Accession ID: MIRT005418 [miRNA, hsa-miR-30d-5p :: TP53, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30dLinkOut: [miRBase ]
Description Homo sapiens miR-30d stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30d-5p
Mature Sequence 6| UGUAAACAUCCCCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Putative hsa-miR-30d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BCC7, LFS1, P53, TRP53
Description tumor protein p53
Transcript NM_001126114    LinkOut: [ RefSeq ]
Other Transcripts NM_001126112 , NM_000546 , NM_001126113 , NM_001126115 , NM_001126116 , NM_001126117   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP53 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_001126114|3'UTR
   1 AGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAAACT
  81 CGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAG
 161 GATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTC
 241 CCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGACAGC
 321 CTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGA
 401 AGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGG
 481 AGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGTTCT
 561 TGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTCCCT
 641 CACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATTGTG
 721 AGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAGGGT
 801 GCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTCAAG
 881 TCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATCCCA
 961 CACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCTTTT
1041 TTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTGATC
1121 TTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTCATG
1201 CCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCCTGG
1281 GCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGGTCA
1361 ACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTTTTA
1441 TATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaAGGUCAGCCCCUACAAAUgu 5'
            | | ||  |||||||||:  
Target 5' ttTACTGTGAGGGATGTTTGgg 3'
521 - 542 132.00 -15.70
2
miRNA  3' gaAGGUCAG-CCCCUA-CAAAUGu 5'
            | ||||:  ||| | |||||| 
Target 5' ctTGCAGTTAAGGGTTAGTTTACa 3'
559 - 582 132.00 -17.60
3
miRNA  3' gaAGGUCAGCCC--CUACAAAUgu 5'
            | ||||:|||  | || |||  
Target 5' tcTACAGTTGGGCAGCTGGTTAgg 3'
840 - 863 118.00 -12.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30d-5p :: TP53    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions 293T , H1299 , HCT116 , HCT116p53 , H929 , MM1.s
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , RNA22 , TargetScan
Original Description (Extracted from the article) ... miRNAs (miR-25 and miR-30d) directly target the 3'UTR of TP53 to downregulate p53 protein levels and reduce the expression of genes that are transcriptionally activated by p53 ...

- Kumar, M. Lu, Z. Takwi, A. A. Chen, W. et al., 2011, Oncogene.

Article - Kumar, M. Lu, Z. Takwi, A. A. Chen, W. et al.
- Oncogene, 2011
The tumor suppressor p53, encoded by the TP53 gene, is recognized as the guardian of the human genome because it regulates many downstream genes to exercise its function in cell cycle and cell death. Recent studies have revealed that several microRNAs (miRNAs) are important components of the p53 tumor suppressor network with miR-125b and miR-504 directly targeting TP53. In this study, we use a screening method to identify that two miRNAs (miR-25 and miR-30d) directly target the 3'UTR of TP53 to downregulate p53 protein levels and reduce the expression of genes that are transcriptionally activated by p53. Correspondingly, both miR-25 and miR-30d adversely affect apoptotic cell death, cell cycle arrest and cellular senescence. Inhibition of either miR-25 or miR-30d expression increases endogenous p53 expression and elevates cellular apoptosis in several cell lines, including one from multiple myeloma that has little TP53 mutations. Thus, beyond miR-125b and miR-504, the human TP53 gene is negatively regulated by two more miRNAs: miR-25 and miR-30d.
LinkOut: [PMID: 20935678]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30d-5p :: TP53    [ Functional MTI ]
Validation Method
Article - Wu, J. Zheng, C. Fan, Y. Zeng, C. Chen, Z. et al.
- J Am Soc Nephrol, 2013
MicroRNAs (miRNAs) are essential for podocyte homeostasis, and the miR-30 family may be responsible for this action. However, the exact roles and clinical relevance of miR-30s remain unknown. In this study, we examined the expression of the miR-30 family in the podocytes of patients with FSGS and found that all members are downregulated. Treating cultured human podocytes with TGF-beta, LPS, or puromycin aminonucleoside (PAN) also downregulated the miR-30 family. Podocyte cytoskeletal damage and apoptosis caused by treatment with TGF-beta or PAN were ameliorated by exogenous miR-30 expression and aggravated by miR-30 knockdown. Moreover, we found that miR-30s exert their protective roles by direct inhibition of Notch1 and p53, which mediate podocyte injury. In rats, treatment with PAN substantially downregulated podocyte miR-30s and induced proteinuria and podocyte injury; however, transfer of exogenous miR-30a to podocytes of PAN-treated rats ameliorated proteinuria and podocyte injury and reduced Notch1 activation. Finally, we demonstrated that glucocorticoid treatment maintains miR-30 expression in cultured podocytes treated with TGF-beta, LPS, or PAN and in the podocytes of PAN-treated rats. Glucocorticoid-sustained miR-30 expression associated with reduced Notch1 activation and alleviated podocyte damage. Taken together, these findings demonstrate that miR-30s protect podocytes by targeting Notch1 and p53 and that the loss of miR-30s facilitates podocyte injury. In addition, sustained miR-30 expression may be a novel mechanism underlying the therapeutic effectiveness of glucocorticoids in treating podocytopathy.
