Accession ID: MIRT005420 [miRNA, hsa-let-7a-5p :: IL6, target gene]
pre-miRNA Information
pre-miRNA ID hsa-let-7a-1LinkOut: [miRBase ]
Synonyms LET7A1, MIRNLET7A1, let-7a-1, MIRLET7A1
Description Homo sapiens let-7a-1 stem-loop
Comment let-7a-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-let-7a-5p
Mature Sequence 6| UGAGGUAGUAGGUUGUAUAGUU |27
Evidence Experimental
Experiments Northern
Putative hsa-let-7a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol IL6 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BSF2, HGF, HSF, IFNB2, IL-6
Description interleukin 6 (interferon, beta 2)
Transcript NM_0006    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on IL6 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of IL6
(miRNA target sites are highlighted)
>IL6|NM_0006|3'UTR
   1 ATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAA
  81 CTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAA
 161 ATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTT
 241 TTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGGAAAGTGTAGGC
 321 TTACCTCAAATAAATGGCTAACTTATACATATTTTTAAAGAAATATTTATATTGTATTTATATAATGTATAAATGGTTTT
 401 TATACCAATAAATGGCATTTTAAAAAATTCAGCAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-let-7a-5p :: IL6    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions MCF10A
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... Let-7 MicroRNA Directly Inhibits Expression of IL6. ...

- Iliopoulos, D. Hirsch, H. A. Struhl, K., 2009, Cell.

Article - Iliopoulos, D. Hirsch, H. A. Struhl, K.
- Cell, 2009
Inflammation is linked clinically and epidemiologically to cancer, and NF-kappaB appears to play a causative role, but the mechanisms are poorly understood. We show that transient activation of Src oncoprotein can mediate an epigenetic switch from immortalized breast cells to a stably transformed line that forms self-renewing mammospheres that contain cancer stem cells. Src activation triggers an inflammatory response mediated by NF-kappaB that directly activates Lin28 transcription and rapidly reduces let-7 microRNA levels. Let-7 directly inhibits IL6 expression, resulting in higher levels of IL6 than achieved by NF-kappaB activation. IL6-mediated activation of the STAT3 transcription factor is necessary for transformation, and IL6 activates NF-kappaB, thereby completing a positive feedback loop. This regulatory circuit operates in other cancer cells lines, and its transcriptional signature is found in human cancer tissues. Thus, inflammation activates a positive feedback loop that maintains the epigenetic transformed state for many generations in the absence of the inducing signal.
LinkOut: [PMID: 19878981]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
343 hsa-let-7a-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000415 CDK6 cyclin-dependent kinase 6 2 2
MIRT000416 CDC25A cell division cycle 25 homolog A (S. pombe) 1 1
MIRT000417 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 3 5
MIRT000418 BCL2 B-cell CLL/lymphoma 2 3 1
MIRT000463 NKIRAS2 NFKB inhibitor interacting Ras-like 2 4 1
MIRT000708 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 4 1
MIRT001853 NF2 neurofibromin 2 (merlin) 5 2
MIRT001854 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 4 2
MIRT001855 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 5 4
MIRT001936 PRDM1 PR domain containing 1, with ZNF domain 4 2
MIRT002027 lin-41 abnormal cell LINeage 2 1
MIRT002077 TRIM71 tripartite motif-containing 71 2 3
MIRT002078 FOXA1 forkhead box A1 2 1
MIRT002079 NR1I2 nuclear receptor subfamily 1, group I, member 2 2 1
MIRT002080 VDR vitamin D (1,25- dihydroxyvitamin D3) receptor 2 1
