Accession ID: MIRT005456 [miRNA, hsa-miR-31-5p :: DMD, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-31LinkOut: [miRBase ]
Synonyms MIRN31, hsa-mir-31, miR-31, MIR31
Description Homo sapiens miR-31 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-31-5p
Mature Sequence 8| AGGCAAGAUGCUGGCAUAGCU |28
Evidence Experimental
Experiments Cloned
Putative hsa-miR-31-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol DMD LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BMD, CMD3B, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272
Description dystrophin
Transcript NM_000109    LinkOut: [ RefSeq ]
Other Transcripts NM_004006 , NM_004007 , NM_004009 , NM_004010 , NM_004011 , NM_004012 , NM_004013 , NM_004014 , NM_004015 , NM_004016 , NM_004017 , NM_004018 , NM_004019 , NM_004020 , NM_004021 , NM_004022 , NM_004023   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on DMD LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of DMD
(miRNA target sites are highlighted)
>DMD|NM_000109|3'UTR
   1 GAAGTCTTTTCCACATGGCAGATGATTTGGGCAGAGCGATGGAGTCCTTAGTATCAGTCATGACAGATGAAGAAGGAGCA
  81 GAATAAATGTTTTACAACTCCTGATTCCCGCATGGTTTTTATAATATTCATACAACAAAGAGGATTAGACAGTAAGAGTT
 161 TACAAGAAATAAATCTATATTTTTGTGAAGGGTAGTGGTATTATACTGTAGATTTCAGTAGTTTCTAAGTCTGTTATTGT
 241 TTTGTTAACAATGGCAGGTTTTACACGTCTATGCAATTGTACAAAAAAGTTATAAGAAAACTACATGTAAAATCTTGATA
 321 GCTAAATAACTTGCCATTTCTTTATATGGAACGCATTTTGGGTTGTTTAAAAATTTATAACAGTTATAAAGAAAGATTGT
 401 AAACTAAAGTGTGCTTTATAAAAAAAAGTTGTTTATAAAAACCCCTAAAAACAAAACAAACACACACACACACACATACA
 481 CACACACACACAAAACTTTGAGGCAGCGCATTGTTTTGCATCCTTTTGGCGTGATATCCATATGAAATTCATGGCTTTTT
 561 CTTTTTTTGCATATTAAAGATAAGACTTCCTCTACCACCACACCAAATGACTACTACACACTGCTCATTTGAGAACTGTC
 641 AGCTGAGTGGGGCAGGCTTGAGTTTTCATTTCATATATCTATATGTCTATAAGTATATAAATACTATAGTTATATAGATA
 721 AAGAGATACGAATTTCTATAGACTGACTTTTTCCATTTTTTAAATGTTCATGTCACATCCTAATAGAAAGAAATTACTTC
 801 TAGTCAGTCATCCAGGCTTACCTGCTTGGTCTAGAATGGATTTTTCCCGGAGCCGGAAGCCAGGAGGAAACTACACCACA
 881 CTAAAACATTGTCTACAGCTCCAGATGTTTCTCATTTTAAACAACTTTCCACTGACAACGAAAGTAAAGTAAAGTATTGG
 961 ATTTTTTTAAAGGGAACATGTGAATGAATACACAGGACTTATTATATCAGAGTGAGTAATCGGTTGGTTGGTTGATTGAT
1041 TGATTGATTGATACATTCAGCTTCCTGCTGCTAGCAATGCCACGATTTAGATTTAATGATGCTTCAGTGGAAATCAATCA
1121 GAAGGTATTCTGACCTTGTGAACATCAGAAGGTATTTTTTAACTCCCAAGCAGTAGCAGGACGATGATAGGGCTGGAGGG
1201 CTATGGATTCCCAGCCCATCCCTGTGAAGGAGTAGGCCACTCTTTAAGTGAAGGATTGGATGATTGTTCATAATACATAA
1281 AGTTCTCTGTAATTACAACTAAATTATTATGCCCTCTTCTCACAGTCAAAAGGAACTGGGTGGTTTGGTTTTTGTTGCTT
1361 TTTTAGATTTATTGTCCCATGTGGGATGAGTTTTTAAATGCCACAAGACATAATTTAAAATAAATAAACTTTGGGAAAAG
