Accession ID: MIRT005492 [miRNA, hsa-miR-1226-3p :: MUC1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-1226LinkOut: [miRBase ]
Synonyms MIRN1226, hsa-mir-1226, MIR1226
Description Homo sapiens miR-1226 stem-loop
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-1226-3p
Mature Sequence 54| UCACCAGCCCUGUGUUCCCUAG |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-1226-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol MUC1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms CD227, EMA, H23AG, KL-6, MAM6, MUC-1, MUC-1/SEC, MUC-1/X, MUC1/ZD, PEM, PEMT, PUM
Description mucin 1, cell surface associated
Transcript NM_001044391    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on MUC1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of MUC1
(miRNA target sites are highlighted)
>MUC1|NM_001044391|3'UTR
   1 GGGCACGTCGCCCGCTGAGCTGAGTGGCCAGCCAGTGCCATTCCACTCCACTCAGGTTCTTCAGGGCCAGAGCCCCTGCA
  81 CCCTGTTTGGGCTGGTGAGCTGGGAGTTCAGGTGGGCTGCTCACAGCCTCCTTCAGAGGCCCCACCAATTTCTCGGACAC
 161 TTCTCAGTGTGTGGAAGCTCATGTGGGCCCCTGAGGGCTCATGCCTGGGAAGTGTTGTGGTGGGGGCTCCCAGGAGGACT
 241 GGCCCAGAGAGCCCTGAGATAGCGGGGATCCTGAACTGGACTGAATAAAACGTGGTCTCCCACTGCGCCAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gaucccuuguguCCCGACCACu 5'
                      ||||||||| 
Target 5' tgcaccctgtttGGGCTGGTGa 3'
77 - 98 150.00 -19.50
2
miRNA  3' gaucccuuGUGUCCCGAC-CACu 5'
                  |:| | |||| ||| 
Target 5' acgtcgccCGCTGAGCTGAGTGg 3'
5 - 27 118.00 -12.40
3
miRNA  3' gauCCCUUGUGU---CCCGACCAcu 5'
             ||||:: ||   |||||| |  
Target 5' gctGGGAGTTCAGGTGGGCTGCTca 3'
99 - 123 115.00 -18.06
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-1226-3p :: MUC1    [ Functional MTI ]
Validation Method Immunoblot , Luciferase reporter assay , qRT-PCR , Other
Conditions MCF-7 , MDA-MB-231 , HEK-293 , ZR-75-1 , BT-549 , MCF-10A
Disease breast cancer;
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... We also show that miR-1226 interacts with the MUC1 mRNA 3'UTR and that miR-1226 downregulates endogenous MUC1 protein levels.// ...

- Jin, C. Rajabi, H. Kufe, D., 2010, Int J Oncol.

Article - Jin, C. Rajabi, H. Kufe, D.
- Int J Oncol, 2010
The MUC1 oncoprotein is aberrantly overexpressed in human carcinomas and hematologic malignancies. Micro-RNAs (miRNAs) have been implicated in the suppression and induction of oncogenesis. The present studies demonstrate that the MUC1 mRNA 3' untranslated region (3'UTR) contains a highly conserved motif for binding of a novel miRNA, miR-1226, that has no known targets. The results show that miR-1226 is expressed in human breast cancer cell lines and non-malignant mammary epithelial cells. We also show that miR-1226 interacts with the MUC1 mRNA 3'UTR and that miR-1226 downregulates endogenous MUC1 protein levels. Consistent with miR-1226-induced downregulation of MUC1 expression, the results demonstrate that miR-1226 induces i) an increase in reactive oxygen species, ii) loss of the mitochondrial transmembrane potential, and iii) a decrease in cell survival. These findings indicate that expression of the MUC1 oncoprotein is downregulated by miR-1226 and that miR-1226 thereby functions as a tumor suppressor by promoting the induction of cell death.
