Accession ID: MIRT005488 [miRNA, hsa-miR-138-5p :: CEBPA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-138-2LinkOut: [miRBase ]
Description Homo sapiens miR-138-2 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-138-5p
Mature Sequence 10| AGCUGGUGUUGUGAAUCAGGCCG |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-138-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-138-5p :: CEBPA    [ Functional MTI ]
Validation Method qRT-PCR
Conditions adipose tissue-derived mesenchymal stem cells (hAD-MSCs)
Original Description (Extracted from the article) ... key adipogenic transcription factors and adipocyte-speciļ¬c genes were down-regulated at day 3 of differentiation due to the overexpression of miR-138 (Fig. 1E). Therefore, over- expression of miR-138 resulted in adipogenesis inhibition of hAD-MSCs.// ...

- Yang, Z. Bian, C. Zhou, H. Huang, S. Wang, et al., 2011, Stem cells and development.

Article - Yang, Z. Bian, C. Zhou, H. Huang, S. Wang, et al.
- Stem cells and development, 2011
A better understanding of the molecular mechanisms underlying the differentiation of human adipose tissue-derived mesenchymal stem cells (hAD-MSCs) could provide new insights into the pathogenesis of a number of diseases, such as obesity and diabetes, and broaden the spectrum of potential hAD-MSCs-based cell therapy. In this study, we reported that a human microRNA, hsa-miR-138, could inhibit the adipogenic differentiation of hAD-MSCs. Our results showed that miR-138 was significantly down-regulated during adipogenic differentiation. Overexpression of miR-138 in hAD-MSCs could effectively reduce lipid droplets accumulation, inhibit expression of key adipogenic transcription factors cytidine-cytidine-adenosine-adenosine-thymidine (CCAAT) enhancer binding protein alpha and peroxisome proliferator-activated receptor gamma 2 as well as several other adipogenic marker genes, such as fatty acid binding protein 4 and lipoprotein lipase. Further studies showed that the expression of adenovirus early region 1-A-like inhibitor of differentiation 1 (EID-1), a nuclear receptor coregulator, was inversely correlated with that of miR-138 when hAD-MSCs were differentiated into adipocytes. Knockdown of EID-1 by RNA interference inhibited adipocyte differentiation of hAD-MSCs. In addition, luciferase reporter assays demonstrated that miR-138 directly targeted the 3' untranslated region of EID-1, implying that the negative role of miR-138 in the adipocyte differentiation of hAD-MSCs is at least partially mediated via repressing EID-1. Taken together, this study shows that miR-138 plays a negative role in adipogenic differentiation and sheds light on the role of miRNAs during differentiation of hAD-MSCs toward adipocytes.
LinkOut: [PMID: 20486779]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
98 hsa-miR-138-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000493 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 4 1
MIRT000494 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 4 1
MIRT000495 RHOC ras homolog family member C 5 4
MIRT000797 SLC45A3 solute carrier family 45, member 3 3 1
MIRT003991 TERT telomerase reverse transcriptase 4 1
MIRT005487 EID1 EP300 interacting inhibitor of differentiation 1 4 1
MIRT005488 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT005489 PPARG peroxisome proliferator-activated receptor gamma 2 1
MIRT005490 FABP4 fatty acid binding protein 4, adipocyte 2 1
MIRT005491 LPL lipoprotein lipase 2 1
MIRT005691 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT006020 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 3 1
MIRT006142 FOSL1 FOS-like antigen 1 2 1
MIRT006271 SIRT1 sirtuin 1 1 1
MIRT006299 CCND3 cyclin D3 3 3
MIRT006388 PTK2 PTK2 protein tyrosine kinase 2 2 1
MIRT006493 H2AFX H2A histone family, member X 3 3
MIRT006744 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 2
MIRT006864 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT006865 BLCAP bladder cancer associated protein 2 1
MIRT006866 MXD1 MAX dimerization protein 1 2 1
MIRT007273 RELN reelin 1 1
MIRT007300 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 4