LinkOut: [PMID: 24029422]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
353 hsa-miR-30d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003274 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 4 2
MIRT005418 TP53 tumor protein p53 4 2
MIRT006240 CASP3 caspase 3, apoptosis-related cysteine peptidase 3 2
MIRT006322 SMAD1 SMAD family member 1 2 1
MIRT006608 Snai1 snail homolog 1 (Drosophila) 1 1
MIRT006763 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT006920 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT007057 GPR78 G protein-coupled receptor 78 1 1
MIRT025969 RUNX2 runt-related transcription factor 2 2 1
MIRT047776 FAM60A family with sequence similarity 60, member A 1 1
MIRT047777 EXOC2 exocyst complex component 2 1 1
MIRT047778 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT047779 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047780 IRF2 interferon regulatory factor 2 1 1
MIRT047781 SENP2 SUMO1/sentrin/SMT3 specific peptidase 2 1 1
MIRT047782 TAF1C TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa 1 1
MIRT047783 KLF14 Kruppel-like factor 14 1 1
MIRT047784 HOXA11 homeobox A11 1 1
MIRT047785 DENND5A DENN/MADD domain containing 5A 1 1
MIRT047786 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047787 SMEK1 SMEK homolog 1, suppressor of mek1 (Dictyostelium) 1 1
MIRT047788 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT047789 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT047790 RREB1 ras responsive element binding protein 1 1 1
MIRT047791 ZNF609 zinc finger protein 609 1 1
MIRT047792 TAB1 TGF-beta activated kinase 1/MAP3K7 binding protein 1 1 1
MIRT047793 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT047794 ADC arginine decarboxylase 1 1
MIRT047795 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT047796 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT047797 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT047798 RPLP0 ribosomal protein, large, P0 1 1
MIRT047799 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT047800 RAB35 RAB35, member RAS oncogene family 1 1
MIRT047801 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT047802 FNIP1 folliculin interacting protein 1 1 1
MIRT047803 SLC27A1 solute carrier family 27 (fatty acid transporter), member 1 1 1
MIRT047804 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT047805 SRSF9 serine/arginine-rich splicing factor 9 1 1
MIRT047806 RPN2 ribophorin II 1 1
MIRT047807 HDHD3 haloacid dehalogenase-like hydrolase domain containing 3 1 1
MIRT047808 MAP1B microtubule-associated protein 1B 1 1
MIRT047809 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT047810 RPS17 ribosomal protein S17 1 1
MIRT047811 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT047812 C10orf137 chromosome 10 open reading frame 137 1 1
MIRT047813 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT047814 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT047815 FBN2 fibrillin 2 1 1
MIRT047816 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT047817 DROSHA drosha, ribonuclease type III 1 1
MIRT047818 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT047819 ZNF227 zinc finger protein 227 1 1
MIRT047820 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT047821 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT047822 NMT1 N-myristoyltransferase 1 1 1
MIRT047823 FKTN fukutin 1 1
MIRT047824 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT047825 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT047826 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT047827 MED28 mediator complex subunit 28 1 1
MIRT047828 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT053037 SOCS1 suppressor of cytokine signaling 1 3 4
MIRT054617 BCL9 B-cell CLL/lymphoma 9 3 1
MIRT057357 PCGF5 polycomb group ring finger 5 1 1
MIRT057484 KIF11 kinesin family member 11 1 2
MIRT057674 LCOR ligand dependent nuclear receptor corepressor 1 1
MIRT059173 SLC35C1 solute carrier family 35, member C1 1 1
MIRT067977 TFDP1 transcription factor Dp-1 1 3
