Accession ID: MIRT005491 [miRNA, hsa-miR-138-5p :: LPL, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-138-2LinkOut: [miRBase ]
Description Homo sapiens miR-138-2 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-138-5p
Mature Sequence 10| AGCUGGUGUUGUGAAUCAGGCCG |32
Evidence Experimental
Experiments Cloned
Putative hsa-miR-138-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LPL LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms HDLCQ11, LIPD
Description lipoprotein lipase
Transcript NM_0002    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LPL LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of LPL
(miRNA target sites are highlighted)
>LPL|NM_0002|3'UTR
   1 TGAAACTGGGCGAATCTACAGAACAAAGAACGGCATGTGAATTCTGTGAAGAATGAAGTGGAGGAAGTAACTTTTACAAA
  81 ACATACCCAGTGTTTGGGGTGTTTCAAAAGTGGATTTTCCTGAATATTAATCCCAGCCCTACCCTTGTTAGTTATTTTAG
 161 GAGACAGTCTCAAGCACTAAAAAGTGGCTAATTCAATTTATGGGGTATAGTGGCCAAATAGCACATCCTCCAACGTTAAA
 241 AGACAGTGGATCATGAAAAGTGCTGTTTTGTCCTTTGAGAAAGAAATAATTGTTTGAGCGCAGAGTAAAATAAGGCTCCT
 321 TCATGTGGCGTATTGGGCCATAGCCTATAATTGGTTAGAACCTCCTATTTTAATTGGAATTCTGGATCTTTCGGACTGAG
 401 GCCTTCTCAAACTTTACTCTAAGTCTCCAAGAATACAGAAAATGCTTTTCCGCGGCACGAATCAGACTCATCTACACAGC
 481 AGTATGAATGATGTTTTAGAATGATTCCCTCTTGCTATTGGAATGTGGTCCAGACGTCAACCAGGAACATGTAACTTGGA
 561 GAGGGACGAAGAAAGGGTCTGATAAACACAGAGGTTTTAAACAGTCCCTACCATTGGCCTGCATCATGACAAAGTTACAA
 641 ATTCAAGGAGATATAAAATCTAGATCAATTAATTCTTAATAGGCTTTATCGTTTATTGCTTAATCCCTCTCTCCCCCTTC
 721 TTTTTTGTCTCAAGATTATATTATAATAATGTTCTCTGGGTAGGTGTTGAAAATGAGCCTGTAATCCTCAGCTGACACAT
 801 AATTTGAATGGTGCAGAAAAAAAAAAAGAAACCGTAATTTTATTATTAGATTCTCCAAATGATTTTCATCAATTTAAAAT
 881 CATTCAATATCTGACAGTTACTCTTCAGTTTTAGGCTTACCTTGGTCATGCTTCAGTTGTACTTCCAGTGCGTCTCTTTT
 961 GTTCCTGGCTTTGACATGAAAAGATAGGTTTGAGTTCAAATTTTGCATTGTGTGAGCTTCTACAGATTTTAGACAAGGAC
1041 CGTTTTTACTAAGTAAAAGGGTGGAGAGGTTCCTGGGGTGGATTCCTAAGCAGTGCTTGTAAACCATCGCGTGCAATGAG
1121 CCAGATGGAGTACCATGAGGGTTGCTATTTGTTGTTTTTAACAACTAATCAAGAGTGAGTGAACAACTATTTATAAACTA
1201 GATCTCCTATTTTTCAGAATGCTCTTCTACGTATAAATATGAAATGATAAAGATGTCAAATATCTCAGAGGCTATAGCTG
1281 GGAACCCGACTGTGAAAGTATGTGATATCTGAACACATACTAGAAAGCTCTGCATGTGTGTTGTCCTTCAGCATAATTCG
1361 GAAGGGAAAACAGTCGATCAAGGGATGTATTGGAACATGTCGGAGTAGAAATTGTTCCTGATGTGCCAGAACTTCGACCC
1441 TTTCTCTGAGAGAGATGATCGTGCCTATAAATAGTAGGACCAATGTTGTGATTAACATCATCAGGCTTGGAATGAATTCT
1521 CTCTAAAAATAAAATGATGTATGATTTGTTGTTGGCATCCCCTTTATTAATTCATTAAATTTCTGGATTTGGGTTGTGAC
1601 CCAGGGTGCATTAACTTAAAAGATTCACTAAAGCAGCACATAGCACTGGGAACTCTGGCTCCGAAAAACTTTGTTATATA
1681 TATCAAGGATGTTCTGGCTTTACATTTTATTTATTAGCTGTAAATACATGTGTGGATGTGTAAATGGAGCTTGTACATAT
1761 TGGAAAGGTCATTGTGGCTATCTGCATTTATAAATGTGTGGTGCTAACTGTATGTGTCTTTATCAGTGATGGTCTCACAG
1841 AGCCAACTCACTCTTATGAAATGGGCTTTAACAAAACAAGAAAGAAACGTACTTAACTGTGTGAAGAAATGGAATCAGCT
1921 TTTAATAAAATTGACAACATTTTATTACCACA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-138-5p :: LPL    [ Functional MTI ]
Validation Method qRT-PCR , Other
Conditions adipose tissue-derived mesenchymal stem cells (hAD-MSCs)
Original Description (Extracted from the article) ... key adipogenic transcription factors and adipocyte-speciļ¬c genes were down-regulated at day 3 of differentiation due to the overexpression of miR-138 (Fig. 1E). Therefore, over- expression of miR-138 resulted in adipogenesis inhibition of hAD-MSCs.// ...

