Accession ID: MIRT005412 [miRNA, hsa-miR-129-5p :: NOTCH1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-129-1LinkOut: [miRBase ]
Description Homo sapiens miR-129-1 stem-loop
Comment This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-129-5p
Mature Sequence 5| CUUUUUGCGGUCUGGGCUUGC |25
Evidence Experimental
Experiments Cloned
Putative hsa-miR-129-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NOTCH1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms TAN1, hN1
Description notch 1
Transcript NM_017617    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NOTCH1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NOTCH1
(miRNA target sites are highlighted)
>NOTCH1|NM_017617|3'UTR
   1 ACGGCGCGCCCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATGCCAGGGCCGAC
  81 CAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACGAGGATTTTAATTTTTTTTAGTATTTATTTATGTA
 161 CTTTTATTTTACACAGAAACACTGCCTTTTTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATT
 241 CTGAGAAAACAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTATAAAATATAAA
 321 CAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTCAAAATCCAAAAAGAAATGATGTTGGAGAAGG
 401 GAAGTTGAACGAGCATAGTCCAAAAAGCTCCTGGGGCGTCCAGGCCGCGCCCTTTCCCCGACGCCCACCCAACCCCAAGC
 481 CAGCCCGGCCGCTCCACCAGCATCACCTGCCTGTTAGGAGAAGCTGCATCCAGAGGCAAACGGAGGCAAAGCTGGCTCAC
 561 CTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGA
 641 TGGTTTCTTGCAAGCATGCTTGTGAAAATGTGTTCTCGGAGTGTGTATGCCAAGAGTGCACCCATGGTACCAATCATGAA
 721 TCTTTGTTTCAGGTTCAGTATTATGTAGTTGTTCGTTGGTTATACAAGTTCTTGGTCCCTCCAGAACCACCCCGGCCCCC
 801 TGCCCGTTCTTGAAATGTAGGCATCATGCATGTCAAACATGAGATGTGTGGACTGTGGCACTTGCCTGGGTCACACACGG
 881 AGGCATCCTACCCTTTTCTGGGGAAAGACACTGCCTGGGCTGACCCCGGTGGCGGCCCCAGCACCTCAGCCTGCACAGTG
 961 TCCCCCAGGTTCCGAAGAAGATGCTCCAGCAACACAGCCTGGGCCCCAGCTCGCGGGACCCGACCCCCCGTGGGCTCCCG
1041 TGTTTTGTAGGAGACTTGCCAGAGCCGGGCACATTGAGCTGTGCAACGCCGTGGGCTGCGTCCTTTGGTCCTGTCCCCGC
1121 AGCCCTGGCAGGGGGCATGCGGTCGGGCAGGGGCTGGAGGGAGGCGGGGGCTGCCCTTGGGCCACCCCTCCTAGTTTGGG
1201 AGGAGCAGATTTTTGCAATACCAAGTATAGCCTATGGCAGAAAAAATGTCTGTAAATATGTTTTTAAAGGTGGATTTTGT
1281 TTAAAAAATCTTAATGAATGAGTCTGTTGTGTGTCATGCCAGTGAGGGACGTCAGACTTGGCTCAGCTCGGGGAGCCTTA
1361 GCCGCCCATGCACTGGGGACGCTCCGCTGCCGTGCCGCCTGCACTCCTCAGGGCAGCCTCCCCCGGCTCTACGGGGGCCG
1441 CGTGGTGCCATCCCCAGGGGGCATGACCAGATGCGTCCCAAGATGTTGATTTTTACTGTGTTTTATAAAATAGAGTGTAG
1521 TTTACAGAAAAAGACTTTAAAAGTGATCTACATGAGGAACTGTAGATGATGTATTTTTTTCATCTTTTTTGTTAACTGAT
1601 TTGCAATAAAAATGATACTGATGGTGA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' cgUUCGGGUC---UGGCGUUUUUc 5'
            |||: :||   |: |||:||| 
Target 5' ccAAGTATAGCCTATGGCAGAAAa 3'
1221 - 1244 139.00 -11.80
2
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            :||| :|| |  |||||| 
Target 5' acGAGCATAGTC--CAAAAAg 3'
409 - 427 130.00 -15.90
3
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            |||| : | ::|::|||| 
Target 5' gcAAGCAT-GCTTGTGAAAAt 3'
650 - 669 122.00 -9.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-129-5p :: NOTCH1    [ Functional MTI ]
Validation Method Luciferase reporter assay , Microarray , Other
Conditions SH-SY5Y
Location of target site 3'UTR
Original Description (Extracted from the article) ... overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. ...

