Accession ID: MIRT005371 [miRNA, hsa-miR-146b-5p :: KIT, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-146bLinkOut: [miRBase ]
Description Homo sapiens miR-146b stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-146b-5p
Mature Sequence 9| UGAGAACUGAAUUCCAUAGGCU |30
Evidence Experimental
Experiments Array-cloned
Putative hsa-miR-146b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol KIT LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms C-Kit, CD117, PBT, SCFR
Description v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Transcript NM_000222    LinkOut: [ RefSeq ]
Other Transcripts NM_001093772   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on KIT LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of KIT
(miRNA target sites are highlighted)
>KIT|NM_000222|3'UTR
   1 GCAGAATCAGTGTTTGGGTCACCCCTCCAGGAATGATCTCTTCTTTTGGCTTCCATGATGGTTATTTTCTTTTCTTTCAA
  81 CTTGCATCCAACTCCAGGATAGTGGGCACCCCACTGCAATCCTGTCTTTCTGAGCACACTTTAGTGGCCGATGATTTTTG
 161 TCATCAGCCACCATCCTATTGCAAAGGTTCCAACTGTATATATTCCCAATAGCAACGTAGCTTCTACCATGAACAGAAAA
 241 CATTCTGATTTGGAAAAAGAGAGGGAGGTATGGACTGGGGGCCAGAGTCCTTTCCAAGGCTTCTCCAATTCTGCCCAAAA
 321 ATATGGTTGATAGTTTACCTGAATAAATGGTAGTAATCACAGTTGGCCTTCAGAACCATCCATAGTAGTATGATGATACA
 401 AGATTAGAAGCTGAAAACCTAAGTCCTTTATGTGGAAAACAGAACATCATTAGAACAAAGGACAGAGTATGAACACCTGG
 481 GCTTAAGAAATCTAGTATTTCATGCTGGGAATGAGACATAGGCCATGAAAAAAATGATCCCCAAGTGTGAACAAAAGATG
 561 CTCTTCTGTGGACCACTGCATGAGCTTTTATACTACCGACCTGGTTTTTAAATAGAGTTTGCTATTAGAGCATTGAATTG
 641 GAGAGAAGGCCTCCCTAGCCAGCACTTGTATATACGCATCTATAAATTGTCCGTGTTCATACATTTGAGGGGAAAACACC
 721 ATAAGGTTTCGTTTCTGTATACAACCCTGGCATTATGTCCACTGTGTATAGAAGTAGATTAAGAGCCATATAAGTTTGAA
 801 GGAAACAGTTAATACCATTTTTTAAGGAAACAATATAACCACAAAGCACAGTTTGAACAAAATCTCCTCTTTTAGCTGAT
 881 GAACTTATTCTGTAGATTCTGTGGAACAAGCCTATCAGCTTCAGAATGGCATTGTACTCAATGGATTTGATGCTGTTTGA
 961 CAAAGTTACTGATTCACTGCATGGCTCCCACAGGAGTGGGAAAACACTGCCATCTTAGTTTGGATTCTTATGTAGCAGGA
1041 AATAAAGTATAGGTTTAGCCTCCTTCGCAGGCATGTCCTGGACACCGGGCCAGTATCTATATATGTGTATGTACGTTTGT
1121 ATGTGTGTAGACAAATATTTGGAGGGGTATTTTTGCCCTGAGTCCAAGAGGGTCCTTTAGTACCTGAAAAGTAACTTGGC
1201 TTTCATTATTAGTACTGCTCTTGTTTCTTTTCACATAGCTGTCTAGAGTAGCTTACCAGAAGCTTCCATAGTGGTGCAGA
1281 GGAAGTGGAAGGCATCAGTCCCTATGTATTTGCAGTTCACCTGCACTTAAGGCACTCTGTTATTTAGACTCATCTTACTG
1361 TACCTGTTCCTTAGACCTTCCATAATGCTACTGTCTCACTGAAACATTTAAATTTTACCCTTTAGACTGTAGCCTGGATA
1441 TTATTCTTGTAGTTTACCTCTTTAAAAACAAAACAAAACAAAACAAAAAACTCCCCTTCCTCACTGCCCAATATAAAAGG
1521 CAAATGTGTACATGGCAGAGTTTGTGTGTTGTCTTGAAAGATTCAGGTATGTTGCCTTTATGGTTTCCCCCTTCTACATT
1601 TCTTAGACTACATTTAGAGAACTGTGGCCGTTATCTGGAAGTAACCATTTGCACTGGAGTTCTATGCTCTCGCACCTTTC
1681 CAAAGTTAACAGATTTTGGGGTTGTGTTGTCACCCAAGAGATTGTTGTTTGCCATACTTTGTCTGAAAAATTCCTTTGTG
1761 TTTCTATTGACTTCAATGATAGTAAGAAAAGTGGTTGTTAGTTATAGATGTCTAGGTACTTCAGGGGCACTTCATTGAGA
1841 GTTTTGTCTTGGATATTCTTGAAAGTTTATATTTTTATAATTTTTTCTTACATCAGATGTTTCTTTGCAGTGGCTTAATG
1921 TTTGAAATTATTTTGTGGCTTTTTTTGTAAATATTGAAATGTAGCAATAATGTCTTTTGAATATTCCCAAGCCCATGAGT
2001 CCTTGAAAATATTTTTTATATATACAGTAACTTTATGTGTAAATACATAAGCGGCGTAAGTTTAAAGGATGTTGGTGTTC
2081 CACGTGTTTTATTCCTGTATGTTGTCCAATTGTTGACAGTTCTGAAGAATTCTAATAAAATGTACATATATAAATCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucGGAUACCUUAA-GUCAAGAGu 5'
            |||||| | || |||||| | 
Target 5' tcCCTATGTATTTGCAGTTCACc 3'
1299 - 1321 144.00 -13.60
2
miRNA  3' ucgGAUACCUUAA-----GUCAAGAgu 5'
             :|:|  ||||     |||||||  
Target 5' atgTTGTCCAATTGTTGACAGTTCTga 3'
2099 - 2125 135.00 -9.60
3
miRNA  3' ucGGAUACCUUAAGUCAAGAgu 5'
            | | || | |  ||||||  
Target 5' acCATTTGCACTGGAGTTCTat 3'
1644 - 1665 132.00 -8.47
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-146b-5p :: KIT    [ Functional MTI ]
Validation Method Northern blot , qRT-PCR , Western blot , Other
Conditions PTC
