Accession ID: MIRT005474 [miRNA, hsa-miR-1285-3p :: TP53, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1285-1LinkOut: [miRBase ]
Synonyms MIRN1285-1, hsa-mir-1285-1, MIR1285-1
Description Homo sapiens miR-1285-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1285-3p
Mature Sequence 51| UCUGGGCAACAAAGUGAGACCU |72
Evidence Experimental
Experiments Solexa
Putative hsa-miR-1285-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms FLJ92943, LFS1, TRP53, p53
Description tumor protein p53
Transcript NM_0011261    LinkOut: [ RefSeq ]
Other Transcripts NM_0011261 , NM_0005 , NM_0011261 , NM_0011261 , NM_0011261 , NM_0011261   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP53 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_0011261|3'UTR
   1 TAAAGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAA
  81 ACTCGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTC
 161 AAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTAC
 241 CTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGAC
 321 AGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTC
 401 AGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGG
 481 AGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGT
 561 TCTTGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTC
 641 CCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATT
 721 GTGAGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAG
 801 GGTGCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTC
 881 AAGTCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATC
 961 CCACACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCT
1041 TTTTTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTG
1121 ATCTTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTC
1201 ATGCCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCC
1281 TGGGCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGG
1361 TCAACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTT
1441 TTATATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucCAGAGUGAAACAACGGGUCu 5'
            |||||:||||||||||||| 
Target 5' ggGTCTCGCTTTGTTGCCCAGg 3'
1081 - 1102 196.00 -39.00
2
miRNA  3' ucCAGAGUGAAACAACGGGUCu 5'
            |||||||  |||||||||| 
Target 5' ggGTCTCACAGTGTTGCCCAGg 3'
1244 - 1265 184.00 -34.10
3
miRNA  3' uccaGAGUGAAACAACGGGUCu 5'
              ||||    | ||||||| 
Target 5' ggaaCTCA--AGGATGCCCAGg 3'
154 - 173 146.00 -18.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1285-3p :: TP53    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions HEK293T , SH-SY5Y , HepG2 , MCF-7
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... In this study, we used a high-through- put luciferase reporter screen to demonstrate that p53 can be regulated by microRNA-1285 (miR-1285). Notably, miR-612, which has the same seed sequence as miR-1285, cannot bind to the 30 untranslated region (3' UTR) of p53.// ...

- Tian, S. Huang, S. Wu, S. Guo, W. Li, J. He, X., 2010, Biochem Biophys Res Commun.

Article - Tian, S. Huang, S. Wu, S. Guo, W. Li, J. He, X.
- Biochem Biophys Res Commun, 2010
The well-known tumor suppressor p53 plays critical roles in the modulation of multiple cellular processes. The regulation of p53 is complicated and remains elusive. In this study, we used a high-throughput luciferase reporter screen to demonstrate that p53 can be regulated by microRNA-1285 (miR-1285). Notably, miR-612, which has the same seed sequence as miR-1285, cannot bind to the 3' untranslated region (3' UTR) of p53. Mutational analyses confirmed that the 3' UTR of p53 mRNA contains two miR-1285 target sites, which are nearly perfectly complementary to the mature miR-1285 sequence. Ectopic expression of miR-1285 inhibits expression of p53 mRNA and protein. In contrast, silencing of miR-1285 increases p53 expression. Furthermore, miR-1285 inhibits the transcription of p21, a master gene downstream of p53. In conclusion, our findings provide the first evidence that miR-1285 directly regulates the expression of p53 by directly targeting its 3' UTR.
LinkOut: [PMID: 20417621]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
3 hsa-miR-1285-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005474 TP53 tumor protein p53 4 1
MIRT006814 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 4 1
MIRT035906 COIL coilin 1 1