- Fukuda, Y. Kawasaki, H. Taira, K., 2005, Nucleic Acids Symp Ser (Oxf).

Article - Fukuda, Y. Kawasaki, H. Taira, K.
- Nucleic Acids Symp Ser (Oxf), 2005
MicroRNAs (miRNAs) are endogenous non-coding RNA molecules that inhibit protein translation in a sequence specific manner. We carried out microarray analyses of 180 human pre-miRNAs in neuroblastoma cell, SH-SY5Y, following stimulation by TPA. Twelve of the pre-miRNAs were up-regulated by the TPA stimulation. We also explored miRNA target genes associated with neuronal differentiation. Some miRNAs have complementarity with 3'UTR of the Notch1 gene, a regulator of neuronal differentiation, and luciferase assay showed that overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. Our results suggest that miRNAs can be associated with TPA induced signalling pathways and expression of Notch1 gene.
LinkOut: [PMID: 17150773]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
387 hsa-miR-129-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001953 CAMTA1 calmodulin binding transcription activator 1 2 1
MIRT001954 EIF2C3 eukaryotic translation initiation factor 2C, 3 2 1
MIRT004043 SOX4 SRY (sex determining region Y)-box 4 6 9
MIRT004049 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 3 2
MIRT004050 ETV6 ets variant 6 3 1
MIRT004051 BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 3 1
MIRT005412 NOTCH1 notch 1 3 1
MIRT006660 UBE2F ubiquitin-conjugating enzyme E2F (putative) 1 1
MIRT007376 FMR1 fragile X mental retardation 1 1 1
MIRT026018 PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) 1 1
MIRT026019 TNPO1 transportin 1 1 1
MIRT026020 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 3
MIRT026021 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT026022 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT048045 NSMF nasal embryonic LHRH factor 1 1
MIRT048046 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT053575 CDK6 cyclin-dependent kinase 6 2 1
MIRT054128 BDKRB2 bradykinin receptor B2 2 1
MIRT054152 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 4 1
MIRT054153 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 4 1
MIRT054154 ABCG1 ATP-binding cassette, sub-family G (WHITE), member 1 4 1
MIRT062826 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT071460 CALM1 calmodulin 1 (phosphorylase kinase, delta) 1 3
MIRT071780 RNF11 ring finger protein 11 1 1
MIRT073558 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT095977 DUSP1 dual specificity phosphatase 1 1 1
MIRT108438 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT109538 KLHL15 kelch-like 15 (Drosophila) 1 1
MIRT121568 APC adenomatous polyposis coli 1 1
MIRT183582 ZC3H11A zinc finger CCCH-type containing 11A 1 1
MIRT187423 SP1 Sp1 transcription factor 3 1
MIRT191756 ZNF410 zinc finger protein 410 1 1
MIRT193383 RORA RAR-related orphan receptor A 1 1
MIRT194564 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT202990 MAP3K2 mitogen-activated protein kinase kinase kinase 2 1 1
MIRT210704 RYBP RING1 and YY1 binding protein 1 1
MIRT217240 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT217788 HBS1L HBS1-like (S. cerevisiae) 1 1
MIRT226719 ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 1 2
MIRT284212 PAPD5 PAP associated domain containing 5 1 1