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... Both forms of Kit were readily detected in normal thyroid tissue but were strongly reduced or absent in the four samples showing strong reduction of KIT transcript.//strong overexpression of miRs-221, -222, and -146b in these four PTC patient samples. ...

- He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al., 2005, Proc Natl Acad Sci U S A.

Article - He, H. Jazdzewski, K. Li, W. Liyanarachchi, et al.
- Proc Natl Acad Sci U S A, 2005
Apart from alterations in the RET/PTC-RAS-BRAF pathway, comparatively little is known about the genetics of papillary thyroid carcinoma (PTC). We show that numerous microRNAs (miRNAs) are transcriptionally up-regulated in PTC tumors compared with unaffected thyroid tissue. A set of five miRNAs, including the three most up-regulated ones (miR-221, -222, and -146), distinguished unequivocally between PTC and normal thyroid. Additionally, miR-221 was up-regulated in unaffected thyroid tissue in several PTC patients, presumably an early event in carcinogenesis. Tumors in which the up-regulation (11- to 19-fold) of miR-221, -222, and -146 was strongest showed dramatic loss of KIT transcript and Kit protein. In 5 of 10 such cases, this down expression was associated with germline single-nucleotide changes in the two recognition sequences in KIT for these miRNAs. We conclude that up-regulation of several miRs and regulation of KIT are involved in PTC pathogenesis, and that sequence changes in genes targeted by miRNAs can contribute to their regulation.
LinkOut: [PMID: 16365291]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
106 hsa-miR-146b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004530 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 2 1
MIRT004662 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT004887 MMP16 matrix metallopeptidase 16 (membrane-inserted) 4 3
MIRT005371 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 3 1
MIRT005374 Card10 caspase recruitment domain family, member 10 3 1
MIRT005392 Scube2 signal peptide, CUB domain, EGF-like 2 3 1
MIRT005394 TRAF6 TNF receptor-associated factor 6, E3 ubiquitin protein ligase 4 1
MIRT005395 IRAK1 interleukin-1 receptor-associated kinase 1 5 2
MIRT041609 COX1 cytochrome c oxidase subunit I 1 1
MIRT041610 POMT2 protein-O-mannosyltransferase 2 1 1
MIRT041611 RHOA ras homolog family member A 1 1
MIRT041612 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT041613 XPO4 exportin 4 1 1
MIRT041614 OR8U1 olfactory receptor, family 8, subfamily U, member 1 1 1
MIRT041615 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT041616 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 1 1
MIRT041617 ATAD1 ATPase family, AAA domain containing 1 1 1
MIRT041618 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1
MIRT041619 NSFL1C NSFL1 (p97) cofactor (p47) 1 1
MIRT041620 MLF1IP MLF1 interacting protein 1 1
MIRT041621 CARD11 caspase recruitment domain family, member 11 1 1
MIRT053375 TLR4 toll-like receptor 4 2 1
MIRT053567 UHRF1 ubiquitin-like with PHD and ring finger domains 1 3 1
MIRT054833 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 3 1
MIRT081896 KCTD15 potassium channel tetramerisation domain containing 15 1 4
MIRT132298 ARL8A ADP-ribosylation factor-like 8A 1 1
MIRT166141 SQSTM1 sequestosome 1 1 2
MIRT387608 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT437621 S100A12 S100 calcium binding protein A12 2 1
MIRT437622 ZNF117 zinc finger protein 117 2 1
MIRT437623 MYO6 myosin VI 2 1
MIRT437624 CCDC6 coiled-coil domain containing 6 2 1
MIRT437625 IL1RAP interleukin 1 receptor accessory protein 2 1
MIRT437626 IL1RL2 interleukin 1 receptor-like 2 2 1
MIRT437903 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 2 1
MIRT438327 ZNRF3 zinc and ring finger 3 1 1
MIRT444061 SERPINA4 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4 1 1
MIRT445435 ESD esterase D 1 1
MIRT446132 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 1 1