MIRT002305 RAVER2 ribonucleoprotein, PTB-binding 2 3 1
MIRT002323 HMGA2 high mobility group AT-hook 2 5 8
MIRT003152 HMGA1 high mobility group AT-hook 1 5 3
MIRT003522 EIF2C4 eukaryotic translation initiation factor 2C, 4 2 1
MIRT003752 trim71 tripartite motif-containing 71 2 1
MIRT003902 APP amyloid beta (A4) precursor protein 2 1
MIRT003904 E2F1 E2F transcription factor 1 2 1
MIRT003974 wech CG42396 gene product from transcript CG42396-RC 2 1
MIRT004321 UHRF2 ubiquitin-like with PHD and ring finger domains 2 4 1
MIRT004346 DICER1 dicer 1, ribonuclease type III 4 2
MIRT004471 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog 4 3
MIRT004520 IGF2 insulin-like growth factor 2 (somatomedin A) 2 1
MIRT004801 LIN28A lin-28 homolog A (C. elegans) 3 2
MIRT004830 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 3 1
MIRT004957 ZFP36L1 zinc finger protein 36, C3H type-like 1 2 1
MIRT004958 THBS1 thrombospondin 1 2 1
MIRT004959 TUSC2 tumor suppressor candidate 2 2 1
MIRT004960 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 2 1
MIRT004961 NEFM neurofilament, medium polypeptide 2 1
MIRT004962 MEIS1 Meis homeobox 1 2 1
MIRT004963 EGR3 early growth response 3 2 1
MIRT004964 HNRPDL heterogeneous nuclear ribonucleoprotein D-like 2 1
MIRT004965 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 2 1
MIRT005292 CASP3 caspase 3, apoptosis-related cysteine peptidase 3 1
MIRT005293 CASP8 caspase 8, apoptosis-related cysteine peptidase 2 1
MIRT005294 CASP9 caspase 9, apoptosis-related cysteine peptidase 2 1
MIRT005420 IL6 interleukin 6 (interferon, beta 2) 4 1
MIRT005477 E2F2 E2F transcription factor 2 4 1
MIRT005478 CCND2 cyclin D2 4 1
MIRT006055 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 2 1
MIRT006056 CDC34 cell division cycle 34 homolog (S. cerevisiae) 2 1
MIRT006152 EWSR1 Ewing sarcoma breakpoint region 1 4 1
MIRT006405 MPL myeloproliferative leukemia virus oncogene 1 1
MIRT006813 CCR7 chemokine (C-C motif) receptor 7 3 1
MIRT032499 ACP1 acid phosphatase 1, soluble 1 1
MIRT032500 MED28 mediator complex subunit 28 1 1
MIRT032501 EIF3J eukaryotic translation initiation factor 3, subunit J 1 1
MIRT032502 SMOX spermine oxidase 1 1
MIRT032503 DAD1 defender against cell death 1 1 1
MIRT032504 RTCA RNA terminal phosphate cyclase domain 1 1 1
MIRT032505 TMED7 transmembrane emp24 protein transport domain containing 7 1 1
MIRT032506 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1 1
MIRT035534 HAS2 hyaluronan synthase 2 1 1
MIRT035541 EGFR epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 1 1
MIRT052360 RIOK3 RIO kinase 3 (yeast) 1 1
MIRT052361 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT052362 FAM105B family with sequence similarity 105, member B 1 1
MIRT052363 TMEM39A transmembrane protein 39A 1 1
MIRT052364 UPP2 uridine phosphorylase 2 1 1
MIRT052365 SYNPR synaptoporin 1 1
MIRT052366 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 1 1
MIRT052367 MEPCE methylphosphate capping enzyme 1 1
MIRT052368 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT052369 NDUFAF3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 1 1
MIRT052370 GP5 glycoprotein V (platelet) 1 1
MIRT052371 GPN1 GPN-loop GTPase 1 1 1
MIRT052372 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 1
MIRT052373 ZNF555 zinc finger protein 555 1 1
MIRT052374 UBE3C ubiquitin protein ligase E3C 1 1
MIRT052375 LHFPL2 lipoma HMGIC fusion partner-like 2 1 1
MIRT052376 MRPL15 mitochondrial ribosomal protein L15 1 1
MIRT052377 HIST2H2BF histone cluster 2, H2bf 1 1
MIRT052378 CEP170B KIAA0284 1 1
MIRT052379 SMPDL3B sphingomyelin phosphodiesterase, acid-like 3B 1 1
MIRT052380 HIST2H2BE histone cluster 2, H2be 1 1