MIRT289012 SUMO2 SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) 1 1
MIRT290618 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT300266 PLEKHM3 pleckstrin homology domain containing, family M, member 3 1 1
MIRT301154 PTMA prothymosin, alpha 1 1
MIRT309648 CPE carboxypeptidase E 1 1
MIRT321653 ZNF655 zinc finger protein 655 1 1
MIRT326949 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 3
MIRT332037 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 1
MIRT344273 ZRANB2 zinc finger, RAN-binding domain containing 2 1 1
MIRT354677 CDV3 CDV3 homolog (mouse) 1 1
MIRT395981 GDNF glial cell derived neurotrophic factor 1 1
MIRT399635 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT405809 SIX1 SIX homeobox 1 1 1
MIRT438713 RET ret proto-oncogene 2 1
MIRT442154 DPY19L1 dpy-19-like 1 (C. elegans) 1 1
MIRT443995 METRN meteorin, glial cell differentiation regulator 1 2
MIRT446313 GM2A GM2 ganglioside activator 1 1
MIRT447279 LAPTM5 lysosomal protein transmembrane 5 1 1
MIRT450274 LMBRD2 LMBR1 domain containing 2 1 1
MIRT450659 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT454911 ANKEF1 ankyrin repeat domain 5 1 6
MIRT492384 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT497060 C6orf223 chromosome 6 open reading frame 223 1 1
MIRT497788 DTX3L deltex 3-like (Drosophila) 1 1
MIRT498114 PLEKHO1 pleckstrin homology domain containing, family O member 1 1 2
MIRT498499 FRK fyn-related kinase 1 1
MIRT498764 PARP15 poly (ADP-ribose) polymerase family, member 15 1 2
MIRT499092 DENND4C DENN/MADD domain containing 4C 1 4
MIRT499859 SVOP SV2 related protein homolog (rat) 1 6
MIRT503456 ZNF154 zinc finger protein 154 1 3
MIRT503534 LRRC55 leucine rich repeat containing 55 1 2
MIRT504948 ZNRF2 zinc and ring finger 2 1 3
MIRT505790 SATB1 SATB homeobox 1 1 2
MIRT507592 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1 2
MIRT508787 PSMB9 proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) 1 1
MIRT509887 RPS23 ribosomal protein S23 1 2
MIRT514264 ZNF519 zinc finger protein 519 1 1
MIRT517103 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT517191 OTUD6A OTU domain containing 6A 1 1
MIRT519280 SPCS1 signal peptidase complex subunit 1 homolog (S. cerevisiae) 1 1
MIRT519336 CACNG1 calcium channel, voltage-dependent, gamma subunit 1 1 2
MIRT519663 ZNF703 zinc finger protein 703 1 2
MIRT519793 ZNF226 zinc finger protein 226 1 1
MIRT522077 OCIAD2 OCIA domain containing 2 1 1
MIRT522115 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 2
MIRT522326 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 3
MIRT522866 KIAA1549 KIAA1549 1 1
MIRT525159 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT526258 CCDC169 coiled-coil domain containing 169 1 1
MIRT526968 PAX7 paired box 7 1 1
MIRT528211 METTL8 methyltransferase like 8 1 1
MIRT528408 OARD1 O-acyl-ADP-ribose deacylase 1 1 2
MIRT528735 RAB13 RAB13, member RAS oncogene family 1 1
MIRT531004 TDGF1P3 teratocarcinoma-derived growth factor 1 pseudogene 3 1 1
MIRT533039 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT533123 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 1 1
MIRT534079 SPRY4 sprouty homolog 4 (Drosophila) 1 1
MIRT534097 AZF1 azoospermia factor 1 1 1
MIRT536210 LZIC leucine zipper and CTNNBIP1 domain containing 1 2