1441 GTGTAAAACAGTAGCCCCATCACATTTGTGATACTGACAGGTATCAACCCAGAAGCCCATGAACTGTGTTTCCATCCTTT
1521 GCATTTCTCTGCGAGTAGTTCCACACAGGTTTGTAAGTAAGTAAGAAAGAAGGCAAATTGATTCAAATGTTACAAAAAAA
1601 CCCTTCTTGGTGGATTAGACAGGTTAAATATATAAACAAACAAACAAAAATTGCTCAAAAAAGAGGAGAAAAGCTCAAGA
1681 GGAAAAGCTAAGGACTGGTAGGAAAAAGCTTTACTCTTTCATGCCATTTTATTTCTTTTTGATTTTTAAATCATTCATTC
1761 AATAGATACCACCGTGTGACCTATAATTTTGCAAATCTGTTACCTCTGACATCAAGTGTAATTAGCTTTTGGAGAGTGGG
1841 CTGACATCAAGTGTAATTAGCTTTTGGAGAGTGGGTTTTGTCCATTATTAATAATTAATTAATTAACATCAAACACGGCT
1921 TCTCATGCTATTTCTACCTCACTTTGGTTTTGGGGTGTTCCTGATAATTGTGCACACCTGAGTTCACAGCTTCACCACTT
2001 GTCCATTGCGTTATTTTCTTTTTCCTTTATAATTCTTTCTTTTTCCTTCATAATTTTCAAAAGAAAACCCAAAGCTCTAA
2081 GGTAACAAATTACCAAATTACATGAAGATTTGGTTTTTGTCTTGCATTTTTTTCCTTTATGTGACGCTGGACCTTTTCTT
2161 TACCCAAGGATTTTTAAAACTCAGATTTAAAACAAGGGGTTACTTTACATCCTACTAAGAAGTTTAAGTAAGTAAGTTTC
2241 ATTCTAAAATCAGAGGTAAATAGAGTGCATAAATAATTTTGTTTTAATCTTTTTGTTTTTCTTTTAGACACATTAGCTCT
2321 GGAGTGAGTCTGTCATAATATTTGAACAAAAATTGAGAGCTTTATTGCTGCATTTTAAGCATAATTAATTTGGACATTAT
2401 TTCGTGTTGTGTTCTTTATAACCACCAAGTATTAAACTGTAAATCATAATGTAACTGAAGCATAAACATCACATGGCATG
2481 TTTTGTCATTGTTTTCAGGTACTGAGTTCTTACTTGAGTATCATAATATATTGTGTTTTAACACCAACACTGTAACATTT
2561 ACGAATTATTTTTTTAAACTTCAGTTTTACTGCATTTTCACAACATATCAGACTTCACCAAATATATGCCTTACTATTGT
2641 ATTATAGTACTGCTTTACTGTGTATCTCAATAAAGCACGCAGTTATGTTAC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucgaUACGGUCGUAGAACGGa 5'
              ||| || ::|:|||:| 
Target 5' tcacATGGCA-TGTTTTGTCa 3'
2469 - 2488 124.00 -7.60
2
miRNA  3' ucgauaCGGUCGUAGAACGga 5'
                |::  ::||||||  
Target 5' gatttgGTTTTTGTCTTGCat 3'
2107 - 2127 123.00 -7.80
3
miRNA  3' ucGAUACGGUCG-----UAGAACGGa 5'
            || || :|||     | |||||| 
Target 5' atCT-TGATAGCTAAATAACTTGCCa 3'
312 - 336 122.00 -10.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-31-5p :: DMD    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot , Other
Conditions LA3�mHC2
Location of target site 3'UTR
Tools used in this research unknown
Original Description (Extracted from the article) ... The intense and localized expression of miR-31 in regenerating myoblasts of dystrophic muscles indicates that the high levels of miR-31 found in dystrophic conditions are due to the intensive regeneration programme that is mediated by the activation of satellite cells. Interestingly, in dystrophic myoblasts and satellite cells the lack of dystrophin correlates with a delay of the maturation process of the cells. ...

- Cacchiarelli, D. Incitti, T. Martone, J. et al., 2011, EMBO reports.

