Accession ID: MIRT005412 [miRNA, hsa-miR-129-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-129-1LinkOut: [miRBase ]
Description Homo sapiens miR-129-1 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-129-5p
Mature Sequence 5| CUUUUUGCGGUCUGGGCUUGC |25
Evidence Experimental
Experiments Cloned
Putative hsa-miR-129-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_0176    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_0176|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgUUCGGGUC---UGGCGUUUUUc 5'
            |||: :||   |: |||:||| 
Target 5' ccAAGTATAGCCTATGGCAGAAAa 3'
1221 - 1244 139.00 -11.80
2
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            :||| :|| |  |||||| 
Target 5' acGAGCATAGTC--CAAAAAg 3'
409 - 427 130.00 -15.90
3
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            |||| : | ::|::|||| 
Target 5' gcAAGCAT-GCTTGTGAAAAt 3'
650 - 669 122.00 -9.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-129-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Other
Conditions SH-SY5Y
Location of target site 3'UTR
Original Description (Extracted from the article) ... overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. ...

- Fukuda, Y. Kawasaki, H. Taira, K., 2005, Nucleic Acids Symp Ser (Oxf).

Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
16 hsa-miR-129-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001953 CAMTA1 calmodulin binding transcription activator 1 2 1
MIRT001954 EIF2C3 eukaryotic translation initiation factor 2C, 3 2 1
MIRT004043 SOX4 SRY (sex determining region Y)-box 4 5 3
MIRT004049 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 3 2
MIRT004050 ETV6 ets variant 6 3 1
MIRT004051 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 3 1
MIRT005412 NOTCH1 notch 1 3 1
MIRT006660 UBE2F ubiquitin-conjugating enzyme E2F (putative) 1 1
MIRT007376 FMR1 fragile X mental retardation 1 1 1
MIRT026018 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT026019 TNPO1 transportin 1 1 1
MIRT026020 TP53INP1 tumor protein p53 inducible nuclear protein 1 1 1
MIRT026021 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT026022 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT048045 NSMF nasal embryonic LHRH factor 1 1
MIRT048046 HIST1H2BJ histone cluster 1, H2bj 1 1