MIRT536513 KCTD10 potassium channel tetramerisation domain containing 10 1 1
MIRT537666 EPB41L1 erythrocyte membrane protein band 4.1-like 1 1 1
MIRT538374 CRIM1 cysteine rich transmembrane BMP regulator 1 (chordin-like) 1 1
MIRT539580 RABAC1 Rab acceptor 1 (prenylated) 1 1
MIRT546869 RAB10 RAB10, member RAS oncogene family 1 3
MIRT549993 KIAA0408 KIAA0408 1 1
MIRT551230 COLEC10 collectin sub-family member 10 (C-type lectin) 1 1
MIRT552604 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT554173 SLC35E2B solute carrier family 35, member E2B 1 1
MIRT554244 SLBP stem-loop binding protein 1 1
MIRT554245 SLAIN2 SLAIN motif family, member 2 1 1
MIRT557254 HMGXB4 HMG box domain containing 4 1 1
MIRT560500 POGK pogo transposable element with KRAB domain 1 1
MIRT561172 TMEM30A transmembrane protein 30A 1 1
MIRT561622 SESN3 sestrin 3 1 1
MIRT562774 LINS lines homolog (Drosophila) 1 1
MIRT562860 PBOV1 prostate and breast cancer overexpressed 1 1 1
MIRT563124 ZNF215 zinc finger protein 215 1 1
MIRT564112 ZYG11B zyg-11 homolog B (C. elegans) 1 2
MIRT568562 AKAP10 A kinase (PRKA) anchor protein 10 1 1
MIRT568692 TRAF3 TNF receptor-associated factor 3 1 2
MIRT572277 RNF103-CHMP3 RNF103-CHMP3 readthrough 1 1
MIRT572338 CKAP2L cytoskeleton associated protein 2-like 1 2
MIRT572546 C7orf65 chromosome 7 open reading frame 65 1 1
MIRT572611 CNTLN centlein, centrosomal protein 1 1
MIRT572778 ZNF277 zinc finger protein 277 1 1
MIRT573167 CHMP3 charged multivesicular body protein 3 1 1
MIRT573200 TTC19 tetratricopeptide repeat domain 19 1 1
MIRT573257 DCAF10 DDB1 and CUL4 associated factor 10 1 1
MIRT573292 UFM1 ubiquitin-fold modifier 1 1 1
MIRT573354 PDE3A phosphodiesterase 3A, cGMP-inhibited 1 1
MIRT573995 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT574697 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT609760 SEC24D SEC24 family, member D (S. cerevisiae) 1 1
MIRT609887 C1S complement component 1, s subcomponent 1 1
MIRT609981 PPARA peroxisome proliferator-activated receptor alpha 1 1
MIRT610171 SEC14L4 SEC14-like 4 (S. cerevisiae) 1 1
MIRT611046 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 1 1
MIRT611183 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 1
MIRT611247 WIPF2 WAS/WASL interacting protein family, member 2 1 1
MIRT611269 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT611408 BOD1 biorientation of chromosomes in cell division 1 1 1
MIRT611512 ZNF25 zinc finger protein 25 1 1
MIRT611585 POTED POTE ankyrin domain family, member D 1 1
MIRT611868 GTF2H1 general transcription factor IIH, polypeptide 1, 62kDa 1 1
MIRT612191 CCDC77 coiled-coil domain containing 77 1 1
MIRT612297 ZFP14 zinc finger protein 14 homolog (mouse) 1 2
MIRT612323 TTPAL tocopherol (alpha) transfer protein-like 1 1
MIRT612324 TRPS1 trichorhinophalangeal syndrome I 1 1
MIRT612725 NOL4 nucleolar protein 4 1 1
MIRT613027 GABBR2 gamma-aminobutyric acid (GABA) B receptor, 2 1 1
MIRT613098 ESR1 estrogen receptor 1 1 1
MIRT613199 CLOCK clock homolog (mouse) 1 1
MIRT613245 CBX4 chromobox homolog 4 1 1
MIRT613561 YY2 YY2 transcription factor 1 1
MIRT613705 PRKCD protein kinase C, delta 1 1
MIRT613743 GPR155 G protein-coupled receptor 155 1 1
MIRT613750 UNKL unkempt homolog (Drosophila)-like 1 1