Article - Cacchiarelli, D. Incitti, T. Martone, J. et al.
- EMBO reports, 2011
Duchenne muscular dystrophy (DMD)-which is caused by mutations in the dystrophin gene-is one of the most severe myopathies. Among therapeutic strategies, exon skipping allows the rescue of dystrophin synthesis through the production of a shorter but functional messenger RNA. Here, we report the identification of a microRNA-miR-31-that represses dystrophin expression by targeting its 3' untranslated region. In human DMD myoblasts treated with exon skipping, we demonstrate that miR-31 inhibition increases dystrophin rescue. These results indicate that interfering with miR-31 activity can provide an ameliorating strategy for those DMD therapies that are aimed at efficiently recovering dystrophin synthesis.
LinkOut: [PMID: 21212803]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
176 hsa-miR-31-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000088 RHOA ras homolog family member A 4 4
MIRT000490 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 3 1
MIRT000491 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 3 1
MIRT001180 FOXP3 forkhead box P3 4 2
MIRT004019 SELE selectin E 3 1
MIRT004597 CASR calcium-sensing receptor 1 1
MIRT004968 YY1 YY1 transcription factor 3 1
MIRT004969 RET ret proto-oncogene 3 1
MIRT004970 NUMB numb homolog (Drosophila) 3 1
MIRT004971 NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive 3 1
MIRT004972 KLF13 Kruppel-like factor 13 3 1
MIRT004973 JAZF1 JAZF zinc finger 1 3 1
MIRT004974 HOXC13 homeobox C13 3 1
MIRT004975 ETS1 v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) 3 1
MIRT004976 ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 4 1
MIRT004977 MPRIP myosin phosphatase Rho interacting protein 3 1
MIRT004978 MMP16 matrix metallopeptidase 16 (membrane-inserted) 4 1
MIRT004979 RDX radixin 4 2
MIRT004980 CXCL12 chemokine (C-X-C motif) ligand 12 3 2
MIRT004981 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 3 1
MIRT004984 FZD3 frizzled family receptor 3 4 1
MIRT005456 DMD dystrophin 4 1
MIRT005566 TIAM1 T-cell lymphoma invasion and metastasis 1 4 1
MIRT005707 ICAM1 intercellular adhesion molecule 1 1 1
MIRT005874 DKK1 dickkopf 1 homolog (Xenopus laevis) 4 1
MIRT005875 DACT3 dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) 4 1
MIRT006026 WASF3 WAS protein family, member 3 2 1
MIRT006468 HIF1AN hypoxia inducible factor 1, alpha subunit inhibitor 3 2
MIRT006567 SATB2 SATB homeobox 2 4 5
MIRT007286 PRKCE protein kinase C, epsilon 1 1
MIRT007292 RASA1 RAS p21 protein activator (GTPase activating protein) 1 3 1
MIRT007319 STK40 serine/threonine kinase 40 2 2
MIRT007327 MCM2 minichromosome maintenance complex component 2 1 1
MIRT007328 CDK1 cyclin-dependent kinase 1 1 1
MIRT007367 CREG1 cellular repressor of E1A-stimulated genes 1 3 1
MIRT028387 Lats2 large tumor suppressor 2 1 1
MIRT035519 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT035528 MET met proto-oncogene (hepatocyte growth factor receptor) 2 3
MIRT049857 PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2 1 1
MIRT049858 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT049859 RPS7 ribosomal protein S7 1 1
MIRT049860 MED12 mediator complex subunit 12 1 1
MIRT049861 CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 1 1
MIRT049862 HIST1H2BC histone cluster 1, H2bc 1 1
MIRT049863 PTPRJ protein tyrosine phosphatase, receptor type, J 1 1
MIRT049864 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT049865 HEATR2 HEAT repeat containing 2 1 1
