Accession ID: MIRT005418 [miRNA, hsa-miR-30d-5p :: TP53, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-30dLinkOut: [miRBase ]
Description Homo sapiens miR-30d stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-30d-5p
Mature Sequence 6| UGUAAACAUCCCCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Putative hsa-miR-30d-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ92943, LFS1, TRP53, p53
Description tumor protein p53
Transcript NM_0011261    LinkOut: [ RefSeq ]
Other Transcripts NM_0011261 , NM_0005 , NM_0011261 , NM_0011261 , NM_0011261 , NM_0011261   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP53 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_0011261|3'UTR
   1 TAAAGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAA
  81 ACTCGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTC
 161 AAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTAC
 241 CTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGAC
 321 AGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTC
 401 AGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGG
 481 AGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGT
 561 TCTTGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTC
 641 CCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATT
 721 GTGAGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAG
 801 GGTGCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTC
 881 AAGTCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATC
 961 CCACACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCT
1041 TTTTTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTG
1121 ATCTTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTC
1201 ATGCCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCC
1281 TGGGCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGG
1361 TCAACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTT
1441 TTATATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaAGGUCAGCCCCUACAAAUgu 5'
            | | ||  |||||||||:  
Target 5' ttTACTGTGAGGGATGTTTGgg 3'
524 - 545 132.00 -15.70
2
miRNA  3' gaAGGUCAG-CCCCUA-CAAAUGu 5'
            | ||||:  ||| | |||||| 
Target 5' ctTGCAGTTAAGGGTTAGTTTACa 3'
562 - 585 132.00 -17.60
3
miRNA  3' gaAGGUCAGCCC--CUACAAAUgu 5'
            | ||||:|||  | || |||  
Target 5' tcTACAGTTGGGCAGCTGGTTAgg 3'
843 - 866 118.00 -12.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-30d-5p :: TP53    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions 293T , H1299 , HCT116 , HCT116p53 , H929 , MM1.s
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , RNA22 , TargetScan
Original Description (Extracted from the article) ... miRNAs (miR-25 and miR-30d) directly target the 3'UTR of TP53 to downregulate p53 protein levels and reduce the expression of genes that are transcriptionally activated by p53 ...

- Kumar, M. Lu, Z. Takwi, A. A. Chen, W. et al., 2011, Oncogene.

Article - Kumar, M. Lu, Z. Takwi, A. A. Chen, W. et al.
- Oncogene, 2011
The tumor suppressor p53, encoded by the TP53 gene, is recognized as the guardian of the human genome because it regulates many downstream genes to exercise its function in cell cycle and cell death. Recent studies have revealed that several microRNAs (miRNAs) are important components of the p53 tumor suppressor network with miR-125b and miR-504 directly targeting TP53. In this study, we use a screening method to identify that two miRNAs (miR-25 and miR-30d) directly target the 3'UTR of TP53 to downregulate p53 protein levels and reduce the expression of genes that are transcriptionally activated by p53. Correspondingly, both miR-25 and miR-30d adversely affect apoptotic cell death, cell cycle arrest and cellular senescence. Inhibition of either miR-25 or miR-30d expression increases endogenous p53 expression and elevates cellular apoptosis in several cell lines, including one from multiple myeloma that has little TP53 mutations. Thus, beyond miR-125b and miR-504, the human TP53 gene is negatively regulated by two more miRNAs: miR-25 and miR-30d.
LinkOut: [PMID: 20935678]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
62 hsa-miR-30d-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003274 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 3 1
MIRT005418 TP53 tumor protein p53 4 1
MIRT006240 CASP3 caspase 3, apoptosis-related cysteine peptidase 2 1
MIRT006322 SMAD1 SMAD family member 1 2 1
MIRT006608 Snai1 snail homolog 1 (Drosophila) 1 1
MIRT006763 SNAI1 snail homolog 1 (Drosophila) 3 1
MIRT006920 EZH2 enhancer of zeste homolog 2 (Drosophila) 3 1
MIRT007057 GPR78 G protein-coupled receptor 78 1 1
MIRT025969 RUNX2 runt-related transcription factor 2 2 1
MIRT047776 FAM60A family with sequence similarity 60, member A 1 1
MIRT047777 EXOC2 exocyst complex component 2 1 1
MIRT047778 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT047779 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047780 IRF2 interferon regulatory factor 2 1 1
MIRT047781 SENP2 SUMO1/sentrin/SMT3 specific peptidase 2 1 1
MIRT047782 TAF1C TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa 1 1
MIRT047783 KLF14 Kruppel-like factor 14 1 1
MIRT047784 HOXA11 homeobox A11 1 1
MIRT047785 DENND5A DENN/MADD domain containing 5A 1 1
MIRT047786 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT047787 SMEK1 SMEK homolog 1, suppressor of mek1 (Dictyostelium) 1 1
MIRT047788 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT047789 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT047790 RREB1 ras responsive element binding protein 1 1 1
MIRT047791 ZNF609 zinc finger protein 609 1 1
MIRT047792 TAB1 TGF-beta activated kinase 1/MAP3K7 binding protein 1 1 1
MIRT047793 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT047794 ADC arginine decarboxylase 1 1
MIRT047795 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 1 1
MIRT047796 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT047797 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT047798 RPLP0 ribosomal protein, large, P0 1 1
MIRT047799 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT047800 RAB35 RAB35, member RAS oncogene family 1 1
MIRT047801 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT047802 FNIP1 folliculin interacting protein 1 1 1
MIRT047803 SLC27A1 solute carrier family 27 (fatty acid transporter), member 1 1 1
MIRT047804 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT047805 SRSF9 splicing factor, arginine/serine-rich 9 1 1
MIRT047806 RPN2 ribophorin II 1 1
MIRT047807 HDHD3 haloacid dehalogenase-like hydrolase domain containing 3 1 1
MIRT047808 MAP1B microtubule-associated protein 1B 1 1
MIRT047809 NR2F6 nuclear receptor subfamily 2, group F, member 6 1 1
MIRT047810 RPS17 ribosomal protein S17 1 1
MIRT047811 HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 (H) 1 1
MIRT047812 C10orf137 chromosome 10 open reading frame 137 1 1
MIRT047813 POLR3H polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) 1 1
MIRT047814 KCTD12 potassium channel tetramerisation domain containing 12 1 1
MIRT047815 FBN2 fibrillin 2 1 1
MIRT047816 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT047817 DROSHA ribonuclease type III, nuclear 1 1
MIRT047818 REXO1 REX1, RNA exonuclease 1 homolog (S. cerevisiae) 1 1
MIRT047819 ZNF227 zinc finger protein 227 1 1
MIRT047820 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT047821 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT047822 NMT1 N-myristoyltransferase 1 1 1
MIRT047823 FKTN fukutin 1 1
MIRT047824 YKT6 YKT6 v-SNARE homolog (S. cerevisiae) 1 1
MIRT047825 ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1 1
MIRT047826 SGTA small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha 1 1
MIRT047827 MED28 mediator complex subunit 28 1 1
MIRT047828 ZBTB4 zinc finger and BTB domain containing 4 1 1