MIRT613758 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT613868 TMEM51 transmembrane protein 51 1 1
MIRT613974 LRRC40 leucine rich repeat containing 40 1 1
MIRT613987 NTNG2 netrin G2 1 1
MIRT614419 ZNF440 zinc finger protein 440 1 1
MIRT614440 WDR92 WD repeat domain 92 1 1
MIRT614470 ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif, 18 1 1
MIRT614552 KLHL5 kelch-like 5 (Drosophila) 1 1
MIRT614592 RIF1 RAP1 interacting factor homolog (yeast) 1 1
MIRT614652 NIPAL3 NIPA-like domain containing 3 1 1
MIRT614719 TEAD3 TEA domain family member 3 1 1
MIRT614792 RRAGC Ras-related GTP binding C 1 1
MIRT614871 PDE12 phosphodiesterase 12 1 1
MIRT614905 NPTX1 neuronal pentraxin I 1 1
MIRT614930 MARCH3 membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase 1 1
MIRT614954 KAT6B K(lysine) acetyltransferase 6B 1 1
MIRT614955 HOMER1 homer homolog 1 (Drosophila) 1 1
MIRT614976 GNAQ guanine nucleotide binding protein (G protein), q polypeptide 1 1
MIRT614995 GABRB1 gamma-aminobutyric acid (GABA) A receptor, beta 1 1 1
MIRT615003 FNIP2 folliculin interacting protein 2 1 1
MIRT615028 DUSP10 dual specificity phosphatase 10 1 1
MIRT615031 DIS3 DIS3 mitotic control homolog (S. cerevisiae) 1 1
MIRT615184 BRSK1 BR serine/threonine kinase 1 1 1
MIRT615292 ZNF793 zinc finger protein 793 1 1
MIRT615432 ZFP82 zinc finger protein 82 homolog (mouse) 1 1
MIRT615463 ARSD arylsulfatase D 1 1
MIRT615555 SAR1A SAR1 homolog A (S. cerevisiae) 1 1
MIRT615780 KIAA0319L KIAA0319-like 1 1
MIRT615792 FAM124A family with sequence similarity 124A 1 1
MIRT615879 MEMO1 mediator of cell motility 1 1 1
MIRT615991 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT616260 KANK4 KN motif and ankyrin repeat domains 4 1 1
MIRT616267 HOXD11 homeobox D11 1 1
MIRT616332 ZNF699 zinc finger protein 699 1 1
MIRT616484 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT616635 LRAT lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) 1 2
MIRT616839 PRKX protein kinase, X-linked 1 2
MIRT617007 C16orf52 chromosome 16 open reading frame 52 1 1
MIRT617209 CERS4 ceramide synthase 4 1 1
MIRT617347 ARSE arylsulfatase E (chondrodysplasia punctata 1) 1 1
MIRT617361 C21orf62 chromosome 21 open reading frame 62 1 1
MIRT617791 CHRM2 cholinergic receptor, muscarinic 2 1 1
MIRT618140 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 1 1
MIRT618533 TMEM241 transmembrane protein 241 1 1
MIRT618703 ESD esterase D 1 1
MIRT618933 SF3A3 splicing factor 3a, subunit 3, 60kDa 1 1
MIRT618992 COL9A2 collagen, type IX, alpha 2 1 1
MIRT619010 SLC2A6 solute carrier family 2 (facilitated glucose transporter), member 6 1 1
MIRT619270 CEP57L1 centrosomal protein 57kDa-like 1 1 1
MIRT619777 NRIP2 nuclear receptor interacting protein 2 1 1
MIRT620283 GLTP glycolipid transfer protein 1 1
MIRT620792 GATAD1 GATA zinc finger domain containing 1 1 1
MIRT620818 MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein 1 1
MIRT621064 IL12RB2 interleukin 12 receptor, beta 2 1 1
MIRT621106 TBRG4 transforming growth factor beta regulator 4 1 1
MIRT621150 MICALCL MICAL C-terminal like 1 1
MIRT622146 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT622342 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT622393 RSBN1 round spermatid basic protein 1 1 1