- Yang, Z. Bian, C. Zhou, H. Huang, S. Wang, et al., 2011, Stem cells and development.

Article - Yang, Z. Bian, C. Zhou, H. Huang, S. Wang, et al.
- Stem cells and development, 2011
A better understanding of the molecular mechanisms underlying the differentiation of human adipose tissue-derived mesenchymal stem cells (hAD-MSCs) could provide new insights into the pathogenesis of a number of diseases, such as obesity and diabetes, and broaden the spectrum of potential hAD-MSCs-based cell therapy. In this study, we reported that a human microRNA, hsa-miR-138, could inhibit the adipogenic differentiation of hAD-MSCs. Our results showed that miR-138 was significantly down-regulated during adipogenic differentiation. Overexpression of miR-138 in hAD-MSCs could effectively reduce lipid droplets accumulation, inhibit expression of key adipogenic transcription factors cytidine-cytidine-adenosine-adenosine-thymidine (CCAAT) enhancer binding protein alpha and peroxisome proliferator-activated receptor gamma 2 as well as several other adipogenic marker genes, such as fatty acid binding protein 4 and lipoprotein lipase. Further studies showed that the expression of adenovirus early region 1-A-like inhibitor of differentiation 1 (EID-1), a nuclear receptor coregulator, was inversely correlated with that of miR-138 when hAD-MSCs were differentiated into adipocytes. Knockdown of EID-1 by RNA interference inhibited adipocyte differentiation of hAD-MSCs. In addition, luciferase reporter assays demonstrated that miR-138 directly targeted the 3' untranslated region of EID-1, implying that the negative role of miR-138 in the adipocyte differentiation of hAD-MSCs is at least partially mediated via repressing EID-1. Taken together, this study shows that miR-138 plays a negative role in adipogenic differentiation and sheds light on the role of miRNAs during differentiation of hAD-MSCs toward adipocytes.
LinkOut: [PMID: 20486779]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
45 hsa-miR-138-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000493 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 4 1
MIRT000494 ROCK2 Rho-associated, coiled-coil containing protein kinase 2 4 1
MIRT000495 RHOC ras homolog gene family, member C 4 3
MIRT000797 SLC45A3 solute carrier family 45, member 3 3 1
MIRT003991 TERT telomerase reverse transcriptase 4 1
MIRT005487 EID1 EP300 interacting inhibitor of differentiation 1 4 1
MIRT005488 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT005489 PPARG peroxisome proliferator-activated receptor gamma 2 1
MIRT005490 FABP4 fatty acid binding protein 4, adipocyte 2 1
MIRT005491 LPL lipoprotein lipase 2 1
MIRT005691 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT006020 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 3 1
MIRT006142 FOSL1 FOS-like antigen 1 2 1
MIRT006271 SIRT1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 1 1
MIRT006299 CCND3 cyclin D3 3 1
MIRT006388 PTK2 PTK2 protein tyrosine kinase 2 2 1
MIRT006493 H2AFX H2A histone family, member X 2 1
MIRT006744 HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) 1 2
MIRT006864 CASP3 caspase 3, apoptosis-related cysteine peptidase 1 1
MIRT006865 BLCAP bladder cancer associated protein 2 1
MIRT006866 MXD1 MAX dimerization protein 1 2 1
MIRT007273 RELN reelin 1 1
MIRT007300 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 2
MIRT007335 SOX4 SRY (sex determining region Y)-box 4 1 1
MIRT021683 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) 1 1
MIRT021684 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1 1
MIRT021685 PLEK2 pleckstrin 2 1 1
MIRT021686 CDH1 cadherin 1, type 1, E-cadherin (epithelial) 1 1
MIRT021687 SNAI2 snail homolog 2 (Drosophila) 2 1
MIRT021688 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 1 1
MIRT021689 EED embryonic ectoderm development 2 1
MIRT021690 SUZ12 suppressor of zeste 12 homolog (Drosophila) 2 1
MIRT021691 ZEB2 zinc finger E-box binding homeobox 2 2 1
MIRT021692 VIM vimentin 4 1
MIRT035577 KRT19 keratin 19 1 1
MIRT045827 PHKG2 phosphorylase kinase, gamma 2 (testis) 1 1
MIRT045828 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 1 1
MIRT045829 RARA retinoic acid receptor, alpha 1 1
MIRT045830 RGS12 regulator of G-protein signaling 12 1 1
MIRT045831 TOR2A torsin family 2, member A 1 1
MIRT045832 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT045833 NVL nuclear VCP-like 1 1
MIRT045834 DMKN dermokine 1 1
MIRT045835 HIST1H2BK histone cluster 1, H2bk 1 1
MIRT045836 HIST1H2BJ histone cluster 1, H2bj 1 1