Accession ID: MIRT005427 [miRNA, hsa-miR-214-3p :: MAPK8, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-214LinkOut: [miRBase ]
Synonyms MIRN214, miRNA214, mir-214, MIR214
Description Homo sapiens miR-214 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-214-3p
Mature Sequence 71| ACAGCAGGCACAGACAGGCAGU |92
Evidence Experimental
Experiments Cloned
Putative hsa-miR-214-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MAPK8 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms JNK, JNK-46, JNK1, JNK1A2, JNK21B1/2, PRKM8, SAPK1, SAPK1c
Description mitogen-activated protein kinase 8
Transcript NM_002750    LinkOut: [ RefSeq ]
Other Transcripts NM_139046 , NM_139047 , NM_139049   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MAPK8 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MAPK8
(miRNA target sites are highlighted)
>MAPK8|NM_002750|3'UTR
   1 TCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAATGTCAACAGATCCGACTTTGGCCTCT
  81 GATACAGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGACTACTTGGGCCATCGGGGGGTGGGAG
 161 GGATGGGGAGTCGGTTAGTCATTGATAGAACTACTTTGAAAACAATTCAGTGGTCTTATTTTTGGGTGATTTTTCAAAAA
 241 ATGTA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ugaCGGACAGACACGGACGACa 5'
             |||  |||| | |||||| 
Target 5' tggGCC--TCTG-GGCTGCTGt 3'
110 - 128 130.00 -20.10
2
miRNA  3' ugacGGACAGACA-CGGACGACa 5'
              :| | || | |||| ||| 
Target 5' cagaTCCGACTTTGGCCT-CTGa 3'
61 - 82 102.00 -12.60
3
miRNA  3' ugaCGGACAG-----ACACGGACGaca 5'
             |:|||||     ||||:|| |   
Target 5' gtcGTCTGTCAATGATGTGTCTTCaat 3'
29 - 55 87.00 -14.32
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-214-3p :: MAPK8    [ Functional MTI ]
Validation Method GFP reporter assay , Microarray , qRT-PCR , Western blot , Other , Reporter assay;qRT-PCR;Microarray;Other
Conditions HeLa
Location of target site 3'UTR
Tools used in this research miRBase Target Database , PicTar , TargetScan
Original Description (Extracted from the article) ... miR-214 negatively regulates MEK3 and JNK1 through binding to their 3'UTRs by assay of GFP expression (EGFP).// ...

- Yang, Z. Chen, S. Luan, X. Li, Y. Liu, M. et al., 2009, IUBMB Life.

Article - Yang, Z. Chen, S. Luan, X. Li, Y. Liu, M. et al.
- IUBMB Life, 2009
MicroRNAs are a group of endogenously expressed, single-stranded, 18-24 nt RNAs that regulate diverse cellular pathways. Although documented evidence indicates that some microRNAs can function as oncogenes or tumor-suppressors, the role of miR-214 in regulating human cervical cancer cells remains unexplored. We determined the expression level of miR-214 and found it is downregulated in cervical cancer compared with normal tissue. Overexpression of miR-214 in HeLa cells, a human cervical cancer cell line, significantly inhibited cell proliferation according to the MTT and colony forming assays. HeLa cells that stably overexpress miR-214 downregulate the expression of MEK3 and JNK1 at both mRNA and protein levels. Further investigation revealed that miR-214 regulates the expression of MEK3 and JNK1 by targeting the 3'UTRs of these genes. Collectively, these results suggest that miR-214 negatively regulates HeLa cell proliferation by targeting the noncoding regions of MEK3 and JNK1 mRNAs.
