Accession ID: MIRT005427 [miRNA, hsa-miR-214-3p :: MAPK8, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-214LinkOut: [miRBase ]
Synonyms MIRN214, miRNA214, mir-214, MIR214
Description Homo sapiens miR-214 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-214-3p
Mature Sequence 71| ACAGCAGGCACAGACAGGCAGU |92
Evidence Experimental
Experiments Cloned
Putative hsa-miR-214-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MAPK8 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms JNK, JNK1, JNK1A2, JNK21B1/2, PRKM8, SAPK1
Description mitogen-activated protein kinase 8
Transcript NM_0027    LinkOut: [ RefSeq ]
Other Transcripts NM_1390 , NM_1390 , NM_1390   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MAPK8 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MAPK8
(miRNA target sites are highlighted)
>MAPK8|NM_0027|3'UTR
   1 TGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATGTCAACAGATCCGACTTTGGCC
  81 TCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGACTACTTGGGCCATCGGGGGGTGG
 161 GAGGGATGGGGAGTCGGTTAGTCATTGATAGAACTACTTTGAAAACAATTCAGTGGTCTTATTTTTGGGTGATTTTTCAA
 241 AAAATGTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaCGGACAGACACGGACGACa 5'
             |||  |||| | |||||| 
Target 5' tggGCC--TCTG-GGCTGCTGt 3'
113 - 131 130.00 -20.10
2
miRNA  3' ugacGGACAGACA-CGGACGACa 5'
              :| | || | |||| ||| 
Target 5' cagaTCCGACTTTGGCCT-CTGa 3'
64 - 85 102.00 -12.60
3
miRNA  3' ugaCGGACAG-----ACACGGACGaca 5'
             |:|||||     ||||:|| |   
Target 5' gtcGTCTGTCAATGATGTGTCTTCaat 3'
32 - 58 87.00 -14.32
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-214-3p :: MAPK8    [ Functional MTI ]
Validation Method GFP reporter assay , Microarray , qRT-PCR , Western blot , Other , Reporter assay;qRT-PCR;Microarray;Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-214 negatively regulates MEK3 and JNK1 through binding to their 3'UTRs by assay of GFP expression (EGFP).// ...

- Yang, Z. Chen, S. Luan, X. Li, Y. Liu, M. et al., 2009, IUBMB Life.

Article - Yang, Z. Chen, S. Luan, X. Li, Y. Liu, M. et al.
- IUBMB Life, 2009
MicroRNAs are a group of endogenously expressed, single-stranded, 18-24 nt RNAs that regulate diverse cellular pathways. Although documented evidence indicates that some microRNAs can function as oncogenes or tumor-suppressors, the role of miR-214 in regulating human cervical cancer cells remains unexplored. We determined the expression level of miR-214 and found it is downregulated in cervical cancer compared with normal tissue. Overexpression of miR-214 in HeLa cells, a human cervical cancer cell line, significantly inhibited cell proliferation according to the MTT and colony forming assays. HeLa cells that stably overexpress miR-214 downregulate the expression of MEK3 and JNK1 at both mRNA and protein levels. Further investigation revealed that miR-214 regulates the expression of MEK3 and JNK1 by targeting the 3'UTRs of these genes. Collectively, these results suggest that miR-214 negatively regulates HeLa cell proliferation by targeting the noncoding regions of MEK3 and JNK1 mRNAs.
LinkOut: [PMID: 19859982]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
29 hsa-miR-214-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000148 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 2
MIRT000799 PTEN phosphatase and tensin homolog 5 5
MIRT004738 DAPK1 death-associated protein kinase 1 3 1
MIRT005426 MAP2K3 mitogen-activated protein kinase kinase 3 5 1
MIRT005427 MAPK8 mitogen-activated protein kinase 8 5 1
MIRT005551 POU4F2 POU class 4 homeobox 2 4 1
MIRT005765 PLXNB1 plexin B1 5 2
MIRT005811 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 3 1
MIRT006028 ING4 inhibitor of growth family, member 4 2 1
MIRT006375 XBP1 X-box binding protein 1 3 1
MIRT006644 QKI quaking homolog, KH domain RNA binding (mouse) 1 1
MIRT006731 TWIST1 twist homolog 1 (Drosophila) 3 1
MIRT006816 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 4 2
MIRT006881 TP53 tumor protein p53 1 2
MIRT007031 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT007201 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT007294 BCL2L2 BCL2-like 2 3 1
MIRT024958 FLOT1 flotillin 1 2 1
MIRT024959 MAP2K5 mitogen-activated protein kinase kinase 5 2 1
MIRT024960 HSPD1 heat shock 60kDa protein 1 (chaperonin) 2 1
MIRT024961 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 2 1
MIRT024962 CPNE7 copine VII 2 1
MIRT024963 RASA1 RAS p21 protein activator (GTPase activating protein) 1 2 1
MIRT024964 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 2 1
MIRT024965 ARL2 ADP-ribosylation factor-like 2 2 1
MIRT024966 AP3B1 adaptor-related protein complex 3, beta 1 subunit 2 1
MIRT024967 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT035545 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT035546 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1