MIRT068115 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT068387 S100PBP S100P binding protein 1 1
MIRT069734 FOXG1 forkhead box G1 1 2
MIRT074375 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT075440 PSMD7 proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 1 3
MIRT079944 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 2
MIRT080958 LRRC8B leucine rich repeat containing 8 family, member B 1 1
MIRT081079 LDLR low density lipoprotein receptor 1 1
MIRT081714 ZNF507 zinc finger protein 507 1 2
MIRT082853 ZNF543 zinc finger protein 543 1 2
MIRT084234 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT087147 HIC2 hypermethylated in cancer 2 1 4
MIRT088446 LCLAT1 lysocardiolipin acyltransferase 1 1 1
MIRT088681 EML4 echinoderm microtubule associated protein like 4 1 2
MIRT088935 ASB3 ankyrin repeat and SOCS box containing 3 1 1
MIRT090504 SLC35G2 solute carrier family 35, member G2 1 1
MIRT091577 FBXO45 F-box protein 45 1 1
MIRT095097 SEC24A SEC24 family, member A (S. cerevisiae) 1 1
MIRT096079 SFXN1 sideroflexin 1 1 1
MIRT098037 SOBP sine oculis binding protein homolog (Drosophila) 1 1
MIRT099797 SOX4 SRY (sex determining region Y)-box 4 1 2
MIRT100764 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 1 2
MIRT100909 CD2AP CD2-associated protein 1 1
MIRT103195 SP4 Sp4 transcription factor 1 4
MIRT104521 PEG10 paternally expressed 10 1 1
MIRT105031 FAM91A1 family with sequence similarity 91, member A1 1 1
MIRT106745 RAD23B RAD23 homolog B (S. cerevisiae) 1 1
MIRT110576 KIF5B kinesin family member 5B 1 3
MIRT115922 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 1 1
MIRT118143 ZNF264 zinc finger protein 264 1 1
MIRT128243 STRIP1 striatin interacting protein 1 1 1
MIRT131795 CEP350 centrosomal protein 350kDa 1 1
MIRT131859 IER5 immediate early response 5 1 1
MIRT134331 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT135676 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT136215 STX12 syntaxin 12 1 1
MIRT137018 WDFY2 WD repeat and FYVE domain containing 2 1 1
MIRT137123 TPRG1L tumor protein p63 regulated 1-like 1 1
MIRT138280 RNF220 ring finger protein 220 1 1
MIRT139248 JDP2 Jun dimerization protein 2 1 1
MIRT140635 PLEKHO2 pleckstrin homology domain containing, family O member 2 1 1
MIRT140879 GLCE glucuronic acid epimerase 1 1
MIRT142588 IL21R interleukin 21 receptor 1 2
MIRT143349 PAPD5 PAP associated domain containing 5 1 1
MIRT144537 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT145449 RNF135 ring finger protein 135 1 1
MIRT148352 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 1 1
MIRT149116 LRRC8D leucine rich repeat containing 8 family, member D 1 1
MIRT150761 MAST3 microtubule associated serine/threonine kinase 3 1 1
MIRT152413 ARID3A AT rich interactive domain 3A (BRIGHT-like) 1 2
MIRT154951 RRM2 ribonucleotide reductase M2 1 2
MIRT155237 IFNAR2 interferon (alpha, beta and omega) receptor 2 1 1
MIRT159113 NRBP1 nuclear receptor binding protein 1 1 1
MIRT159244 RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1
MIRT160847 PLXNA1 plexin A1 1 1
MIRT164235 GAB1 GRB2-associated binding protein 1 1 1
MIRT165596 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT167509 PRDM1 PR domain containing 1, with ZNF domain 1 1
MIRT170145 KLHDC10 kelch domain containing 10 1 1
MIRT171352 PHTF2 putative homeodomain transcription factor 2 1 2
MIRT171550 DBF4 DBF4 homolog (S. cerevisiae) 1 1
MIRT173415 MTDH metadherin 1 1
MIRT176034 JADE3 PHD finger protein 16 1 1
MIRT177711 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT185099 LYPLAL1 lysophospholipase-like 1 1 1
MIRT188273 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT192227 MKRN3 makorin ring finger protein 3 1 1
MIRT194171 IREB2 iron-responsive element binding protein 2 1 1
MIRT197647 DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 1 1
MIRT206180 RAB10 RAB10, member RAS oncogene family 1 1
MIRT206888 XPO1 exportin 1 (CRM1 homolog, yeast) 1 1
MIRT210817 SETD5 SET domain containing 5 1 1
MIRT212860 N4BP2 NEDD4 binding protein 2 1 1
