Accession ID: MIRT005504 [miRNA, hsa-miR-10b-5p :: NF1, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-10bLinkOut: [miRBase ]
Synonyms MIRN10B, hsa-mir-10b, miRNA10B, mir-10b, MIR10B
Description Homo sapiens miR-10b stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-10b-5p
Mature Sequence 27| UACCCUGUAGAACCGAAUUUGUG |49
Evidence Experimental
Experiments Cloned
Putative hsa-miR-10b-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol NF1 LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms NFNS, VRNF, WSS
Description neurofibromin 1
Transcript NM_000267    LinkOut: [ RefSeq ]
Other Transcripts NM_001042492 , NM_001128147   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on NF1 LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of NF1
(miRNA target sites are highlighted)
>NF1|NM_000267|3'UTR
   1 AGCTTGCTTGCTTTCTTTTTTAAAATCAACTTAACATGGGCTCTTCACTAGTGACCCCTTCCCTGTCCTTGCCCTTTCCC
  81 CCCATGTTGTAATGCTGCACTTCCTGTTTTATAATGAACCCATCCGGTTTGCCATGTTGCCAGATGATCAACTCTTCGAA
 161 GCCTTGCCTAAATTTAATGCTGCCTTTTCTTTAACTTTTTTTCTTCTACTTTTGGCGTGTATCTGGTATATGTAAGTGTT
 241 CAGAACAACTGCAAAGAAAGTGGGAGGTCAGGAAACTTTTAACTGAGAAATCTCAATTGTAAGAGAGGATGAATTCTTGA
 321 ATACTGCTACTACTGGCCAGTGATGAAAGCCATTTGCACAGAGCTCTGCCTTCTGTGGTTTTCCCTTCTTCATCCTACAG
 401 AGTAAAGTGTTAGTCCTATTTATACATTTTTCAAGATACAAGTTTATGAGAGAAATAGTATTATAACCCCAGTATGTTTA
 481 ATCTTTTAGCTGTGGACTTTTTTTTTAACCGTACAAAACTGAAAGAACCATAGAGGTCAAGCCTCAGTGACTTGACACCA
 561 TAAAGCCACAGACAAGGTACTTGGGGGGGAGGGCAGGGAAATTTCATATTTTATAGTGGATTCTTAAGAAATACTAACAC
 641 TTGAGTATTAGCAATAATTACAGGAAAATAAGTGCGACCACATATATCTTAACATTACTGAATTAAAACTATGGCTTCTA
 721 AGTCCTTATCCAAACTCAGTCATCCAAACTAGTTTATTTTTTTCTCCAGTTGATTATCTTTTAATTTTTAATTTTGCTAA
 801 AGGTGGTTTTTTTGTGTTTTGTTTTTTGTAAACCAAAACTATACTAAGTATAGTAATTATATATATATATATATTTTTTC
 881 CCCTCCCCCTCTTCTTTCCTAACTAATTCTGAGCAGGGTAATCAGTGAACAAAGTGTTGAAAATTGTTCCCAGAAGGTAA
 961 TTTTCATAGATGTTTGCATTAGCTCCATAGCAAAATGGAATGGTACGTGACATTTAGGGTAGCTGATATTTTTATTTTGT
1041 TAAATAATTTCCAAGAATAGAGTATGGTGTATATTATAAATTTCTTTGATAAGATGTATTTTGAATGTCTTTTAATCTTC