MIRT049866 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT049867 RPA1 replication protein A1, 70kDa 1 1
MIRT049868 TXNDC5 thioredoxin domain containing 5 (endoplasmic reticulum) 1 1
MIRT049869 AKAP8L A kinase (PRKA) anchor protein 8-like 1 1
MIRT049870 FLNA filamin A, alpha 1 1
MIRT049871 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT049872 NDFIP2 Nedd4 family interacting protein 2 1 1
MIRT049873 TRIB3 tribbles homolog 3 (Drosophila) 1 1
MIRT049874 NUP188 nucleoporin 188kDa 1 1
MIRT049875 RPS4Y1 ribosomal protein S4, Y-linked 1 1 1
MIRT049876 GLI2 GLI family zinc finger 2 1 1
MIRT049877 RPL37A ribosomal protein L37a 1 1
MIRT049878 EXOSC5 exosome component 5 1 1
MIRT049879 DDX19A DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A 1 1
MIRT049880 UBA6 ubiquitin-like modifier activating enzyme 6 1 1
MIRT049881 NOL9 nucleolar protein 9 1 1
MIRT049882 DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 1 1
MIRT049883 FAM134C family with sequence similarity 134, member C 1 1
MIRT049884 PEX19 peroxisomal biogenesis factor 19 1 1
MIRT049885 SMEK2 SMEK homolog 2, suppressor of mek1 (Dictyostelium) 1 1
MIRT049886 TRRAP transformation/transcription domain-associated protein 1 1
MIRT049887 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT049888 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT049889 NOP56 NOP56 ribonucleoprotein homolog (yeast) 1 1
MIRT049890 PCSK1N proprotein convertase subtilisin/kexin type 1 inhibitor 1 1
MIRT049891 ZNF275 zinc finger protein 275 1 1
MIRT049892 C2CD5 KIAA0528 1 1
MIRT049893 NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein 1 1
MIRT049894 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT049895 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT049896 GYG1 glycogenin 1 1 1
MIRT049897 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT049898 LRRC59 leucine rich repeat containing 59 1 1
MIRT049899 GHITM growth hormone inducible transmembrane protein 1 1
MIRT049900 EDC3 enhancer of mRNA decapping 3 homolog (S. cerevisiae) 1 1
MIRT049901 MYO1D myosin ID 1 1
MIRT049902 STOML2 stomatin (EPB72)-like 2 1 1
MIRT049903 EXOC6 exocyst complex component 6 1 1
MIRT049904 HOXA7 homeobox A7 1 1
MIRT049905 SFXN1 sideroflexin 1 1 1
MIRT049906 ILF2 interleukin enhancer binding factor 2, 45kDa 1 1
MIRT053750 SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 2 1
MIRT053751 MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 2 1
MIRT053752 RAB27A RAB27A, member RAS oncogene family 2 1
MIRT054726 TBXA2R thromboxane A2 receptor 4 1
MIRT054727 C11orf30 chromosome 11 open reading frame 30 4 1
MIRT067320 SESN2 sestrin 2 1 2
MIRT248732 ARID1A AT rich interactive domain 1A (SWI-like) 3 1
MIRT267266 TMEM109 transmembrane protein 109 1 1
MIRT273599 SP1 Sp1 transcription factor 1 1
MIRT294476 ZNF805 zinc finger protein 805 1 1
MIRT303306 SNRNP27 small nuclear ribonucleoprotein 27kDa (U4/U6.U5) 1 1
MIRT316765 FOXC1 forkhead box C1 1 2
MIRT369398 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 4
MIRT395121 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT437432 ABCB9 ATP-binding cassette, sub-family B (MDR/TAP), member 9 3 1
MIRT437512 RHOBTB1 Rho-related BTB domain containing 1 1 1
MIRT437549 SP7 Sp7 transcription factor 3 1
MIRT443895 NUDT3 nudix (nucleoside diphosphate linked moiety X)-type motif 3 1 2
MIRT444977 C15orf52 chromosome 15 open reading frame 52 1 1
MIRT445239 FOXD4 forkhead box D4 1 1
MIRT445498 FOXD4L5 forkhead box D4-like 5 1 1
MIRT445501 FOXD4L4 forkhead box D4-like 4 1 1
MIRT447023 FOXD4L1 forkhead box D4-like 1 1 1