MIRT622932 PAK7 p21 protein (Cdc42/Rac)-activated kinase 7 1 1
MIRT622981 ONECUT3 one cut homeobox 3 1 1
MIRT623232 MLLT6 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 1 1
MIRT623323 MAN1C1 mannosidase, alpha, class 1C, member 1 1 1
MIRT623339 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 1 1
MIRT623385 LHX9 LIM homeobox 9 1 1
MIRT623425 KLF6 Kruppel-like factor 6 1 1
MIRT624076 EBF1 early B-cell factor 1 1 1
MIRT624540 BRI3BP BRI3 binding protein 1 1
MIRT624771 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT624846 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT624894 AAGAB alpha- and gamma-adaptin binding protein 1 1
MIRT625164 CCS copper chaperone for superoxide dismutase 1 1
MIRT625193 GSTCD glutathione S-transferase, C-terminal domain containing 1 1
MIRT625339 TAPBP TAP binding protein (tapasin) 1 1
MIRT625442 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT625814 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT626181 SRFBP1 serum response factor binding protein 1 1 1
MIRT626395 BID BH3 interacting domain death agonist 1 1
MIRT626867 PDGFRA platelet-derived growth factor receptor, alpha polypeptide 1 1
MIRT627504 ST8SIA3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT627745 RAD54L2 RAD54-like 2 (S. cerevisiae) 1 1
MIRT627864 PCDH19 protocadherin 19 1 1
MIRT628130 HMGB1 high mobility group box 1 1 1
MIRT630882 SLC25A33 solute carrier family 25 (pyrimidine nucleotide carrier), member 33 1 1
MIRT630936 VLDLR very low density lipoprotein receptor 1 1
MIRT630960 NGDN neuroguidin, EIF4E binding protein 1 1
MIRT634904 RAET1E retinoic acid early transcript 1E 1 1
MIRT635117 TMEM233 transmembrane protein 233 1 1
MIRT635604 ADAT1 adenosine deaminase, tRNA-specific 1 1 1
MIRT636028 REEP1 receptor accessory protein 1 1 1
MIRT636737 ADD3 adducin 3 (gamma) 1 1
MIRT636916 ZNF845 zinc finger protein 845 1 1
MIRT637047 RAB27A RAB27A, member RAS oncogene family 1 1
MIRT637114 C10orf111 chromosome 10 open reading frame 111 1 1
MIRT637598 ZNF554 zinc finger protein 554 1 1
MIRT637940 SIGLEC9 sialic acid binding Ig-like lectin 9 1 1
MIRT638008 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT638111 XIAP X-linked inhibitor of apoptosis 1 1
MIRT638186 TIMM8A translocase of inner mitochondrial membrane 8 homolog A (yeast) 1 1
MIRT638203 SPTLC2 serine palmitoyltransferase, long chain base subunit 2 1 1
MIRT638786 EI24 etoposide induced 2.4 mRNA 1 1
MIRT638901 CBX6 chromobox homolog 6 1 1
MIRT639436 SLC30A10 solute carrier family 30, member 10 1 1
MIRT639443 CTNNBL1 catenin, beta like 1 1 1
MIRT639496 TYW5 tRNA-yW synthesizing protein 5 1 1
MIRT639690 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT640997 GRAP2 GRB2-related adaptor protein 2 1 1
MIRT641401 SCN2B sodium channel, voltage-gated, type II, beta subunit 1 1
MIRT641476 EXPH5 exophilin 5 1 1
MIRT641612 DEFB118 defensin, beta 118 1 1
MIRT641667 CCNI cyclin I 1 1
MIRT642082 FBXL2 F-box and leucine-rich repeat protein 2 1 1
MIRT643178 HYPK huntingtin interacting protein K 1 1
MIRT643954 GALNT13 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13) 1 1
MIRT644152 GIN1 gypsy retrotransposon integrase 1 1 1
MIRT644204 CBS cystathionine-beta-synthase 1 1
MIRT644924 PTCD2 pentatricopeptide repeat domain 2 1 1
