Accession ID: MIRT005474 [miRNA, hsa-miR-1285-3p :: TP53, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1285-1LinkOut: [miRBase ]
Synonyms MIRN1285-1, hsa-mir-1285-1, MIR1285-1
Description Homo sapiens miR-1285-1 stem-loop
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-1285-3p
Mature Sequence 51| UCUGGGCAACAAAGUGAGACCU |72
Evidence Experimental
Experiments Illumina
Putative hsa-miR-1285-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol TP53 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms BCC7, LFS1, P53, TRP53
Description tumor protein p53
Transcript NM_001126114    LinkOut: [ RefSeq ]
Other Transcripts NM_001126112 , NM_000546 , NM_001126113 , NM_001126115 , NM_001126116 , NM_001126117   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on TP53 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_001126114|3'UTR
   1 AGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAAACT
  81 CGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAG
 161 GATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTC
 241 CCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGACAGC
 321 CTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGA
 401 AGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGG
 481 AGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGTTCT
 561 TGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTCCCT
 641 CACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATTGTG
 721 AGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAGGGT
 801 GCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTCAAG
 881 TCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATCCCA
 961 CACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCTTTT
1041 TTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTGATC
1121 TTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTCATG
1201 CCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCCTGG
1281 GCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGGTCA
1361 ACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTTTTA
1441 TATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucCAGAGUGAAACAACGGGUCu 5'
            |||||:||||||||||||| 
Target 5' ggGTCTCGCTTTGTTGCCCAGg 3'
1078 - 1099 196.00 -39.00
2
miRNA  3' ucCAGAGUGAAACAACGGGUCu 5'
            |||||||  |||||||||| 
Target 5' ggGTCTCACAGTGTTGCCCAGg 3'
1241 - 1262 184.00 -34.10
3
miRNA  3' uccaGAGUGAAACAACGGGUCu 5'
              ||||    | ||||||| 
Target 5' ggaaCTCA--AGGATGCCCAGg 3'
151 - 170 146.00 -18.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1285-3p :: TP53    [ Functional MTI ]
Validation Method Luciferase reporter assay , qRT-PCR , Western blot ,
Conditions HEK293T , SH-SY5Y , HepG2 , MCF-7
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... In this study, we used a high-through- put luciferase reporter screen to demonstrate that p53 can be regulated by microRNA-1285 (miR-1285). Notably, miR-612, which has the same seed sequence as miR-1285, cannot bind to the 30 untranslated region (3' UTR) of p53.// ...

- Tian, S. Huang, S. Wu, S. Guo, W. Li, J. He, X., 2010, Biochem Biophys Res Commun.

Article - Tian, S. Huang, S. Wu, S. Guo, W. Li, J. He, X.
- Biochem Biophys Res Commun, 2010
The well-known tumor suppressor p53 plays critical roles in the modulation of multiple cellular processes. The regulation of p53 is complicated and remains elusive. In this study, we used a high-throughput luciferase reporter screen to demonstrate that p53 can be regulated by microRNA-1285 (miR-1285). Notably, miR-612, which has the same seed sequence as miR-1285, cannot bind to the 3' untranslated region (3' UTR) of p53. Mutational analyses confirmed that the 3' UTR of p53 mRNA contains two miR-1285 target sites, which are nearly perfectly complementary to the mature miR-1285 sequence. Ectopic expression of miR-1285 inhibits expression of p53 mRNA and protein. In contrast, silencing of miR-1285 increases p53 expression. Furthermore, miR-1285 inhibits the transcription of p21, a master gene downstream of p53. In conclusion, our findings provide the first evidence that miR-1285 directly regulates the expression of p53 by directly targeting its 3' UTR.