MIRT052381 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT052382 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT052383 COX2 cytochrome c oxidase subunit II 1 1
MIRT052384 BCAT1 branched chain amino-acid transaminase 1, cytosolic 1 1
MIRT052385 RRM2 ribonucleotide reductase M2 1 1
MIRT052386 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT052387 ZCCHC9 zinc finger, CCHC domain containing 9 1 1
MIRT052388 CD276 CD276 molecule 1 1
MIRT052389 PHF6 PHD finger protein 6 1 1
MIRT052390 FAM13C family with sequence similarity 13, member C 1 1
MIRT052391 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT052392 ACVR1B activin A receptor, type IB 1 1
MIRT052393 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT052394 BAZ2A bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT052395 UBAP2 ubiquitin associated protein 2 1 1
MIRT052396 RPL9 ribosomal protein L9 1 1
MIRT052397 TRIM5 tripartite motif-containing 5 1 1
MIRT052398 DNAJC6 DnaJ (Hsp40) homolog, subfamily C, member 6 1 1
MIRT052399 GLUL glutamate-ammonia ligase 1 1
MIRT052400 HIST1H4D histone cluster 1, H4d 1 1
MIRT052401 FOXJ3 forkhead box J3 1 1
MIRT052402 PHTF2 putative homeodomain transcription factor 2 1 1
MIRT052403 ACTB actin, beta 1 1
MIRT052404 NID2 nidogen 2 (osteonidogen) 1 1
MIRT052405 ANO6 anoctamin 6 1 1
MIRT052406 CS citrate synthase 1 1
MIRT052407 BTBD1 BTB (POZ) domain containing 1 1 1
MIRT052408 NCBP1 nuclear cap binding protein subunit 1, 80kDa 1 1
MIRT052409 LMNA lamin A/C 1 1
MIRT052410 RBMXL1 RNA binding motif protein, X-linked-like 1 1 1
MIRT052411 JAZF1 JAZF zinc finger 1 1 1
MIRT052412 RPS3A ribosomal protein S3A 1 1
MIRT052413 ZNF629 zinc finger protein 629 1 1
MIRT052414 SIK1 salt-inducible kinase 1 1 1
MIRT052415 HIST1H1D histone cluster 1, H1d 1 1
MIRT052416 SESN2 sestrin 2 1 1
MIRT052417 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT052418 GPM6B glycoprotein M6B 1 1
MIRT052419 RPL30 ribosomal protein L30 1 1
MIRT052420 ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 1 1
MIRT052421 FBXW2 F-box and WD repeat domain containing 2 1 1
MIRT052422 POU3F2 POU class 3 homeobox 2 1 1
MIRT052423 TTC22 tetratricopeptide repeat domain 22 1 1
MIRT052424 LRRC37A2 leucine rich repeat containing 37, member A2 1 1
MIRT052425 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT052426 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT052427 RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) 1 1
MIRT052428 KIAA2026 KIAA2026 1 1
MIRT052429 COX1 cytochrome c oxidase subunit I 1 1
MIRT052430 NAA35 N(alpha)-acetyltransferase 35, NatC auxiliary subunit 1 1
MIRT052431 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial) 1 1
MIRT052432 ATP6 ATP synthase F0 subunit 6 1 1
MIRT052433 GTF2I general transcription factor IIi 1 1
MIRT052434 KRTAP19-1 keratin associated protein 19-1 1 1
MIRT052435 RPL4 ribosomal protein L4 1 1
MIRT052436 TMEM165 transmembrane protein 165 1 1
MIRT052437 GTF3C5 general transcription factor IIIC, polypeptide 5, 63kDa 1 1
MIRT052438 KIAA1147 KIAA1147 1 1
MIRT052439 C9orf37 chromosome 9 open reading frame 37 1 1
MIRT052440 C11orf57 chromosome 11 open reading frame 57 1 1
MIRT052441 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT052442 ZNF609 zinc finger protein 609 1 1
MIRT052443 TMEM64 transmembrane protein 64 1 1
MIRT052444 EXPH5 exophilin 5 1 1
MIRT052445 AKAP17A splicing factor, arginine/serine-rich 17A 1 1
MIRT052446 ATG4C ATG4 autophagy related 4 homolog C (S. cerevisiae) 1 1
MIRT052447 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT052448 WWP2 WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT052449 RPS15A ribosomal protein S15a 1 1
MIRT052450 RPS10 ribosomal protein S10 1 1
