Accession ID: MIRT005427 [miRNA, hsa-miR-214 ::
MAPK8, target gene]
| pre-miRNA ID | hsa-mir-214 LinkOut: [miRBase ] |
|---|---|
| Synonyms | MIRN214, miRNA214, mir-214, MIR214 |
| Description | Homo sapiens miR-214 stem-loop |
| Comment | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . |
| 2nd Structure of pre-miRNA | ![]() |
| Mature miRNA | hsa-miR-214-3p |
|---|---|
| Mature Sequence | 71| ACAGCAGGCACAGACAGGCAGU |92 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-214-3p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
| Mature miRNA | hsa-miR-214-5p |
| Mature Sequence | 30| UGCCUGUCUACACUUGCUGUGC |51 |
| Evidence | Experimental |
| Experiments | Cloned |
| Putative hsa-miR-214-5p Targets | LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ] |
![]() |
| Gene Symbol | MAPK8 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Synonyms | JNK, JNK1, JNK1A2, JNK21B1/2, PRKM8, SAPK1 | ||||||||||||||||||||
| Description | mitogen-activated protein kinase 8 | ||||||||||||||||||||
| Transcript | NM_002750 LinkOut: [ RefSeq ] | ||||||||||||||||||||
| Other Transcripts | NM_139046, NM_139047, NM_139049 | ||||||||||||||||||||
| Expression | LinkOut: [ BioGPS ] | ||||||||||||||||||||
| KEGG Pathway |
hsa04010 MAPK signaling pathway - Homo sapiens (human) hsa04012 ErbB signaling pathway - Homo sapiens (human) hsa04310 Wnt signaling pathway - Homo sapiens (human) hsa04510 Focal adhesion - Homo sapiens (human) hsa04620 Toll-like receptor signaling pathway - Homo sapiens (human) hsa04621 NOD-like receptor signaling pathway - Homo sapiens (human) hsa04622 RIG-I-like receptor signaling pathway - Homo sapiens (human) hsa04664 Fc epsilon RI signaling pathway - Homo sapiens (human) hsa04722 Neurotrophin signaling pathway - Homo sapiens (human) hsa04910 Insulin signaling pathway - Homo sapiens (human) hsa04912 GnRH signaling pathway - Homo sapiens (human) hsa04914 Progesterone-mediated oocyte maturation - Homo sapiens (human) hsa04920 Adipocytokine signaling pathway - Homo sapiens (human) hsa04930 Type II diabetes mellitus - Homo sapiens (human) hsa05120 Epithelial cell signaling in Helicobacter pylori infection - Homo sapiens (human) hsa05142 Chagas disease - Homo sapiens (human) hsa05200 Pathways in cancer - Homo sapiens (human) hsa05210 Colorectal cancer - Homo sapiens (human) hsa05212 Pancreatic cancer - Homo sapiens (human) |
||||||||||||||||||||
| Putative miRNA Targets on MAPK8 | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] | ||||||||||||||||||||
| 3'UTR of MAPK8 (miRNA target sites are highlighted) |
>MAPK8|NM_002750|3'UTR 1 TGATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATGTCAACAGATCCGACTTTGGCC 81 TCTGATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGACTACTTGGGCCATCGGGGGGTGG 161 GAGGGATGGGGAGTCGGTTAGTCATTGATAGAACTACTTTGAAAACAATTCAGTGGTCTTATTTTTGGGTGATTTTTCAA 241 AAAATGTA Target sites Provided by authors Predicted by miRanda |
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
| miRNA:Target | hsa-miR-214 :: MAPK8 [ Functional MTI ] | ||||||
|---|---|---|---|---|---|---|---|
| Validation Method | GFP reporter assay , Microarray , qRT-PCR , Western blot | ||||||
| Conditions | HeLa | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | miRBase Target Database, PicTar, TargetScan | ||||||
| Original Description (Extracted from the article) | ... miR-214 negatively regulates MEK3 and JNK1 through binding to their 3'UTRs by assay of GFP expression (EGFP).// ... - Yang, Z. Chen, S. Luan, X. Li, Y. Liu, M. et al., 2009, IUBMB Life. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Yang, Z.
Chen, S.
Luan, X.
Li, Y.
Liu, M. et al. - IUBMB Life, 2009
MicroRNAs are a group of endogenously expressed, single-stranded, 18-24 nt RNAs that regulate diverse cellular pathways. Although documented evidence indicates that some microRNAs can function as oncogenes or tumor-suppressors, the role of miR-214 in regulating human cervical cancer cells remains unexplored. We determined the expression level of miR-214 and found it is downregulated in cervical cancer compared with normal tissue. Overexpression of miR-214 in HeLa cells, a human cervical cancer cell line, significantly inhibited cell proliferation according to the MTT and colony forming assays. HeLa cells that stably overexpress miR-214 downregulate the expression of MEK3 and JNK1 at both mRNA and protein levels. Further investigation revealed that miR-214 regulates the expression of MEK3 and JNK1 by targeting the 3'UTRs of these genes. Collectively, these results suggest that miR-214 negatively regulates HeLa cell proliferation by targeting the noncoding regions of MEK3 and JNK1 mRNAs.
LinkOut: [PMID: 19859982]
|