LinkOut: [PMID: 20417621]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
180 hsa-miR-1285-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005474 TP53 tumor protein p53 4 1
MIRT006814 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 4 1
MIRT035906 COIL coilin 1 1
MIRT142262 DCTN5 dynactin 5 (p25) 1 2
MIRT455615 SRSF3 serine/arginine-rich splicing factor 3 1 1
MIRT458689 MRI1 methylthioribose-1-phosphate isomerase homolog (S. cerevisiae) 1 1
MIRT470849 PLXND1 plexin D1 1 1
MIRT471840 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT475230 IKZF3 IKAROS family zinc finger 3 (Aiolos) 1 2
MIRT480296 C7orf73 chromosome 7 open reading frame 73 1 2
MIRT483512 C10orf76 chromosome 10 open reading frame 76 1 1
MIRT484954 ZBTB34 zinc finger and BTB domain containing 34 1 3
MIRT490803 PSMD3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1 1
MIRT493377 KIAA1614 KIAA1614 1 1
MIRT496410 PARVB parvin, beta 1 1
MIRT497269 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT497680 SYNGR1 synaptogyrin 1 1 1
MIRT498224 TLN2 talin 2 1 1
MIRT498315 BCL11B B-cell CLL/lymphoma 11B (zinc finger protein) 1 1
MIRT504052 TOMM5 translocase of outer mitochondrial membrane 5 homolog (yeast) 1 1
MIRT516315 F8A2 coagulation factor VIII-associated 2 1 1
MIRT516341 F8A3 coagulation factor VIII-associated 3 1 1
MIRT517815 UGDH UDP-glucose 6-dehydrogenase 1 3
MIRT518745 C1orf35 chromosome 1 open reading frame 35 1 1
MIRT519297 MLH1 mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) 1 1
MIRT520389 UBB ubiquitin B 1 2
MIRT525230 DPY19L3 dpy-19-like 3 (C. elegans) 1 1
MIRT533149 WNT10A wingless-type MMTV integration site family, member 10A 1 1
MIRT533546 TPR translocated promoter region, nuclear basket protein 1 1
MIRT533686 TMEM86A transmembrane protein 86A 1 1
MIRT534546 RUNX1 runt-related transcription factor 1 1 1
MIRT539594 SSH2 slingshot homolog 2 (Drosophila) 1 1
MIRT539678 ZBTB44 zinc finger and BTB domain containing 44 1 1
MIRT539712 EIF3H eukaryotic translation initiation factor 3, subunit H 1 1
MIRT539731 DNAH10OS dynein, axonemal, heavy chain 10 opposite strand 1 1
MIRT539757 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT539789 EMC1 ER membrane protein complex subunit 1 1 2
MIRT539813 GAPVD1 GTPase activating protein and VPS9 domains 1 1 1
MIRT539997 SLC24A4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 1 1
MIRT540075 SSH3 slingshot homolog 3 (Drosophila) 1 1
MIRT540093 NPY4R pancreatic polypeptide receptor 1 1 1
MIRT540429 FAM83F family with sequence similarity 83, member F 1 1
MIRT540514 CXCL10 chemokine (C-X-C motif) ligand 10 1 1
MIRT540533 ZNF417 zinc finger protein 417 1 1
MIRT540624 F2RL2 coagulation factor II (thrombin) receptor-like 2 1 1
MIRT540912 PON1 paraoxonase 1 1 1
MIRT540992 ZNF460 zinc finger protein 460 1 2
MIRT541514 TOR1AIP1 torsin A interacting protein 1 1 1
MIRT541635 PARP2 poly (ADP-ribose) polymerase 2 1 1
MIRT541667 ATP8B3 ATPase, aminophospholipid transporter, class I, type 8B, member 3 1 1
MIRT541740 ZC3HAV1 zinc finger CCCH-type, antiviral 1 1 1
MIRT541815 SMU1 smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) 1 1
MIRT541906 VWA7 von Willebrand factor A domain containing 7 1 1
MIRT542007 XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 1 1
MIRT542022 PEX2 peroxisomal biogenesis factor 2 1 1
MIRT542189 FUT1 fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) 1 3
MIRT542206 C14orf142 chromosome 14 open reading frame 142 1 1
