Accession ID: MIRT005492 [miRNA, hsa-miR-1226-3p :: MUC1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1226LinkOut: [miRBase ]
Synonyms MIRN1226, hsa-mir-1226, MIR1226
Description Homo sapiens miR-1226 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-1226-3p
Mature Sequence 54| UCACCAGCCCUGUGUUCCCUAG |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-1226-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MUC1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD227, EMA, H23AG, KL-6, MAM6, PEM, PEMT, PUM
Description mucin 1, cell surface associated
Transcript NM_0010443    LinkOut: [ RefSeq ]
Other Transcripts NM_0010180 , NM_0010180 , NM_0010443 , NM_0010443 , NM_0010443 , NM_0024   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MUC1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MUC1
(miRNA target sites are highlighted)
>MUC1|NM_0010443|3'UTR
   1 TAGCAGTACCGATCGTAGCCCCTATGAGAAGGTTTCTGCAGGTAATGGTGGCAGCAGCCTCTCTTACACAAACCCAGCAG
  81 TGGCAGCCACTTCTGCCAACTTGTAGGGGCACGTCGCCCGCTGAGCTGAGTGGCCAGCCAGTGCCATTCCACTCCACTCA
 161 GGTTCTTCAGGGCCAGAGCCCCTGCACCCTGTTTGGGCTGGTGAGCTGGGAGTTCAGGTGGGCTGCTCACAGCCTCCTTC
 241 AGAGGCCCCACCAATTTCTCGGACACTTCTCAGTGTGTGGAAGCTCATGTGGGCCCCTGAGGGCTCATGCCTGGGAAGTG
 321 TTGTGGTGGGGGCTCCCAGGAGGACTGGCCCAGAGAGCCCTGAGATAGCGGGGATCCTGAACTGGACTGAATAAAACGTG
 401 GTCTCCCACTGCGCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaucccuuguguCCCGACCACu 5'
                      ||||||||| 
Target 5' tgcaccctgtttGGGCTGGTGa 3'
183 - 204 150.00 -19.50
2
miRNA  3' gaucccuuGUGUCCCGAC-CACu 5'
                  |:| | |||| ||| 
Target 5' acgtcgccCGCTGAGCTGAGTGg 3'
111 - 133 118.00 -12.40
3
miRNA  3' gauCCCUUGUGU---CCCGACCAcu 5'
             ||||:: ||   |||||| |  
Target 5' gctGGGAGTTCAGGTGGGCTGCTca 3'
205 - 229 115.00 -18.06
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1226-3p :: MUC1    [ Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay , qRT-PCR , Other
Conditions MCF-7 , MDA-MB-231 , HEK-293 , ZR-75-1 , BT-549 , MCF-10A
Disease breast cancer;
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... We also show that miR-1226 interacts with the MUC1 mRNA 3'UTR and that miR-1226 downregulates endogenous MUC1 protein levels.// ...

- Jin, C. Rajabi, H. Kufe, D., 2010, Int J Oncol.

Article - Jin, C. Rajabi, H. Kufe, D.
- Int J Oncol, 2010
The MUC1 oncoprotein is aberrantly overexpressed in human carcinomas and hematologic malignancies. Micro-RNAs (miRNAs) have been implicated in the suppression and induction of oncogenesis. The present studies demonstrate that the MUC1 mRNA 3' untranslated region (3'UTR) contains a highly conserved motif for binding of a novel miRNA, miR-1226, that has no known targets. The results show that miR-1226 is expressed in human breast cancer cell lines and non-malignant mammary epithelial cells. We also show that miR-1226 interacts with the MUC1 mRNA 3'UTR and that miR-1226 downregulates endogenous MUC1 protein levels. Consistent with miR-1226-induced downregulation of MUC1 expression, the results demonstrate that miR-1226 induces i) an increase in reactive oxygen species, ii) loss of the mitochondrial transmembrane potential, and iii) a decrease in cell survival. These findings indicate that expression of the MUC1 oncoprotein is downregulated by miR-1226 and that miR-1226 thereby functions as a tumor suppressor by promoting the induction of cell death.