LinkOut: [PMID: 19859982]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
170 hsa-miR-214-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000148 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 5
MIRT000799 PTEN phosphatase and tensin homolog 5 7
MIRT004738 DAPK1 death-associated protein kinase 1 3 1
MIRT005426 MAP2K3 mitogen-activated protein kinase kinase 3 5 1
MIRT005427 MAPK8 mitogen-activated protein kinase 8 5 1
MIRT005551 POU4F2 POU class 4 homeobox 2 4 1
MIRT005765 PLXNB1 plexin B1 5 2
MIRT005811 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 3 1
MIRT006028 ING4 inhibitor of growth family, member 4 2 1
MIRT006375 XBP1 X-box binding protein 1 3 1
MIRT006644 QKI QKI, KH domain containing, RNA binding 1 1
MIRT006731 TWIST1 twist homolog 1 (Drosophila) 3 1
MIRT006816 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 4 2
MIRT006881 TP53 tumor protein p53 1 2
MIRT007031 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 3 2
MIRT007201 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) 1 1
MIRT007294 BCL2L2 BCL2-like 2 3 1
MIRT024958 FLOT1 flotillin 1 2 1
MIRT024959 MAP2K5 mitogen-activated protein kinase kinase 5 2 1
MIRT024960 HSPD1 heat shock 60kDa protein 1 (chaperonin) 2 1
MIRT024961 AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 2 1
MIRT024962 CPNE7 copine VII 2 1
MIRT024963 RASA1 RAS p21 protein activator (GTPase activating protein) 1 2 1
MIRT024964 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide 2 1
MIRT024965 ARL2 ADP-ribosylation factor-like 2 2 1
MIRT024966 AP3B1 adaptor-related protein complex 3, beta 1 subunit 2 1
MIRT024967 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT035545 PSMD10 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 1 1
MIRT035546 ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 1 1
MIRT053000 MAPK1 mitogen-activated protein kinase 1 3 1
MIRT053190 MAPK14 mitogen-activated protein kinase 14 2 1
MIRT053289 JAG1 jagged 1 3 1
MIRT053786 CCL5 chemokine (C-C motif) ligand 5 2 1
MIRT053795 UBE2I ubiquitin-conjugating enzyme E2I 3 1
MIRT054096 HDGF hepatoma-derived growth factor 4 2
MIRT054638 FGFR1 fibroblast growth factor receptor 1 4 2
MIRT054716 NRAS neuroblastoma RAS viral (v-ras) oncogene homolog 3 1
MIRT054876 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 1
MIRT076137 WDR81 WD repeat domain 81 1 1
MIRT082986 PNPLA6 patatin-like phospholipase domain containing 6 1 1
MIRT098546 TBPL1 TBP-like 1 1 3
MIRT100569 PIM1 pim-1 oncogene 3 2
MIRT108653 ZBTB33 zinc finger and BTB domain containing 33 1 2
MIRT117657 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT152280 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 1 1
MIRT153855 NCOA3 nuclear receptor coactivator 3 1 1
MIRT181245 ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT245860 PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) 1 2
MIRT277966 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 1 1
MIRT277972 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT302826 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT367265 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT393091 CDK6 cyclin-dependent kinase 6 4 4
MIRT437668 ABLIM3 actin binding LIM protein family, member 3 2 1
MIRT437669 DOCK9 dedicator of cytokinesis 9 2 1
MIRT437670 ARHGAP10 Rho GTPase activating protein 10 2 1
MIRT437671 TRPS1 trichorhinophalangeal syndrome I 2 1
MIRT437672 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 2
MIRT437673 RAB5B RAB5B, member RAS oncogene family 2 1
MIRT437674 CAPN5 calpain 5 2 1
MIRT437675 TWF1 twinfilin, actin-binding protein, homolog 1 (Drosophila) 2 1
MIRT437676 KIF1B kinesin family member 1B 2 1
MIRT437811 LTF lactotransferrin 1 1
MIRT438012 RAB15 RAB15, member RAS oncogene family 2 1
MIRT438091 POR P450 (cytochrome) oxidoreductase 1 1
MIRT438092 GSR glutathione reductase 1 1
MIRT438124 BAX BCL2-associated X protein 1 1
MIRT438406 CD274 CD274 molecule 2 1
MIRT438676 ALPK2 alpha-kinase 2 3 1
MIRT438677 PAPPA pregnancy-associated plasma protein A, pappalysin 1 3 1
MIRT438741 LZTS1 leucine zipper, putative tumor suppressor 1 3 1
MIRT438815 CADM1 cell adhesion molecule 1 1 1
MIRT442914 PCBD2 pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 1 1
MIRT443631 CPSF2 cleavage and polyadenylation specific factor 2, 100kDa 1 1
MIRT445668 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT448866 FAM49B family with sequence similarity 49, member B 1 1
MIRT451757 LRTM2 leucine-rich repeats and transmembrane domains 2 1 1
MIRT455569 TRAF1 TNF receptor-associated factor 1 1 1
MIRT455847 C9orf78 chromosome 9 open reading frame 78 1 1
MIRT456706 LDB1 LIM domain binding 1 1 1
MIRT457193 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT458051 TSEN54 tRNA splicing endonuclease 54 homolog (S. cerevisiae) 1 1
MIRT459637 GABARAP GABA(A) receptor-associated protein 1 1
MIRT459713 ZNF641 zinc finger protein 641 1 1