MIRT052451 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT052452 AOC2 amine oxidase, copper containing 2 (retina-specific) 1 1
MIRT052453 SP1 Sp1 transcription factor 1 1
MIRT052454 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT052455 CAMK2D calcium/calmodulin-dependent protein kinase II delta 1 1
MIRT052456 CD2AP CD2-associated protein 1 1
MIRT052457 H1F0 H1 histone family, member 0 1 1
MIRT052458 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT052459 RPSA ribosomal protein SA 1 1
MIRT052460 NEU3 sialidase 3 (membrane sialidase) 1 1
MIRT052461 UBAP2L ubiquitin associated protein 2-like 1 1
MIRT052462 GORASP2 golgi reassembly stacking protein 2, 55kDa 1 1
MIRT052463 ANKRD17 ankyrin repeat domain 17 1 1
MIRT052464 IPO7 importin 7 1 1
MIRT052465 CFL2 cofilin 2 (muscle) 1 1
MIRT052466 ZMYM3 zinc finger, MYM-type 3 1 1
MIRT052467 RBM6 RNA binding motif protein 6 1 1
MIRT052468 TAF9B TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa 1 1
MIRT052469 SKA3 spindle and kinetochore associated complex subunit 3 1 1
MIRT052470 DDX18 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 1 1
MIRT052471 FARSA phenylalanyl-tRNA synthetase, alpha subunit 1 1
MIRT052472 BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 1 1
MIRT052473 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT052474 BUD13 BUD13 homolog (S. cerevisiae) 1 1
MIRT052475 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 1 1
MIRT052476 NUDT4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1 1
MIRT052477 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT052478 SPATS2 spermatogenesis associated, serine-rich 2 1 1
MIRT052479 REPS1 RALBP1 associated Eps domain containing 1 1 1
MIRT052480 TRAF7 TNF receptor-associated factor 7 1 1
MIRT052481 CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood group) 1 1
MIRT052482 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT052483 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT052484 ERN1 endoplasmic reticulum to nucleus signaling 1 1 1
MIRT052485 NDUFS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) 1 1
MIRT052486 MRS2 MRS2 magnesium homeostasis factor homolog (S. cerevisiae) 1 1
MIRT052487 TARS threonyl-tRNA synthetase 1 1
MIRT052488 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT052489 PAXBP1 GC-rich sequence DNA-binding factor 1 1 1
MIRT052490 LIX1L Lix1 homolog (mouse)-like 1 1
MIRT052491 RAD21 RAD21 homolog (S. pombe) 1 1
MIRT052492 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT052493 ZNF644 zinc finger protein 644 1 1
MIRT052494 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT052495 ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 1 1
MIRT052496 ZNF746 zinc finger protein 746 1 1
MIRT052497 ND2 MTND2 1 1
MIRT052498 RPS4X ribosomal protein S4, X-linked 1 1
MIRT052499 NPC1 Niemann-Pick disease, type C1 1 1
MIRT052500 ITM2B integral membrane protein 2B 1 1
MIRT052501 RPS13 ribosomal protein S13 1 1
MIRT052502 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT052503 CARHSP1 calcium regulated heat stable protein 1, 24kDa 1 1
MIRT052504 CNTRL centrosomal protein 110kDa 1 1
MIRT052505 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT052506 ARID3B AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT052507 LILRB4 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 1 1
MIRT052508 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT052509 SRSF2 splicing factor, arginine/serine-rich 2 1 1
MIRT052510 CLPB ClpB caseinolytic peptidase B homolog (E. coli) 1 1
MIRT052511 DEGS1 degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) 1 1
MIRT052512 LTA4H leukotriene A4 hydrolase 1 1
MIRT052513 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT052514 HDAC5 histone deacetylase 5 1 1