MIRT645959 TTF2 transcription termination factor, RNA polymerase II 1 1
MIRT647136 CYP27C1 cytochrome P450, family 27, subfamily C, polypeptide 1 1 1
MIRT647893 EPN2 epsin 2 1 1
MIRT649253 IMPA2 inositol(myo)-1(or 4)-monophosphatase 2 1 1
MIRT650262 NAA38 N(alpha)-acetyltransferase 38, NatC auxiliary subunit 1 1
MIRT650678 CD82 CD82 molecule 1 1
MIRT650931 CTNS cystinosin, lysosomal cystine transporter 1 1
MIRT651293 ZDHHC21 zinc finger, DHHC-type containing 21 1 1
MIRT651857 UNC5D unc-5 homolog D (C. elegans) 1 1
MIRT651991 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT652117 TRPM7 transient receptor potential cation channel, subfamily M, member 7 1 1
MIRT652258 TP63 tumor protein p63 1 1
MIRT652950 SYAP1 synapse associated protein 1 1 1
MIRT653533 SLC38A9 solute carrier family 38, member 9 1 1
MIRT654442 RASAL2 RAS protein activator like 2 1 1
MIRT654698 PRRC2B proline-rich coiled-coil 2B 1 1
MIRT655160 PHF21A PHD finger protein 21A 1 1
MIRT655410 PAN2 PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1
MIRT657042 KCNJ6 potassium inwardly-rectifying channel, subfamily J, member 6 1 1
MIRT659384 CPT1A carnitine palmitoyltransferase 1A (liver) 1 1
MIRT660286 BICC1 bicaudal C homolog 1 (Drosophila) 1 1
MIRT660641 ANKRD44 ankyrin repeat domain 44 1 1
MIRT661764 BIVM basic, immunoglobulin-like variable motif containing 1 1
MIRT663270 FAM107A family with sequence similarity 107, member A 1 1
MIRT663732 ZNF285 zinc finger protein 285 1 1
MIRT664934 TERF2 telomeric repeat binding factor 2 1 1
MIRT665825 TIMM8B translocase of inner mitochondrial membrane 8 homolog B (yeast) 1 1
MIRT666048 STON2 stonin 2 1 1
MIRT666421 SH2B3 SH2B adaptor protein 3 1 1
MIRT666655 RBM47 RNA binding motif protein 47 1 1
MIRT667443 MAPK14 mitogen-activated protein kinase 14 1 1
MIRT667661 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT667775 KCNIP3 Kv channel interacting protein 3, calsenilin 1 1
MIRT668359 FGD4 FYVE, RhoGEF and PH domain containing 4 1 1
MIRT668536 ERGIC1 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 1 1
MIRT668640 DYM dymeclin 1 1
MIRT670033 NFRKB nuclear factor related to kappaB binding protein 1 1
MIRT670401 ELP2 elongator acetyltransferase complex subunit 2 1 1
MIRT671111 ZNF573 zinc finger protein 573 1 1
MIRT671128 CD226 CD226 molecule 1 1
MIRT671144 ANKRD9 ankyrin repeat domain 9 1 1
MIRT671314 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 1 1
MIRT671328 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT671856 ZNF429 zinc finger protein 429 1 1
MIRT671962 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 1
MIRT672008 PXMP4 peroxisomal membrane protein 4, 24kDa 1 1
MIRT672053 KIAA0930 KIAA0930 1 1
MIRT672467 RTTN rotatin 1 1
MIRT672641 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 2
MIRT672659 GTF2H5 general transcription factor IIH, polypeptide 5 1 1
MIRT672733 ISCA2 iron-sulfur cluster assembly 2 homolog (S. cerevisiae) 1 1
MIRT672754 UBE2V2 ubiquitin-conjugating enzyme E2 variant 2 1 1
MIRT672838 ICOSLG inducible T-cell co-stimulator ligand 1 1
MIRT672916 LRRC2 leucine rich repeat containing 2 1 1
MIRT672982 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT673077 AK1 adenylate kinase 1 1 1
MIRT673142 C1orf50 chromosome 1 open reading frame 50 1 1