MIRT215131 MFAP3 microfibrillar-associated protein 3 1 1
MIRT218372 FAM8A1 family with sequence similarity 8, member A1 1 1
MIRT244293 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT252100 NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma 1 1
MIRT257170 TBPL1 TBP-like 1 1 1
MIRT258125 UBE3C ubiquitin protein ligase E3C 1 1
MIRT258177 CBX3 chromobox homolog 3 1 1
MIRT270740 TMED2 transmembrane emp24 domain trafficking protein 2 1 1
MIRT283402 CCNF cyclin F 1 1
MIRT289629 CBX2 chromobox homolog 2 1 1
MIRT292168 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT292815 MTF2 metal response element binding transcription factor 2 1 1
MIRT293784 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT294576 ZNF460 zinc finger protein 460 1 2
MIRT302902 FOXN2 forkhead box N2 1 1
MIRT306843 FYTTD1 forty-two-three domain containing 1 1 1
MIRT313774 MIER3 mesoderm induction early response 1, family member 3 1 2
MIRT322688 BAG4 BCL2-associated athanogene 4 1 1
MIRT368808 MZT1 mitotic spindle organizing protein 1 1 1
MIRT379728 ZXDB zinc finger, X-linked, duplicated B 1 1
MIRT387954 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT437490 NOTCH1 notch 1 3 1
MIRT438722 KPNB1 karyopherin (importin) beta 1 3 1
MIRT438869 ATG2B autophagy related 2B 1 1
MIRT438870 ATG5 autophagy related 5 1 1
MIRT438871 ATG12 autophagy related 12 1 1
MIRT438872 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 1 1
MIRT438873 BECN1 beclin 1, autophagy related 2 2
MIRT439097 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 0 1
MIRT444597 TGFA transforming growth factor, alpha 1 1
MIRT446448 CHST15 carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 1 1
MIRT448490 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 1 1
MIRT448513 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 1 1
MIRT448655 NCOA3 nuclear receptor coactivator 3 1 1
MIRT448783 GNA13 guanine nucleotide binding protein (G protein), alpha 13 1 2
MIRT449708 TSPYL1 TSPY-like 1 1 1
MIRT450760 PGGT1B protein geranylgeranyltransferase type I, beta subunit 1 1
MIRT452140 PPP2R1B protein phosphatase 2, regulatory subunit A, beta 1 1
MIRT463403 ZDHHC20 zinc finger, DHHC-type containing 20 1 1
MIRT464289 VASH1 vasohibin 1 1 1
MIRT467409 SOCS3 suppressor of cytokine signaling 3 1 1
MIRT467625 SLC7A5 solute carrier family 7 (amino acid transporter light chain, L system), member 5 1 1
MIRT470404 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT471078 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta 1 2
MIRT471151 PHF13 PHD finger protein 13 1 3
MIRT472475 NAP1L1 nucleosome assembly protein 1-like 1 1 4
MIRT472492 NACC2 NACC family member 2, BEN and BTB (POZ) domain containing 1 1
MIRT473654 MARCKSL1 MARCKS-like 1 1 1
MIRT473698 MAPK8 mitogen-activated protein kinase 8 1 2
MIRT474083 LMBR1L limb region 1 homolog (mouse)-like 1 2
MIRT474283 LARP1 La ribonucleoprotein domain family, member 1 1 3
MIRT474323 KREMEN1 kringle containing transmembrane protein 1 1 1
MIRT475696 HHIPL1 HHIP-like 1 1 1
MIRT476170 GOLGA8B golgin A8 family, member B 1 2
MIRT481136 AZIN1 antizyme inhibitor 1 1 3
MIRT481464 ARPP19 cAMP-regulated phosphoprotein, 19kDa 1 2
MIRT482068 ALG9 asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae) 1 1
MIRT482125 AKIRIN1 akirin 1 1 2
MIRT485202 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 3
MIRT488723 ADPRHL1 ADP-ribosylhydrolase like 1 1 1
MIRT492608 POLR3E polymerase (RNA) III (DNA directed) polypeptide E (80kD) 1 1
MIRT497125 IFNE interferon, epsilon 1 1
MIRT498610 MTRNR2L10 MT-RNR2-like 10 1 3
MIRT502700 CSNK1G1 casein kinase 1, gamma 1 1 3
MIRT503025 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT504038 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT507129 GIGYF1 GRB10 interacting GYF protein 1 1 3
MIRT514178 PGPEP1 pyroglutamyl-peptidase I 1 2
MIRT530619 CXCL11 chemokine (C-X-C motif) ligand 11 1 1
MIRT531355 FAM81B family with sequence similarity 81, member B 1 1
MIRT534305 SKIDA1 SKI/DACH domain containing 1 1 1
MIRT536977 HABP4 hyaluronan binding protein 4 1 2