MIRT542339 LIMD1 LIM domains containing 1 1 1
MIRT542428 ZNF331 zinc finger protein 331 1 1
MIRT542461 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) 1 1
MIRT542496 WDR13 WD repeat domain 13 1 1
MIRT542555 MRPS10 mitochondrial ribosomal protein S10 1 1
MIRT542701 RPS15A ribosomal protein S15a 1 1
MIRT542821 PDE12 phosphodiesterase 12 1 1
MIRT552110 PPP1R1A protein phosphatase 1, regulatory (inhibitor) subunit 1A 1 1
MIRT555608 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT564918 YTHDF1 YTH domain family, member 1 1 1
MIRT568611 ACVR2A activin A receptor, type IIA 1 1
MIRT608704 GMPR guanosine monophosphate reductase 1 1
MIRT610063 MYBPC1 myosin binding protein C, slow type 1 1
MIRT610797 KLK2 kallikrein-related peptidase 2 1 1
MIRT617181 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT620583 WBSCR27 Williams Beuren syndrome chromosome region 27 1 2
MIRT623350 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 1 1
MIRT623875 FUS fused in sarcoma 1 1
MIRT625420 IMP4 IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) 1 1
MIRT626391 ZMYM6 zinc finger, MYM-type 6 1 1
MIRT630229 SORD sorbitol dehydrogenase 1 1
MIRT631872 BBS5 Bardet-Biedl syndrome 5 1 1
MIRT631907 VEGFC vascular endothelial growth factor C 1 1
MIRT632007 POPDC2 popeye domain containing 2 1 1
MIRT632878 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT633315 LINC00346 long intergenic non-protein coding RNA 346 1 1
MIRT633991 SLC35E2 solute carrier family 35, member E2 1 1
MIRT635250 ELOVL6 ELOVL fatty acid elongase 6 1 1
MIRT635260 FBXL20 F-box and leucine-rich repeat protein 20 1 1
MIRT635282 GK5 glycerol kinase 5 (putative) 1 1
MIRT635864 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT636625 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 2
MIRT637087 SELPLG selectin P ligand 1 1
MIRT639027 AAK1 AP2 associated kinase 1 1 1
MIRT640878 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT641930 SLC25A16 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 1 1
MIRT642175 HEBP2 heme binding protein 2 1 1
MIRT642253 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 1 1
MIRT642856 RNF135 ring finger protein 135 1 1
MIRT643242 PRSS21 protease, serine, 21 (testisin) 1 1
MIRT643377 TRIM16L tripartite motif containing 16-like 1 1
MIRT646933 MCCC2 methylcrotonoyl-CoA carboxylase 2 (beta) 1 1
MIRT647805 FRMD8 FERM domain containing 8 1 1
MIRT650519 UFM1 ubiquitin-fold modifier 1 1 1
MIRT651620 WASF3 WAS protein family, member 3 1 1
MIRT655590 OTUD7B OTU domain containing 7B 1 1
MIRT657654 GPR75 G protein-coupled receptor 75 1 1
MIRT657837 GJD3 gap junction protein, delta 3, 31.9kDa 1 1
MIRT658359 FAM65B family with sequence similarity 65, member B 1 1
MIRT661175 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT661334 TBC1D15 TBC1 domain family, member 15 1 1
MIRT662006 ZNF445 zinc finger protein 445 1 1
MIRT662196 MEI1 meiosis inhibitor 1 1 1
MIRT663475 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT663960 ZNF554 zinc finger protein 554 1 1
MIRT665909 TBCCD1 TBCC domain containing 1 1 1
MIRT666031 STRN3 striatin, calmodulin binding protein 3 1 1
MIRT666498 SBNO1 strawberry notch homolog 1 (Drosophila) 1 1
MIRT667293 MYPN myopalladin 1 2
MIRT668022 HAUS3 HAUS augmin-like complex, subunit 3 1 1
MIRT670089 ABCF3 ATP-binding cassette, sub-family F (GCN20), member 3 1 2
MIRT670600 LLGL1 lethal giant larvae homolog 1 (Drosophila) 1 2