MIRT007335 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT021683 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) 1 1
MIRT021684 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT021685 PLEK2 pleckstrin 2 1 1
MIRT021686 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT021687 SNAI2 snail homolog 2 (Drosophila) 2 1
MIRT021688 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT021689 EED embryonic ectoderm development 2 1
MIRT021690 SUZ12 suppressor of zeste 12 homolog (Drosophila) 2 1
MIRT021691 ZEB2 zinc finger E-box binding homeobox 2 2 1
MIRT021692 VIM vimentin 4 2
MIRT035577 KRT19 keratin 19 1 1
MIRT045827 PHKG2 phosphorylase kinase, gamma 2 (testis) 1 1
MIRT045828 PPP1R13B protein phosphatase 1, regulatory subunit 13B 1 1
MIRT045829 RARA retinoic acid receptor, alpha 1 1
MIRT045830 RGS12 regulator of G-protein signaling 12 1 1
MIRT045831 TOR2A torsin family 2, member A 1 1
MIRT045832 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT045833 NVL nuclear VCP-like 1 1
MIRT045834 DMKN dermokine 1 1
MIRT045835 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT045836 HIST1H2BJ histone cluster 1, H2bj 1 1
MIRT052908 S100A1 S100 calcium binding protein A1 1 1
MIRT053080 CCND1 cyclin D1 4 1
MIRT053168 SENP1 SUMO1/sentrin specific peptidase 1 3 1
MIRT054578 GPR124 G protein-coupled receptor 124 4 1
MIRT054682 RMND5A required for meiotic nuclear division 5 homolog A (S. cerevisiae) 4 1
MIRT077621 IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 1 3
MIRT087849 CBY1 chibby homolog 1 (Drosophila) 1 2
MIRT168540 HMGA1 high mobility group AT-hook 1 1 1
MIRT177393 ZMYND11 zinc finger, MYND-type containing 11 1 1
MIRT221379 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 1 3
MIRT367645 ARHGAP42 Rho GTPase activating protein 42 1 2
MIRT438201 TWIST2 twist homolog 2 (Drosophila) 1 1
MIRT438462 MAP3K11 mitogen-activated protein kinase kinase kinase 11 1 1
MIRT438755 LCN2 lipocalin 2 3 1
MIRT445060 C16orf87 chromosome 16 open reading frame 87 1 1
MIRT452243 TRAM1 translocation associated membrane protein 1 1 1
MIRT478683 CSRP2 cysteine and glycine-rich protein 2 1 2
MIRT484897 ZNF607 zinc finger protein 607 1 1
MIRT487900 CST9 cystatin 9 (testatin) 1 1
MIRT488907 TSTD2 thiosulfate sulfurtransferase (rhodanese)-like domain containing 2 1 1
MIRT491518 IL10RA interleukin 10 receptor, alpha 1 1
MIRT493244 MEX3A mex-3 homolog A (C. elegans) 1 1
MIRT501251 SEMA4C sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C 1 3
MIRT507277 FERMT2 fermitin family member 2 1 1
MIRT507289 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT510063 C12orf49 chromosome 12 open reading frame 49 1 2
MIRT510977 PFN2 profilin 2 1 3
MIRT511221 LNPEP leucyl/cystinyl aminopeptidase 1 2
MIRT512070 DEK DEK oncogene 1 3
MIRT513641 TP53INP2 tumor protein p53 inducible nuclear protein 2 1 1
MIRT524859 ARL5B ADP-ribosylation factor-like 5B 1 2
MIRT530599 C7orf33 chromosome 7 open reading frame 33 1 2
MIRT531344 PLEKHG4B pleckstrin homology domain containing, family G (with RhoGef domain) member 4B 1 1
MIRT531680 MYO3A myosin IIIA 1 1
MIRT556545 LIN52 lin-52 homolog (C. elegans) 1 1
MIRT559268 BAG4 BCL2-associated athanogene 4 1 1
MIRT560956 FAM35A family with sequence similarity 35, member A 1 1
MIRT570371 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 1 1
MIRT570414 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 1
MIRT570447 TMEM189 transmembrane protein 189 1 1
MIRT609068 IGLON5 IgLON family member 5 1 2
MIRT623752 GRID1 glutamate receptor, ionotropic, delta 1 1 1
MIRT637683 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT638712 FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) 1 1
MIRT672803 PPM1L protein phosphatase, Mg2+/Mn2+ dependent, 1L 1 1
MIRT673864 CAPN7 calpain 7 1 1
MIRT685769 ZNF426 zinc finger protein 426 1 1
MIRT687233 PLAGL2 pleiomorphic adenoma gene-like 2 1 1
MIRT687449 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT692709 MEAF6 MYST/Esa1-associated factor 6 1 1
MIRT707403 KCNK12 potassium channel, subfamily K, member 12 1 1
MIRT710148 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like 1 1
MIRT725343 NEUROD1 neuronal differentiation 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*