MIRT446670 METTL7A methyltransferase like 7A 1 1
MIRT448042 SFRP1 secreted frizzled-related protein 1 1 1
MIRT448163 MKRN2 makorin ring finger protein 2 1 1
MIRT448602 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT449334 ACTBL2 actin, beta-like 2 1 1
MIRT450496 LIMD2 LIM domain containing 2 1 1
MIRT451935 TMPRSS5 transmembrane protease, serine 5 1 1
MIRT460083 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 1 1
MIRT462097 TMEM214 transmembrane protein 214 1 1
MIRT462356 BCL7B B-cell CLL/lymphoma 7B 1 1
MIRT467098 SRPRB signal recognition particle receptor, B subunit 1 3
MIRT468088 SHCBP1 SHC SH2-domain binding protein 1 1 1
MIRT469228 RHOBTB3 Rho-related BTB domain containing 3 1 1
MIRT469761 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT470475 PPP1R11 protein phosphatase 1, regulatory (inhibitor) subunit 11 1 1
MIRT472593 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 1
MIRT481368 ATG9A autophagy related 9A 1 1
MIRT487522 GXYLT2 glucoside xylosyltransferase 2 1 1
MIRT487735 MICAL2 microtubule associated monoxygenase, calponin and LIM domain containing 2 1 2
MIRT488423 COPA coatomer protein complex, subunit alpha 1 1
MIRT493740 GRAP2 GRB2-related adaptor protein 2 1 1
MIRT497303 CD300LB CD300 molecule-like family member b 1 1
MIRT501921 MBD4 methyl-CpG binding domain protein 4 1 2
MIRT510077 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 1 3
MIRT513661 TMEM136 transmembrane protein 136 1 1
MIRT532944 ZNF292 zinc finger protein 292 1 1
MIRT533310 USP48 ubiquitin specific peptidase 48 1 1
MIRT535151 PLEKHG5 pleckstrin homology domain containing, family G (with RhoGef domain) member 5 1 1
MIRT545339 CCDC83 coiled-coil domain containing 83 1 1
MIRT545674 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 1 1
MIRT549599 TMEM101 transmembrane protein 101 1 1
MIRT549868 ZNF260 zinc finger protein 260 1 1
MIRT551936 AKAP8 A kinase (PRKA) anchor protein 8 1 2
MIRT553542 TMEM167A transmembrane protein 167A 1 2
MIRT554519 RUFY2 RUN and FYVE domain containing 2 1 1
MIRT559118 C16orf52 chromosome 16 open reading frame 52 1 1
MIRT559373 ATP13A3 ATPase type 13A3 1 1
MIRT565760 SERTAD2 SERTA domain containing 2 1 1
MIRT566973 LBR lamin B receptor 1 1
MIRT567598 FANCF Fanconi anemia, complementation group F 1 1
MIRT572305 LSM4 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) 1 1
MIRT572490 BTN2A2 butyrophilin, subfamily 2, member A2 1 1
MIRT574443 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT609587 GPM6B glycoprotein M6B 1 1
MIRT610780 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT616848 ZNF629 zinc finger protein 629 1 1
MIRT623276 MDN1 MDN1, midasin homolog (yeast) 1 1
MIRT627840 POU3F1 POU class 3 homeobox 1 1 1
MIRT636160 TLL1 tolloid-like 1 1 1
MIRT647088 HORMAD2 HORMA domain containing 2 1 1
MIRT656234 MFSD6 major facilitator superfamily domain containing 6 1 1
MIRT658605 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 1 1
MIRT665508 UTP15 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) 1 1
MIRT668792 CYTIP cytohesin 1 interacting protein 1 2
MIRT681544 ZNF738 zinc finger protein 738 1 1
MIRT686026 UMPS uridine monophosphate synthetase 1 1
MIRT690325 MRPS30 mitochondrial ribosomal protein S30 1 1
MIRT693788 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT694256 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT695043 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 1 1
MIRT701166 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT704046 EDEM3 ER degradation enhancer, mannosidase alpha-like 3 1 1
MIRT704806 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT705301 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT709787 CYBRD1 cytochrome b reductase 1 1 1
MIRT717743 MYLK myosin light chain kinase 1 1
MIRT724690 DGCR6L DiGeorge syndrome critical region gene 6-like 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*