MIRT670691 SUGT1 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1 1
MIRT670850 SFT2D2 SFT2 domain containing 2 1 1
MIRT670983 MED17 mediator complex subunit 17 1 1
MIRT672623 IGF2R insulin-like growth factor 2 receptor 1 1
MIRT673225 KLHDC8A kelch domain containing 8A 1 1
MIRT674267 ZNF284 zinc finger protein 284 1 1
MIRT675633 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 1 1
MIRT675808 MED28 mediator complex subunit 28 1 1
MIRT676339 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT681726 KCNE4 potassium voltage-gated channel, Isk-related family, member 4 1 1
MIRT682846 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT682915 FAM73A family with sequence similarity 73, member A 1 1
MIRT682934 ZNF292 zinc finger protein 292 1 1
MIRT682952 RPL12 ribosomal protein L12 1 1
MIRT683032 SUSD5 sushi domain containing 5 1 1
MIRT684389 MCTS1 malignant T cell amplified sequence 1 1 1
MIRT684689 OR7D2 olfactory receptor, family 7, subfamily D, member 2 1 1
MIRT687204 PLXNA3 plexin A3 1 1
MIRT689147 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 1 1
MIRT689634 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT690600 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT690804 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT690945 GLG1 golgi glycoprotein 1 1 1
MIRT691852 OSCAR osteoclast associated, immunoglobulin-like receptor 1 1
MIRT693617 CENPL centromere protein L 1 1
MIRT693759 ZNF383 zinc finger protein 383 1 1
MIRT694016 PPIL4 peptidylprolyl isomerase (cyclophilin)-like 4 1 1
MIRT694596 AAR2 AAR2 splicing factor homolog (S. cerevisiae) 1 1
MIRT694985 PLAC8 placenta-specific 8 1 1
MIRT695019 MRPS21 mitochondrial ribosomal protein S21 1 1
MIRT696416 DOCK7 dedicator of cytokinesis 7 1 1
MIRT697805 UBXN2A UBX domain protein 2A 1 1
MIRT697943 TVP23C family with sequence similarity 18, member B2 1 1
MIRT698777 STK4 serine/threonine kinase 4 1 1
MIRT699534 SIX4 SIX homeobox 4 1 1
MIRT701075 PARD6B par-6 partitioning defective 6 homolog beta (C. elegans) 1 1
MIRT702612 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein-like 2 1 1
MIRT702690 IRGQ immunity-related GTPase family, Q 1 1
MIRT702933 HMX3 H6 family homeobox 3 1 1
MIRT703723 FAM127A family with sequence similarity 127, member A 1 1
MIRT704298 DDX19B DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B 1 1
MIRT704334 DCTN6 dynactin 6 1 1
MIRT706760 KIAA0907 KIAA0907 1 1
MIRT708485 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 1 1
MIRT710775 PHF7 PHD finger protein 7 1 1
MIRT712486 FSTL3 follistatin-like 3 (secreted glycoprotein) 1 1
MIRT712786 ZNF154 zinc finger protein 154 1 1
MIRT714509 SHE Src homology 2 domain containing E 1 1
MIRT714773 TERF1 telomeric repeat binding factor (NIMA-interacting) 1 1 1
MIRT715265 RNF125 ring finger protein 125, E3 ubiquitin protein ligase 1 1
MIRT716449 TMPRSS11BNL TMPRSS11B N terminal-like 1 1
MIRT718200 PSMF1 proteasome (prosome, macropain) inhibitor subunit 1 (PI31) 1 1
MIRT720003 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa 1 1
MIRT720396 ZNF549 zinc finger protein 549 1 1
MIRT720599 TTC39C tetratricopeptide repeat domain 39C 1 1
MIRT721233 CRCP CGRP receptor component 1 1
MIRT721263 SH3D19 SH3 domain containing 19 1 1
MIRT721803 GRM1 glutamate receptor, metabotropic 1 1 1
MIRT722575 C1orf95 chromosome 1 open reading frame 95 1 1
MIRT722844 C17orf102 chromosome 17 open reading frame 102 1 1
MIRT722911 COA4 cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*