MIRT460214 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT462257 LAMA4 laminin, alpha 4 1 1
MIRT465374 TPM3 tropomyosin 3 1 3
MIRT466424 TFAP2A transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) 1 4
MIRT466659 TAF1D TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa 1 3
MIRT466847 STX6 syntaxin 6 1 1
MIRT468050 SIK1 salt-inducible kinase 1 1 1
MIRT468079 SHOC2 soc-2 suppressor of clear homolog (C. elegans) 1 3
MIRT468142 SH3BP4 SH3-domain binding protein 4 1 1
MIRT468371 SETD8 SET domain containing (lysine methyltransferase) 8 1 1
MIRT471522 PCGF3 polycomb group ring finger 3 1 1
MIRT472260 NFIC nuclear factor I/C (CCAAT-binding transcription factor) 1 1
MIRT472876 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT474648 KLF16 Kruppel-like factor 16 1 1
MIRT474824 KIAA0226 KIAA0226 1 1
MIRT474942 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT475711 HEYL hairy/enhancer-of-split related with YRPW motif-like 1 2
MIRT476269 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT478757 CS citrate synthase 1 1
MIRT479580 CDC42SE1 CDC42 small effector 1 1 1
MIRT480074 CALU calumenin 1 1
MIRT480443 C17orf49 chromosome 17 open reading frame 49 1 1
MIRT480535 C10orf76 chromosome 10 open reading frame 76 1 1
MIRT481483 ARL8B ADP-ribosylation factor-like 8B 1 1
MIRT482009 AMER1 family with sequence similarity 123B 1 4
MIRT482366 AGO2 eukaryotic translation initiation factor 2C, 2 1 1
MIRT484770 ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1 2
MIRT484989 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 4
MIRT485026 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT485044 TMEM189 transmembrane protein 189 1 4
MIRT488291 PARS2 prolyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT488503 SFMBT2 Scm-like with four mbt domains 2 1 2
MIRT490235 C9orf3 chromosome 9 open reading frame 3 1 1
MIRT490633 BCAM basal cell adhesion molecule (Lutheran blood group) 1 1
MIRT492577 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT493820 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT494341 CASKIN1 CASK interacting protein 1 1 1
MIRT495138 ZNRF1 zinc and ring finger 1, E3 ubiquitin protein ligase 1 1
MIRT496011 CD180 CD180 molecule 1 1
MIRT504552 ZNF417 zinc finger protein 417 1 3
MIRT506793 KLHL15 kelch-like 15 (Drosophila) 1 3
MIRT507713 CNIH cornichon homolog (Drosophila) 1 1
MIRT507993 BCL2L13 BCL2-like 13 (apoptosis facilitator) 1 2
MIRT512511 BTBD19 BTB (POZ) domain containing 19 1 1
MIRT522092 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT522688 LUZP1 leucine zipper protein 1 1 3
MIRT527622 BANP BTG3 associated nuclear protein 1 1
MIRT532199 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT538448 CNNM2 cyclin M2 1 1
MIRT541083 RLIM ring finger protein, LIM domain interacting 1 1
MIRT545364 LIN7C lin-7 homolog C (C. elegans) 1 1
MIRT547120 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547316 NPTN neuroplastin 1 1
MIRT547963 HIGD1A HIG1 hypoxia inducible domain family, member 1A 1 2
MIRT550758 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT563842 SMDT1 chromosome 22 open reading frame 32 1 1
MIRT565037 VAV2 vav 2 guanine nucleotide exchange factor 1 1
MIRT567665 ERGIC2 ERGIC and golgi 2 1 1
MIRT568571 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT569613 TRIM29 tripartite motif containing 29 1 1
MIRT570838 RPL7L1 ribosomal protein L7-like 1 1 1
MIRT571058 POLQ polymerase (DNA directed), theta 1 1
MIRT610138 FOXI2 forkhead box I2 1 1
MIRT613384 ABCC12 ATP-binding cassette, sub-family C (CFTR/MRP), member 12 1 1
MIRT616463 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618324 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT621584 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT622626 PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta 1 1
MIRT631494 RASSF4 Ras association (RalGDS/AF-6) domain family member 4 1 1
MIRT647291 JAG2 jagged 2 1 1
MIRT670695 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 2
MIRT691703 FLOT2 flotillin 2 1 1
MIRT692013 NAP1L4 nucleosome assembly protein 1-like 4 1 1
MIRT698217 TMEM248 transmembrane protein 248 1 1
MIRT703335 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 1 1
MIRT710116 MED23 mediator complex subunit 23 1 1
MIRT711978 HOMER2 homer homolog 2 (Drosophila) 1 1
MIRT714117 TMED9 transmembrane emp24 protein transport domain containing 9 1 1
MIRT718552 PIGQ phosphatidylinositol glycan anchor biosynthesis, class Q 1 1
MIRT719745 SLC39A11 solute carrier family 39 (metal ion transporter), member 11 1 1
MIRT720022 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 1 1
MIRT720364 ZBTB8B zinc finger and BTB domain containing 8B 1 1
MIRT721401 LDLRAD4 low density lipoprotein receptor class A domain containing 4 1 1
MIRT721529 DKK3 dickkopf 3 homolog (Xenopus laevis) 1 1
MIRT723091 INSIG1 insulin induced gene 1 1 1
MIRT724670 NCAN neurocan 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*