATT
1601 TCTTAGACTACATTTAGAGAACTGTGGCCGTTATCTGGAAGTAACCATTTGCACTGGAGTTCTATGCTCTCGCACCTTTC
1681 CAAAGTTAACAGATTTTGGGGTTGTGTTGTCACCCAAGAGATTGTTGTTTGCCATACTTTGTCTGAAAAATTCCTTTGTG
1761 TTTCTATTGACTTCAATGATAGTAAGAAAAGTGGTTGTTAGTTATAGATGTCTAGGTACTTCAGGGGCACTTCATTGAGA
1841 GTTTTGTCTTGGATATTCTTGAAAGTTTATATTTTTATAATTTTTTCTTACATCAGATGTTTCTTTGCAGTGGCTTAATG
1921 TTTGAAATTATTTTGTGGCTTTTTTTGTAAATATTGAAATGTAGCAATAATGTCTTTTGAATATTCCCAAGCCCATGAGT
2001 CCTTGAAAATATTTTTTATATATACAGTAACTTTATGTGTAAATACATAAGCGGCGTAAGTTTAAAGGATGTTGGTGTTC
2081 CACGTGTTTTATTCCTGTATGTTGTCCAATTGTTGACAGTTCTGAAGAATTCTAATAAAATGTACATATATAAATCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucGGAUACCUUAA-GUCAAGAGu 5'
            |||||| | || |||||| | 
Target 5' tcCCTATGTATTTGCAGTTCACc 3'
1299 - 1321 144.00 -13.60
2
miRNA  3' ucgGAUACCUUAA-----GUCAAGAgu 5'
             :|:|  ||||     |||||||  
Target 5' atgTTGTCCAATTGTTGACAGTTCTga 3'
2099 - 2125 135.00 -9.60
3
miRNA  3' ucGGAUACCUUAAGUCAAGAgu 5'
            | | || | |  ||||||  
Target 5' acCATTTGCACTGGAGTTCTat 3'
1644 - 1665 132.00 -8.47
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-146b-5p :: KIT    [ Functional MTI ]
Validation Method Northern blot , qRT-PCR , Western blot , Other
Conditions PTC
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... Both forms of Kit were readily detected in normal thyroid tissue but were strongly reduced or absent in the four samples showing strong reduction of KIT transcript.//strong overexpression of miRs-221, -222, and -146b in these four PTC patient samples. ...

- He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al., 2005, Proc Natl Acad Sci U S A.

Article - He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al.
- Proc Natl Acad Sci U S A, 2005
Apart from alterations in the RET/PTC-RAS-BRAF pathway, comparatively little is known about the genetics of papillary thyroid carcinoma (PTC). We show that numerous microRNAs (miRNAs) are transcriptionally up-regulated in PTC tumors compared with unaffected thyroid tissue. A set of five miRNAs, including the three most up-regulated ones (miR-221, -222, and -146), distinguished unequivocally between PTC and normal thyroid. Additionally, miR-221 was up-regulated in unaffected thyroid tissue in several PTC patients, presumably an early event in carcinogenesis. Tumors in which the up-regulation (11- to 19-fold) of miR-221, -222, and -146 was strongest showed dramatic loss of KIT transcript and Kit protein. In 5 of 10 such cases, this down expression was associated with germline single-nucleotide changes in the two recognition sequences in KIT for these miRNAs. We conclude that up-regulation of several miRs and regulation of KIT are involved in PTC pathogenesis, and that sequence changes in genes targeted by miRNAs can contribute to their regulation.
LinkOut: [PMID: 16365291]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
21 hsa-miR-146b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004530 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 2 1
MIRT004662 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT004887 MMP16 matrix metallopeptidase 16 (membrane-inserted) 4 2
MIRT005371 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 3 1
MIRT005374 Card10 caspase recruitment domain family, member 10 3 1
MIRT005392 Scube2 signal peptide, CUB domain, EGF-like 2 3 1
MIRT005394 TRAF6 TNF receptor-associated factor 6, E3 ubiquitin protein ligase 4 1
MIRT005395 IRAK1 interleukin-1 receptor-associated kinase 1 4 1
MIRT041609 COX1 cytochrome c oxidase subunit I 1 1
MIRT041610 POMT2 protein-O-mannosyltransferase 2 1 1
MIRT041611 RHOA ras homolog family member A 1 1
MIRT041612 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT041613 XPO4 exportin 4 1 1
MIRT041614 OR8U1 olfactory receptor, family 8, subfamily U, member 1 1 1
MIRT041615 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT041616 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT041617 ATAD1 ATPase family, AAA domain containing 1 1 1
MIRT041618 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1
MIRT041619 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT041620 MLF1IP MLF1 interacting protein 1 1
MIRT041621 CARD11 caspase recruitment domain family, member 11 1 1