MIRT052515 MTFR1L family with sequence similarity 54, member B 1 1
MIRT052516 NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 1 1
MIRT052517 JPH4 junctophilin 4 1 1
MIRT052518 TAF5L TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa 1 1
MIRT052519 MED13L mediator complex subunit 13-like 1 1
MIRT052520 FKBP8 FK506 binding protein 8, 38kDa 1 1
MIRT052521 ZNF780A zinc finger protein 780A 1 1
MIRT052522 BSDC1 BSD domain containing 1 1 1
MIRT052523 HMGN2 high-mobility group nucleosomal binding domain 2 1 1
MIRT052524 SLC35A4 solute carrier family 35, member A4 1 1
MIRT052525 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT052526 B4GALNT3 beta-1,4-N-acetyl-galactosaminyl transferase 3 1 1
MIRT052527 USP14 ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) 1 1
MIRT052528 HOXC4 homeobox C4 1 1
MIRT052529 PTGES2 prostaglandin E synthase 2 1 1
MIRT052530 HSF2 heat shock transcription factor 2 1 1
MIRT052531 FAM171A2 family with sequence similarity 171, member A2 1 1
MIRT052532 CAND2 cullin-associated and neddylation-dissociated 2 (putative) 1 1
MIRT052533 TMEM241 chromosome 18 open reading frame 45 1 1
MIRT052534 S100PBP S100P binding protein 1 1
MIRT052535 AIDA axin interactor, dorsalization associated 1 1
MIRT052536 RANBP2 RAN binding protein 2 1 1
MIRT052537 MAPK11 mitogen-activated protein kinase 11 1 1
MIRT052538 BMPR1B bone morphogenetic protein receptor, type IB 1 1
MIRT052539 ADSL adenylosuccinate lyase 1 1
MIRT052540 SNX2 sorting nexin 2 1 1
MIRT052541 MTUS1 microtubule associated tumor suppressor 1 1 1
MIRT052542 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT052543 HOXA6 homeobox A6 1 1
MIRT052544 DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 1 1
MIRT052545 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 1
MIRT052546 PCIF1 PDX1 C-terminal inhibiting factor 1 1 1
MIRT052547 UBOX5 U-box domain containing 5 1 1
MIRT052548 PEX14 peroxisomal biogenesis factor 14 1 1
MIRT052549 TMX2 thioredoxin-related transmembrane protein 2 1 1
MIRT052550 RAVER1 ribonucleoprotein, PTB-binding 1 1 1
MIRT052551 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT052552 G2E3 G2/M-phase specific E3 ubiquitin ligase 1 1
MIRT052553 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1 1
MIRT052554 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 1 1
MIRT052555 CDC25B cell division cycle 25 homolog B (S. pombe) 1 1
MIRT052556 TTC26 tetratricopeptide repeat domain 26 1 1
MIRT052557 LRRC42 leucine rich repeat containing 42 1 1
MIRT052558 NME4 non-metastatic cells 4, protein expressed in 1 1
MIRT052559 GGPS1 geranylgeranyl diphosphate synthase 1 1 1
MIRT052560 LARP1 La ribonucleoprotein domain family, member 1 1 1
MIRT052561 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 1 1
MIRT052562 WDR46 WD repeat domain 46 1 1
MIRT052563 TRRAP transformation/transcription domain-associated protein 1 1
MIRT052564 ARRDC3 arrestin domain containing 3 1 1
MIRT052565 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT052566 EZH2 enhancer of zeste homolog 2 (Drosophila) 1 1
MIRT052567 HOXB4 homeobox B4 1 1
MIRT052568 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT052569 SF3A1 splicing factor 3a, subunit 1, 120kDa 1 1
MIRT052570 F2R coagulation factor II (thrombin) receptor 1 1
MIRT052571 SNX6 sorting nexin 6 1 1
MIRT052572 GADD45GIP1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 1 1
MIRT052573 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT052574 KDM6B lysine (K)-specific demethylase 6B 1 1
MIRT052575 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT052576 ANGEL2 angel homolog 2 (Drosophila) 1 1
MIRT052577 RPL35A ribosomal protein L35a 1 1
MIRT052578 FNIP1 folliculin interacting protein 1 1 1