LinkOut: [PMID: 20514397]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
210 hsa-miR-1226-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005492 MUC1 mucin 1, cell surface associated 3 1
MIRT036409 IGF1R insulin-like growth factor 1 receptor 1 1
MIRT036410 UBE2A ubiquitin-conjugating enzyme E2A 1 1
MIRT036411 WDR1 WD repeat domain 1 1 1
MIRT036412 HIST1H4B histone cluster 1, H4b 1 1
MIRT036413 BLMH bleomycin hydrolase 1 1
MIRT036414 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT036415 KDM2A lysine (K)-specific demethylase 2A 1 1
MIRT036416 RPL35 ribosomal protein L35 1 1
MIRT036417 KARS lysyl-tRNA synthetase 1 1
MIRT036418 AVL9 AVL9 homolog (S. cerevisiase) 1 1
MIRT036419 GLUD2 glutamate dehydrogenase 2 1 1
MIRT036420 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) 1 1
MIRT036421 CABIN1 calcineurin binding protein 1 1 1
MIRT036422 LEPREL4 leprecan-like 4 1 1
MIRT036423 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT036424 UBE2G1 ubiquitin-conjugating enzyme E2G 1 1 1
MIRT036425 UBE2Q1 ubiquitin-conjugating enzyme E2Q family member 1 1 1
MIRT036426 CCDC47 coiled-coil domain containing 47 1 1
MIRT036427 SCAMP1 secretory carrier membrane protein 1 1 1
MIRT036428 HSP90AA1 heat shock protein 90kDa alpha (cytosolic), class A member 1 1 1
MIRT036429 GIMAP8 GTPase, IMAP family member 8 1 1
MIRT036430 MBTPS2 membrane-bound transcription factor peptidase, site 2 1 1
MIRT036431 RCC2 regulator of chromosome condensation 2 1 1
MIRT036432 DUT deoxyuridine triphosphatase 1 1
MIRT036433 XYLT2 xylosyltransferase II 1 1
MIRT036434 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT036435 SACS spastic ataxia of Charlevoix-Saguenay (sacsin) 1 1
MIRT036436 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT036437 PSMB2 proteasome (prosome, macropain) subunit, beta type, 2 1 1
MIRT036438 PAF1 Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) 1 1
MIRT036439 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT036440 PIM2 pim-2 oncogene 1 1
MIRT036441 JUNB jun B proto-oncogene 1 1
MIRT036442 TBX18 T-box 18 1 1
MIRT036443 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT036444 CYB5B cytochrome b5 type B (outer mitochondrial membrane) 1 1
MIRT036445 ATXN2 ataxin 2 1 1
MIRT036446 TBX3 T-box 3 1 1
MIRT036447 EPB41L1 erythrocyte membrane protein band 4.1-like 1 1 1
MIRT036448 TMEM25 transmembrane protein 25 1 1
MIRT036449 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT036450 NDRG3 NDRG family member 3 1 1
MIRT036451 CPSF3L cleavage and polyadenylation specific factor 3-like 1 1
MIRT036452 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT036453 RPA2 replication protein A2, 32kDa 1 1
MIRT036454 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT036455 ZNF629 zinc finger protein 629 1 1
MIRT036456 NOP2 NOP2 nucleolar protein homolog (yeast) 1 1
MIRT036457 KIAA1644 KIAA1644 1 1
MIRT036458 HSPA9 heat shock 70kDa protein 9 (mortalin) 1 1
MIRT036459 ITPR3 inositol 1,4,5-trisphosphate receptor, type 3 1 1
MIRT036460 TM9SF4 transmembrane 9 superfamily protein member 4 1 1
MIRT036461 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 1 1
MIRT036462 EXOC8 exocyst complex component 8 1 1
MIRT036463 ATP6AP2 ATPase, H+ transporting, lysosomal accessory protein 2 1 1
MIRT036464 HIST1H4C histone cluster 1, H4c 1 1
MIRT036465 ZDHHC4 zinc finger, DHHC-type containing 4 1 1
MIRT036466 ERCC2 excision repair cross-complementing rodent repair deficiency, complementation group 2 1 1
MIRT036467 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT036468 RBM27 RNA binding motif protein 27 1 1
MIRT036469 EHHADH enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase 1 1
MIRT036470 RABL6 RAB, member RAS oncogene family-like 6 1 1
MIRT036471 RBM10 RNA binding motif protein 10 1 1
MIRT036472 RABGGTB Rab geranylgeranyltransferase, beta subunit 1 1
MIRT036473 PFKL phosphofructokinase, liver 1 1
MIRT036474 TOP2A topoisomerase (DNA) II alpha 170kDa 1 1
MIRT036475 KIAA1671 KIAA1671 1 1
MIRT036476 EIF3C eukaryotic translation initiation factor 3, subunit C 1 1
MIRT036477 IPO7 importin 7 1 1