MIRT673302 UBE2G2 ubiquitin-conjugating enzyme E2G 2 1 1
MIRT673318 THAP1 THAP domain containing, apoptosis associated protein 1 1 1
MIRT673338 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT673553 PLA2G16 phospholipase A2, group XVI 1 1
MIRT673692 SGK494 uncharacterized serine/threonine-protein kinase SgK494 1 1
MIRT673719 EMCN endomucin 1 1
MIRT673839 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT673887 DCTN6 dynactin 6 1 1
MIRT674111 MTO1 mitochondrial translation optimization 1 homolog (S. cerevisiae) 1 1
MIRT674544 IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2 1 1
MIRT674578 SLC35B4 solute carrier family 35, member B4 1 1
MIRT674603 RBBP4 retinoblastoma binding protein 4 1 1
MIRT674823 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 1 1
MIRT674992 STRN3 striatin, calmodulin binding protein 3 1 1
MIRT675057 FGD6 FYVE, RhoGEF and PH domain containing 6 1 1
MIRT675071 CCR6 chemokine (C-C motif) receptor 6 1 1
MIRT675115 FSD2 fibronectin type III and SPRY domain containing 2 1 1
MIRT675157 YARS2 tyrosyl-tRNA synthetase 2, mitochondrial 1 1
MIRT675253 LPP LIM domain containing preferred translocation partner in lipoma 1 1
MIRT675433 LEAP2 liver expressed antimicrobial peptide 2 1 1
MIRT675686 PIWIL1 piwi-like 1 (Drosophila) 1 1
MIRT675771 YIPF4 Yip1 domain family, member 4 1 1
MIRT675882 SNAP29 synaptosomal-associated protein, 29kDa 1 1
MIRT676051 AUTS8 Autism, susceptibility to, 8 1 1
MIRT677922 SLC35E1 solute carrier family 35, member E1 1 1
MIRT679009 MTMR10 myotubularin related protein 10 1 1
MIRT679023 ZNF419 zinc finger protein 419 1 1
MIRT679391 IL10RB interleukin 10 receptor, beta 1 1
MIRT679406 GMCL1 germ cell-less, spermatogenesis associated 1 1 1
MIRT688348 EPT1 ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) 1 1
MIRT688448 DNAJC15 DnaJ (Hsp40) homolog, subfamily C, member 15 1 1
MIRT691423 PRICKLE4 prickle homolog 4 (Drosophila) 1 1
MIRT691986 TTC38 tetratricopeptide repeat domain 38 1 1
MIRT692497 SPIN4 spindlin family, member 4 1 1
MIRT694576 IGSF9B immunoglobulin superfamily, member 9B 1 1
MIRT702307 L1CAM L1 cell adhesion molecule 1 1
MIRT705916 ADAM17 ADAM metallopeptidase domain 17 1 1
MIRT706539 GJD2 gap junction protein, delta 2, 36kDa 1 1
MIRT707111 NWD1 NACHT and WD repeat domain containing 1 1 1
MIRT707357 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT707406 RRP7A ribosomal RNA processing 7 homolog A (S. cerevisiae) 1 1
MIRT707493 TSEN34 tRNA splicing endonuclease 34 homolog (S. cerevisiae) 1 1
MIRT709332 HNF4G hepatocyte nuclear factor 4, gamma 1 1
MIRT710637 GLUL glutamate-ammonia ligase 1 1
MIRT711042 CENPN centromere protein N 1 1
MIRT713358 SLITRK4 SLIT and NTRK-like family, member 4 1 1
MIRT714760 ZNF462 zinc finger protein 462 1 1
MIRT715645 USP6NL USP6 N-terminal like 1 1
MIRT717750 KCNRG potassium channel regulator 1 1
MIRT721704 ISY1 ISY1 splicing factor homolog (S. cerevisiae) 1 1
MIRT722253 POLQ polymerase (DNA directed), theta 1 1
MIRT723161 GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like 1 1
MIRT723764 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT724347 RNF165 ring finger protein 165 1 1
MIRT725091 TMEM120B transmembrane protein 120B 1 1
MIRT725427 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*