MIRT052579 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 1 1
MIRT052580 TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa 1 1
MIRT052581 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT052582 BPTF bromodomain PHD finger transcription factor 1 1
MIRT052583 PAQR5 progestin and adipoQ receptor family member V 1 1
MIRT052584 SPTBN1 spectrin, beta, non-erythrocytic 1 1 1
MIRT052585 MIB1 mindbomb homolog 1 (Drosophila) 1 1
MIRT052586 RPS24 ribosomal protein S24 1 1
MIRT052587 WDR6 WD repeat domain 6 1 1
MIRT052588 CYP2R1 cytochrome P450, family 2, subfamily R, polypeptide 1 1 1
MIRT052589 TCERG1 transcription elongation regulator 1 1 1
MIRT052590 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT052591 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT052592 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT052593 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT052594 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT052595 ALDH7A1 aldehyde dehydrogenase 7 family, member A1 1 1
MIRT052596 ILKAP integrin-linked kinase-associated serine/threonine phosphatase 2C 1 1
MIRT052597 DPH5 DPH5 homolog (S. cerevisiae) 1 1
MIRT052598 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT052599 TRIO triple functional domain (PTPRF interacting) 1 1
MIRT052600 NDUFAF7 chromosome 2 open reading frame 56 1 1
MIRT052601 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT052602 PREB prolactin regulatory element binding 1 1
MIRT052603 BIRC6 baculoviral IAP repeat-containing 6 1 1
MIRT052604 MYO9A myosin IXA 1 1
MIRT052605 RAB13 RAB13, member RAS oncogene family 1 1
MIRT052606 SMG7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT052607 SLC35C1 solute carrier family 35, member C1 1 1
MIRT052608 GTF3C1 general transcription factor IIIC, polypeptide 1, alpha 220kDa 1 1
MIRT052609 NPTX1 neuronal pentraxin I 1 1
MIRT052610 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT052611 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT052612 NUPL1 nucleoporin like 1 1 1
MIRT052613 UNK unkempt homolog (Drosophila) 1 1
MIRT052614 COPZ1 coatomer protein complex, subunit zeta 1 1 1
MIRT052615 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT052616 TSPAN3 tetraspanin 3 1 1
MIRT052617 KCTD1 potassium channel tetramerisation domain containing 1 1 1
MIRT052618 PLOD1 procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1 1 1
MIRT052619 RBFOX2 RNA binding motif protein 9 1 1
MIRT052620 COX14 chromosome 12 open reading frame 62 1 1
MIRT052621 KPNA6 karyopherin alpha 6 (importin alpha 7) 1 1
MIRT052622 C7orf60 chromosome 7 open reading frame 60 1 1
MIRT052623 C2CD4A C2 calcium-dependent domain containing 4A 1 1
MIRT052624 DSC3 desmocollin 3 1 1
MIRT052625 PDE4DIP phosphodiesterase 4D interacting protein 1 1
MIRT052626 SEL1L3 sel-1 suppressor of lin-12-like 3 (C. elegans) 1 1
MIRT052627 PALD1 KIAA1274 1 1
MIRT052628 METTL6 methyltransferase like 6 1 1
MIRT052629 CRYBG3 beta-gamma crystallin domain containing 3 1 1
MIRT052630 ZNF264 zinc finger protein 264 1 1
MIRT052631 CTDP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 1 1
MIRT052632 ATXN2L ataxin 2-like 1 1
MIRT052633 BCOR BCL6 corepressor 1 1
MIRT052634 IARS isoleucyl-tRNA synthetase 1 1
MIRT052635 SYVN1 synovial apoptosis inhibitor 1, synoviolin 1 1
MIRT052636 ZNF260 zinc finger protein 260 1 1
MIRT052637 CCNB2 cyclin B2 1 1
MIRT052638 SFSWAP splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila) 1 1
MIRT052639 ACAD8 acyl-CoA dehydrogenase family, member 8 1 1
MIRT052640 INTS12 integrator complex subunit 12 1 1
MIRT052641 NIPBL Nipped-B homolog (Drosophila) 1 1
MIRT052642 SESN1 sestrin 1 1 1
MIRT052643 CCNG1 cyclin G1 1 1