MIRT036478 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT036479 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT036480 GPBP1L1 GC-rich promoter binding protein 1-like 1 1 1
MIRT036481 PANK3 pantothenate kinase 3 1 1
MIRT036482 SLC35F6 chromosome 2 open reading frame 18 1 1
MIRT036483 RPL36A ribosomal protein L36a 1 1
MIRT036484 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT036485 AKIP1 A kinase (PRKA) interacting protein 1 1 1
MIRT036486 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT036487 ACTG1 actin, gamma 1 1 1
MIRT036488 EDC4 enhancer of mRNA decapping 4 1 1
MIRT036489 FTSJD2 FtsJ methyltransferase domain containing 2 1 1
MIRT036490 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT036491 AP2M1 adaptor-related protein complex 2, mu 1 subunit 1 1
MIRT036492 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT036493 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha 1 1
MIRT036494 ZBTB40 zinc finger and BTB domain containing 40 1 1
MIRT036495 PIK3R4 phosphoinositide-3-kinase, regulatory subunit 4 1 1
MIRT036496 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1 1
MIRT036497 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 1 1
MIRT036498 PKN3 protein kinase N3 1 1
MIRT036499 FAM3C family with sequence similarity 3, member C 1 1
MIRT036500 IDH1 isocitrate dehydrogenase 1 (NADP+), soluble 1 1
MIRT036501 CKAP4 cytoskeleton-associated protein 4 1 1
MIRT036502 GCN1L1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) 1 1
MIRT036503 ASTL astacin-like metallo-endopeptidase (M12 family) 1 1
MIRT036504 ADAR adenosine deaminase, RNA-specific 1 1
MIRT036505 IRAK1 interleukin-1 receptor-associated kinase 1 1 1
MIRT036506 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 1 1
MIRT036507 HSPB8 heat shock 22kDa protein 8 1 1
MIRT036508 MCM2 minichromosome maintenance complex component 2 1 1
MIRT036509 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT036510 SIMC1 chromosome 5 open reading frame 25 1 1
MIRT036511 PPIA peptidylprolyl isomerase A (cyclophilin A) 1 1
MIRT036512 CENPF centromere protein F, 350/400kDa (mitosin) 1 1
MIRT036513 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 1 1
MIRT036514 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT036515 PBRM1 polybromo 1 1 1
MIRT036516 USP24 ubiquitin specific peptidase 24 1 1
MIRT036517 UQCC ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT036518 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 2
MIRT036519 CNTNAP3 contactin associated protein-like 3 1 1
MIRT036520 DDT D-dopachrome tautomerase 1 1
MIRT036521 ZNF395 zinc finger protein 395 1 1
MIRT036522 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa 1 1
MIRT036523 SLC25A39 solute carrier family 25, member 39 1 1
MIRT036524 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT036525 AAMP angio-associated, migratory cell protein 1 1
MIRT036526 NDUFV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa 1 1
MIRT036527 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) 1 1
MIRT036528 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT036529 ABHD14B abhydrolase domain containing 14B 1 1
MIRT036530 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT036531 BAG6 BCL2-associated athanogene 6 1 1
MIRT036532 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT036533 KIF4B kinesin family member 4B 1 1
MIRT036534 TUBB4B tubulin, beta 4B class IVb 1 1
MIRT036535 FAM168B family with sequence similarity 168, member B 1 1
MIRT036536 TUBB4A tubulin, beta 4A class IVa 1 1
MIRT036537 AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 1 1
MIRT248779 ATXN7L3B ataxin 7-like 3B 1 1
MIRT279943 SLC39A9 solute carrier family 39 (zinc transporter), member 9 1 2
MIRT337171 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 2
MIRT443071 ABLIM1 actin binding LIM protein 1 1 1
MIRT451814 CDCA3 cell division cycle associated 3 1 1
MIRT467748 SLC36A1 solute carrier family 36 (proton/amino acid symporter), member 1 1 1
MIRT473511 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT476233 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 1 1
MIRT486918 GPX1 glutathione peroxidase 1 1 1
MIRT489205 RPH3AL rabphilin 3A-like (without C2 domains) 1 1