LinkOut: [PMID: 20514397]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
130 hsa-miR-1226-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005492 MUC1 mucin 1, cell surface associated 3 1
MIRT036409 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT036410 UBE2A ubiquitin-conjugating enzyme E2A (RAD6 homolog) 1 1
MIRT036411 WDR1 WD repeat domain 1 1 1
MIRT036412 HIST1H4B histone cluster 1, H4b 1 1
MIRT036413 BLMH bleomycin hydrolase 1 1
MIRT036414 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT036415 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT036416 RPL35 ribosomal protein L35 1 1
MIRT036417 KARS lysyl-tRNA synthetase 1 1
MIRT036418 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT036419 GLUD2 glutamate dehydrogenase 2 1 1
MIRT036420 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) 1 1
MIRT036421 CABIN1 calcineurin binding protein 1 1 1
MIRT036422 LEPREL4 synaptonemal complex protein SC65 1 1
MIRT036423 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT036424 UBE2G1 ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast) 1 1
MIRT036425 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT036426 CCDC47 coiled-coil domain containing 47 1 1
MIRT036427 SCAMP1 secretory carrier membrane protein 1 1 1
MIRT036428 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT036429 GIMAP8 GTPase, IMAP family member 8 1 1
MIRT036430 MBTPS2 membrane-bound transcription factor peptidase, site 2 1 1
MIRT036431 RCC2 regulator of chromosome condensation 2 1 1
MIRT036432 DUT deoxyuridine triphosphatase 1 1
MIRT036433 XYLT2 xylosyltransferase II 1 1
MIRT036434 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT036435 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT036436 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT036437 PSMB2 proteasome (prosome, macropain) subunit, beta type, 2 1 1
MIRT036438 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT036439 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT036440 PIM2 pim-2 oncogene 1 1
MIRT036441 JUNB jun B proto-oncogene 1 1
MIRT036442 TBX18 T-box 18 1 1
MIRT036443 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT036444 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT036445 ATXN2 ataxin 2 1 1
MIRT036446 TBX3 T-box 3 1 1
MIRT036447 EPB41L1 erythrocyte membrane protein band 4.1-like 1 1 1
MIRT036448 TMEM25 transmembrane protein 25 1 1
MIRT036449 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT036450 NDRG3 NDRG family member 3 1 1
MIRT036451 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT036452 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT036453 RPA2 replication protein A2, 32kDa 1 1
MIRT036454 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT036455 ZNF629 zinc finger protein 629 1 1
MIRT036456 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT036457 KIAA1644 KIAA1644 1 1
MIRT036458 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT036459 ITPR3 inositol 1,4,5-triphosphate receptor, type 3 1 1
MIRT036460 TM9SF4 transmembrane 9 superfamily protein member 4 1 1
MIRT036461 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT036462 EXOC8 exocyst complex component 8 1 1
MIRT036463 ATP6AP2 ATPase, H+ transporting, lysosomal accessory protein 2 1 1
MIRT036464 HIST1H4C histone cluster 1, H4c 1 1
MIRT036465 ZDHHC4 zinc finger, DHHC-type containing 4 1 1
MIRT036466 ERCC2 excision repair cross-complementing rodent repair deficiency, complementation group 2 1 1
MIRT036467 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT036468 RBM27 RNA binding motif protein 27 1 1
MIRT036469 EHHADH enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase 1 1
MIRT036470 RABL6 chromosome 9 open reading frame 86 1 1
MIRT036471 RBM10 RNA binding motif protein 10 1 1
MIRT036472 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT036473 PFKL phosphofructokinase, liver 1 1
MIRT036474 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT036475 KIAA1671 KIAA1671 1 1
MIRT036476 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT036477 IPO7 importin 7 1 1
MIRT036478 CTDNEP1 dullard homolog (Xenopus laevis) 1 1
MIRT036479 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT036480 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT036481 PANK3 pantothenate kinase 3 1 1
MIRT036482 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT036483 RPL36A ribosomal protein L36a 1 1
MIRT036484 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT036485 AKIP1 chromosome 11 open reading frame 17 1 1
MIRT036486 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT036487 ACTG1 actin, gamma 1 1 1
MIRT036488 EDC4 enhancer of mRNA decapping 4 1 1
MIRT036489 FTSJD2 FtsJ methyltransferase domain containing 2 1 1
MIRT036490 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT036491 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT036492 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT036493 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT036494 ZBTB40 zinc finger and BTB domain containing 40 1 1
MIRT036495 PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 1 1
MIRT036496 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT036497 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT036498 PKN3 protein kinase N3 1 1
MIRT036499 FAM3C family with sequence similarity 3, member C 1 1
MIRT036500 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 1 1
MIRT036501 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT036502 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT036503 ASTL astacin-like metallo-endopeptidase (M12 family) 1 1
MIRT036504 ADAR adenosine deaminase, RNA-specific 1 1
MIRT036505 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT036506 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT036507 HSPB8 heat shock 22kDa protein 8 1 1
MIRT036508 MCM2 minichromosome maintenance complex component 2 1 1
MIRT036509 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT036510 SIMC1 chromosome 5 open reading frame 25 1 1
MIRT036511 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT036512 CENPF centromere protein F, 350/400ka (mitosin) 1 1
MIRT036513 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT036514 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT036515 PBRM1 polybromo 1 1 1
MIRT036516 USP24 ubiquitin specific peptidase 24 1 1
MIRT036517 UQCC ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT036518 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT036519 CNTNAP3 contactin associated protein-like 3 1 1
MIRT036520 DDT D-dopachrome tautomerase 1 1
MIRT036521 ZNF395 zinc finger protein 395 1 1
MIRT036522 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 1 1
MIRT036523 SLC25A39 solute carrier family 25, member 39 1 1
MIRT036524 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT036525 AAMP angio-associated, migratory cell protein 1 1
MIRT036526 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT036527 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT036528 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT036529 ABHD14B abhydrolase domain containing 14B 1 1
MIRT036530 BIRC5 baculoviral IAP repeat-containing 5 1 1
MIRT036531 BAG6 HLA-B associated transcript 3 1 1
MIRT036532 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT036533 KIF4B kinesin family member 4B 1 1
MIRT036534 TUBB4B tubulin, beta 2C 1 1
MIRT036535 FAM168B family with sequence similarity 168, member B 1 1
MIRT036536 TUBB4A tubulin, beta 4 1 1
MIRT036537 AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 1 1