MIRT538155 DDAH1 dimethylarginine dimethylaminohydrolase 1 1 2
MIRT544265 SIKE1 suppressor of IKBKE 1 1 1
MIRT544512 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 1 1
MIRT547152 PGM3 phosphoglucomutase 3 1 1
MIRT547191 PBRM1 polybromo 1 1 1
MIRT547748 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 2
MIRT548191 FOXA1 forkhead box A1 1 1
MIRT548430 ELOVL5 ELOVL fatty acid elongase 5 1 1
MIRT552929 VPS33A vacuolar protein sorting 33 homolog A (S. cerevisiae) 1 1
MIRT553989 SRPR signal recognition particle receptor (docking protein) 1 1
MIRT554286 SIX4 SIX homeobox 4 1 1
MIRT555305 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT555613 PICALM phosphatidylinositol binding clathrin assembly protein 1 2
MIRT555755 PDCD10 programmed cell death 10 1 1
MIRT556574 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT557730 FYCO1 FYVE and coiled-coil domain containing 1 1 1
MIRT557782 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT558468 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT562487 CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) 1 1
MIRT562794 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 1 1
MIRT563232 QRFPR pyroglutamylated RFamide peptide receptor 1 1
MIRT563266 ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1
MIRT565076 UHRF1BP1 UHRF1 binding protein 1 1 2
MIRT565829 SCML2 sex comb on midleg-like 2 (Drosophila) 1 1
MIRT566679 MYLIP myosin regulatory light chain interacting protein 1 1
MIRT566741 MSANTD4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 2
MIRT567610 FANCF Fanconi anemia, complementation group F 1 1
MIRT568347 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 2
MIRT572868 OPHN1 oligophrenin 1 1 1
MIRT612400 STRN striatin, calmodulin binding protein 1 1
MIRT623312 MARCH4 membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase 1 1
MIRT626124 PLSCR1 phospholipid scramblase 1 1 2
MIRT653916 SERPINC1 serpin peptidase inhibitor, clade C (antithrombin), member 1 1 1
MIRT653987 SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT656332 MED29 mediator complex subunit 29 1 1
MIRT669391 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT686769 STX16 syntaxin 16 1 1
MIRT687190 PRKAR1A protein kinase, cAMP-dependent, regulatory, type I, alpha 1 1
MIRT688636 CREM cAMP responsive element modulator 1 1
MIRT704915 CCDC71L coiled-coil domain containing 71-like 1 1
MIRT705332 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT705590 APLP2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT705912 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT716457 MRO maestro 1 1
MIRT718294 MOGAT1 monoacylglycerol O-acyltransferase 1 1 1
MIRT718885 SLFN5 schlafen family member 5 1 1
MIRT719017 SHROOM3 shroom family member 3 1 1
MIRT725998 ZSCAN29 zinc finger and SCAN domain containing 29 1 1
MIRT726047 ZNF200 zinc finger protein 200 1 1
MIRT726059 ZMYND8 zinc finger, MYND-type containing 8 1 1
MIRT726069 ZFAND5 zinc finger, AN1-type domain 5 1 1
MIRT726073 ZCRB1 zinc finger CCHC-type and RNA binding motif 1 1 1
MIRT726121 VPS41 vacuolar protein sorting 41 homolog (S. cerevisiae) 1 1
MIRT726146 VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa 1 1
MIRT726160 USP37 ubiquitin specific peptidase 37 1 1
MIRT726179 UBXN4 UBX domain protein 4 1 1
MIRT726190 UBN1 ubinuclein 1 1 1
MIRT726204 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT726209 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 1 1
MIRT726229 TRIM23 tripartite motif containing 23 1 1
MIRT726263 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1 1
MIRT726378 TBC1D10B TBC1 domain family, member 10B 1 1
MIRT726387 TAOK1 TAO kinase 1 1 1
MIRT726391 TANK TRAF family member-associated NFKB activator 1 1
MIRT726397 TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa 1 1
MIRT726429 STAU1 staufen, RNA binding protein, homolog 1 (Drosophila) 1 1
MIRT726467 SOX12 SRY (sex determining region Y)-box 12 1 1
MIRT726520 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT726531 SLC38A7 solute carrier family 38, member 7 1 1