MIRT449247 MICA MHC class I polypeptide-related sequence A 1 1
MIRT450782 PAPOLG poly(A) polymerase gamma 1 1
MIRT453257 PARP11 poly (ADP-ribose) polymerase family, member 11 1 1
MIRT456182 ZDHHC6 zinc finger, DHHC-type containing 6 1 1
MIRT467509 SMG1 smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT468710 SDC4 syndecan 4 1 1
MIRT469164 RNF111 ring finger protein 111 1 1
MIRT471166 PHF12 PHD finger protein 12 1 1
MIRT472350 TSPAN1 tetraspanin 1 1 1
MIRT477957 DPM2 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit 1 1
MIRT481316 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT481631 ARF1 ADP-ribosylation factor 1 1 1
MIRT484657 HOXD3 homeobox D3 1 2
MIRT485314 MZT1 mitotic spindle organizing protein 1 1 2
MIRT488734 MXRA7 matrix-remodelling associated 7 1 1
MIRT488972 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 1 1
MIRT494953 IL5RA interleukin 5 receptor, alpha 1 1
MIRT496171 RPL35A ribosomal protein L35a 1 1
MIRT498328 NF2 neurofibromin 2 (merlin) 1 1
MIRT499576 INTU inturned planar cell polarity effector homolog (Drosophila) 1 1
MIRT502931 CDC42SE1 CDC42 small effector 1 1 2
MIRT506784 KLHL15 kelch-like 15 (Drosophila) 1 3
MIRT508501 RSRC1 arginine/serine-rich coiled-coil 1 1 3
MIRT509453 ZNF587 zinc finger protein 587 1 3
MIRT509855 ZNF641 zinc finger protein 641 1 2
MIRT516241 BCAS4 breast carcinoma amplified sequence 4 1 1
MIRT516565 PARP1 poly (ADP-ribose) polymerase 1 1 2
MIRT525051 FRK fyn-related kinase 1 1
MIRT534347 SFT2D2 SFT2 domain containing 2 1 1
MIRT539168 AR androgen receptor 1 1
MIRT539748 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT540716 GUF1 GUF1 GTPase homolog (S. cerevisiae) 1 1
MIRT540987 ZNF460 zinc finger protein 460 1 2
MIRT541504 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT542421 ZNF331 zinc finger protein 331 1 1
MIRT549566 C19orf12 chromosome 19 open reading frame 12 1 1
MIRT549839 ECHDC1 enoyl CoA hydratase domain containing 1 1 1
MIRT551148 ZNF678 zinc finger protein 678 1 1
MIRT551646 CCDC127 coiled-coil domain containing 127 1 1
MIRT552507 ZIK1 zinc finger protein interacting with K protein 1 homolog (mouse) 1 2
MIRT553858 SYDE2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) 1 1
MIRT555063 PYURF PIGY upstream reading frame 1 1
MIRT556625 LAPTM4A lysosomal protein transmembrane 4 alpha 1 1
MIRT564127 FZD1 frizzled family receptor 1 1 1
MIRT564146 GTF2E1 general transcription factor IIE, polypeptide 1, alpha 56kDa 1 1
MIRT564314 CCNT1 cyclin T1 1 1
MIRT565481 SPRTN SprT-like N-terminal domain 1 1
MIRT570106 SLC18B1 solute carrier family 18, subfamily B, member 1 1 1
MIRT571745 QSER1 glutamine and serine rich 1 1 1
MIRT572342 CKAP2L cytoskeleton associated protein 2-like 1 2
MIRT622081 SRPX2 sushi-repeat containing protein, X-linked 2 1 1
MIRT637924 LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 1 1
MIRT641554 LIPG lipase, endothelial 1 1
MIRT644331 IPP intracisternal A particle-promoted polypeptide 1 1
MIRT654835 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT664036 RPL27A ribosomal protein L27a 1 1
MIRT682946 RPL12 ribosomal protein L12 1 1
MIRT689545 XPO6 exportin 6 1 1
MIRT693637 ACBD7 acyl-CoA binding domain containing 7 1 1
MIRT702575 JARID2 jumonji, AT rich interactive domain 2 1 1
MIRT705803 AKNA AT-hook transcription factor 1 1
MIRT706577 AFF1 AF4/FMR2 family, member 1 1 1
MIRT719138 DPYSL5 dihydropyrimidinase-like 5 1 1
MIRT720757 FAM193A family with sequence similarity 193, member A 1 1
MIRT722723 MCMBP minichromosome maintenance complex binding protein 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*