MIRT495363 AATF apoptosis antagonizing transcription factor 1 1
MIRT495390 VPS51 vacuolar protein sorting 51 homolog (S. cerevisiae) 1 1
MIRT495594 ARHGEF28 Rho guanine nucleotide exchange factor (GEF) 28 1 1
MIRT495692 KCNC3 potassium voltage-gated channel, Shaw-related subfamily, member 3 1 1
MIRT495833 EHD1 EH-domain containing 1 1 1
MIRT499765 CIRH1A cirrhosis, autosomal recessive 1A (cirhin) 1 5
MIRT504903 CCDC86 coiled-coil domain containing 86 1 1
MIRT513211 RFT1 RFT1 homolog (S. cerevisiae) 1 1
MIRT519628 ZNF781 zinc finger protein 781 1 1
MIRT519843 ZFP69B zinc finger protein 643 1 2
MIRT530064 PLXNA4 plexin A4 1 1
MIRT531308 GPR26 G protein-coupled receptor 26 1 1
MIRT533268 VAV3 vav 3 guanine nucleotide exchange factor 1 2
MIRT534128 SNX13 sorting nexin 13 1 1
MIRT534291 SLAIN2 SLAIN motif family, member 2 1 1
MIRT535866 MORF4L1 mortality factor 4 like 1 1 1
MIRT536022 MCUR1 coiled-coil domain containing 90A 1 1
MIRT539500 ACTN4 actinin, alpha 4 1 1
MIRT547451 MBD4 methyl-CpG binding domain protein 4 1 1
MIRT560019 ZNF525 zinc finger protein 525 1 1
MIRT560084 ZNF195 zinc finger protein 195 1 1
MIRT568722 GRASP GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein 1 1
MIRT570893 ZNF780A zinc finger protein 780A 1 1
MIRT571250 FADS6 fatty acid desaturase domain family, member 6 1 1
MIRT573401 DLC1 deleted in liver cancer 1 1 1
MIRT576568 Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 1 1
MIRT612131 NDUFA10 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa 1 1
MIRT613022 GABPB1 GA binding protein transcription factor, beta subunit 1 1 2
MIRT613861 TNFRSF9 tumor necrosis factor receptor superfamily, member 9 1 2
MIRT614966 GRIK3 glutamate receptor, ionotropic, kainate 3 1 1
MIRT616581 FAM107A family with sequence similarity 107, member A 1 1
MIRT626205 PNRC1 proline-rich nuclear receptor coactivator 1 1 1
MIRT640512 ANTXR1 anthrax toxin receptor 1 1 1
MIRT640536 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT641548 MOCOS molybdenum cofactor sulfurase 1 1
MIRT641683 IGFBP5 insulin-like growth factor binding protein 5 1 1
MIRT642859 RNF135 ring finger protein 135 1 1
MIRT649106 KCNMB1 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1 1
MIRT651844 USP1 ubiquitin specific peptidase 1 1 1
MIRT659044 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 1 1
MIRT659663 CDC73 cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) 1 1
MIRT659959 CXCL10 chemokine (C-X-C motif) ligand 10 1 1
MIRT672556 BRMS1L breast cancer metastasis-suppressor 1-like 1 1
MIRT675601 ZNF106 zinc finger protein 106 homolog (mouse) 1 1
MIRT676034 C9orf69 chromosome 9 open reading frame 69 1 1
MIRT678691 CACNG8 calcium channel, voltage-dependent, gamma subunit 8 1 1
MIRT682730 MSANTD1 Myb/SANT-like DNA-binding domain containing 1 1 1
MIRT682993 RNF40 ring finger protein 40, E3 ubiquitin protein ligase 1 1
MIRT687354 NUP98 nucleoporin 98kDa 1 1
MIRT697178 INMT indolethylamine N-methyltransferase 1 1
MIRT698735 STX12 syntaxin 12 1 1
MIRT699632 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 1 1
MIRT704560 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT704708 CHEK1 checkpoint kinase 1 1 1
MIRT709863 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT712792 ZNF154 zinc finger protein 154 1 1
MIRT712918 MRGPRF MAS-related GPR, member F 1 1
MIRT714040 ELMO1 engulfment and cell motility 1 1 1
MIRT714417 TBC1D16 TBC1 domain family, member 16 1 1
MIRT714539 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT715975 FADS3 fatty acid desaturase 3 1 1
MIRT716452 TMPRSS11BNL TMPRSS11B N terminal-like 1 1
MIRT716996 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 1 1
MIRT718745 ATP9A ATPase, class II, type 9A 1 1
MIRT719103 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 1 1
MIRT721047 TRIM67 tripartite motif containing 67 1 1
MIRT721082 FTSJ2 FtsJ RNA methyltransferase homolog 2 (E. coli) 1 1
MIRT722291 PMPCA peptidase (mitochondrial processing) alpha 1 1
MIRT722940 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 1 1
MIRT725148 SLC43A1 solute carrier family 43, member 1 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*