MIRT726587 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT726594 SH3GL1 SH3-domain GRB2-like 1 1 1
MIRT726610 SRSF7 serine/arginine-rich splicing factor 7 1 1
MIRT726618 SETD3 SET domain containing 3 1 1
MIRT726651 SBF1 SET binding factor 1 1 1
MIRT726663 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT726690 RPA2 replication protein A2, 32kDa 1 1
MIRT726732 RNF122 ring finger protein 122 1 1
MIRT726766 REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit 1 1
MIRT726842 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT726859 PREPL prolyl endopeptidase-like 1 1
MIRT726864 PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) 1 1
MIRT726886 PPP1R2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT726893 PPP1R12A protein phosphatase 1, regulatory subunit 12A 1 1
MIRT726917 PNMA1 paraneoplastic Ma antigen 1 1 1
MIRT726977 PER2 period homolog 2 (Drosophila) 1 1
MIRT726996 PCDH10 protocadherin 10 1 1
MIRT727010 PAWR PRKC, apoptosis, WT1, regulator 1 1
MIRT727032 OTUD4 OTU domain containing 4 1 1
MIRT727091 NDEL1 nudE nuclear distribution E homolog (A. nidulans)-like 1 1 1
MIRT727122 MYBL2 v-myb myeloblastosis viral oncogene homolog (avian)-like 2 1 1
MIRT727166 MLXIP MLX interacting protein 1 1
MIRT727191 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727203 MIA3 melanoma inhibitory activity family, member 3 1 1
MIRT727246 MARCH6 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase 1 1
MIRT727278 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727301 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT727307 LIN28B lin-28 homolog B (C. elegans) 1 1
MIRT727311 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT727318 LCP1 lymphocyte cytosolic protein 1 (L-plastin) 1 1
MIRT727344 KLF10 Kruppel-like factor 10 1 1
MIRT727353 EPG5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT727392 JOSD1 Josephin domain containing 1 1 1
MIRT727397 KDM3A lysine (K)-specific demethylase 3A 1 1
MIRT727406 JAK1 Janus kinase 1 1 1
MIRT727432 IQCB1 IQ motif containing B1 1 1
MIRT727436 IP6K3 inositol hexakisphosphate kinase 3 1 1
MIRT727451 IL1A interleukin 1, alpha 1 1
MIRT727464 IKZF2 IKAROS family zinc finger 2 (Helios) 1 1
MIRT727543 GOLGA1 golgin A1 1 1
MIRT727568 GXYLT1 glucoside xylosyltransferase 1 1 1
MIRT727586 GCLC glutamate-cysteine ligase, catalytic subunit 1 1
MIRT727592 GCSAM germinal center-associated, signaling and motility 1 1
MIRT727632 FUCA1 fucosidase, alpha-L- 1, tissue 1 1
MIRT727689 FANCL Fanconi anemia, complementation group L 1 1
MIRT727724 FAM104A family with sequence similarity 104, member A 1 1
MIRT727746 ERLIN1 ER lipid raft associated 1 1 1
MIRT727763 EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) 1 1
MIRT727773 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT727796 EED embryonic ectoderm development 1 1
MIRT727808 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT727828 DYNLT3 dynein, light chain, Tctex-type 3 1 1
MIRT727898 DCTN4 dynactin 4 (p62) 1 1
MIRT727931 CREG1 cellular repressor of E1A-stimulated genes 1 1 1
MIRT727955 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727977 CLCC1 chloride channel CLIC-like 1 1 1
MIRT728002 CHD1 chromodomain helicase DNA binding protein 1 1 1
MIRT728010 CDC37L1 cell division cycle 37 homolog (S. cerevisiae)-like 1 1 1
MIRT728062 C8orf76 chromosome 8 open reading frame 76 1 1
MIRT728067 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT728075 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728160 KIAA0226L KIAA0226-like 1 1
MIRT728176 BTBD7 BTB (POZ) domain containing 7 1 1
MIRT728188 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT728208 CFDP1 craniofacial development protein 1 1 1
MIRT728229 B4GALT1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 1 1
MIRT728242 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT728267 ATM ataxia telangiectasia mutated 1 1
MIRT728342 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT728372 AFF4 AF4/FMR2 family, member 4 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*