1121 CTCCTCCTCTCCAAAAAAATCAGAAACCTCTTTAAGAAAACATGTAGGTTATATATGCTAGAATTGCATTTAATCACTGT
1201 GAAAAGACTGGTCAGCCTGCATTAGTATGACAGTAGGGGGGCTGTTAGAATTGCTGCTATACTGGTGGTATGGATTATCA
1281 TGGCATTGGAATTTTCATAGTAATGCAGATCCAATTTCTTTGTGGTACCTGCAGTTTACAAAATAATTTGACTTCAGTGA
1361 GCATATTGGTATCTGGATGTTCCAATTTAGAACTAAACCATATTTATTACAAAAAGATATTAATCCCTCTACTCCCAGGT
1441 TCCCTTTATATGTTAAGATATAATGGCTTTGAGGGGGGAAAAAATAAACCTAGGGGAGAGGGGAGTTTCCTGTAGTGCTG
1521 TTTCATTAGAGGATTTCAGTAAATTAAATTCCACAGCTAATTCAATAAATAATGGTACATTTAAGTGTTCTGATTTTAAT
1601 AATATATTTCACATTTATCCACACAGTAACAATGTAATATGTTAATGTAAATAAAATTGGTTTTGATACTCAGAAATAAC
1681 AAGAATTTAATTTTTTAAATTTGTTTACAGTCCTGGGAAAAGTAAGAATTATTTGCCAAAATAAGAGGAAAGAAAACCTT
1761 AGTATTATTAATGAGTTTACCATAGAATTGTTGGAAATACTGAAGACAGGTGCAATTTACTAAACTTTTGTTTTTAAACT
1841 ATTGTAGAGGCTGCATTAGAAGAAAATGTTTATAATGACAGAGCAACTATGACTATATAAAAAAGCTGAAATTAGAACTG
1921 TGTTTAGAAATAGATCAGTAACCCAGTGCCAAGGATGCCAAGCTGCCACCATGGTCTTGGCTCTCCCACAACCCAGTGTT
2001 TCTGGGGTAAGTTTCACAGTTTCTAGGCCCTGGAATAGCAGGCAGTGTAAGCCTTTGATAACTTTAGTTCGATGTTTTTC
2081 TTGTTTTTGTTTGTTGGTTTGGTGCATATGATAGTGGGTGTTATGCTATTTTGCTCTTCCCATCAAAATAAAGAAACTTC
2161 CAGAGGTTTACTGTTAAAAATACTGATATTTCCATAAACGGGTTTACCAAGGGTGTAGTATTTCATACCGCCTGAAATGA
2241 TCAGCATTGGCACAAATCAAAATTCAGCCGCCTTTGAAATGCAAAAATACCTTTGACTAGTAAGTACATCCTAGGAGTTT
2321 GAAAACTTAACTAAGGTTTAAAATTTACCTTGTTTAAAGAACTTCTGACTTTTGAGGAAAATCTAGCTTTCCAAGTAACT
2401 AAAATGTACATGAGATAAACCTCTCACCACTATGTGTCCCTTGAGAAATGCAACACTTTTTTAGTCTTCATACTTGTAAT
2481 CTATAAAAGAAATTCTGAAGTTTAGACCAAGTTGCCCATTTCTGCGTAATTGACATAAGTTCTGTTAAAAATATTATAAG
2561 TAATTCGTTTCGGTTTGTAGATGTTTCCCCTGACTTGTTAAAGAGGAAACCAGGAACTCAGTCATGTTTTTGTCCTGGAT
2641 AATCTACCTGTTATGCCAGTACTCCCATCCGAGGGGCATGCCCTTAGTTGCCCAGATGGAGATGCAGTTCAGTAGATTTG
2721 GGGCAAAGTGGCTACAGCTCTGTCTTCCATTCACTCAACACCTGTTCATGACTGAGCCAGGTGCCCAGGACACATCCTAA
2801 ACAGTCAGCTTCTATCCTGTGTCCTAGTTGGGGAGACAGAGTGCCAGCCAGCAACCCTCCCAGGTTTGTAGGTTTTAGGG
2881 GTTTTCAGTTTTGTTTGGGTTTTTTGTTTTTTGTTTTTGTTTCTACATCCTTCCCCGACTCCCAGGCATAATGAGGCATG
2961 TCTTACTCAATGTTATGCAATGGATTTAGGCAAAAATTCATTCTTAGTGTCAGCCACACAATTTTTTTTAATGCAGTATA
3041 TTCACCTGTAAATAGTTTGTGTAAAATTTGACAAAAAAAGTATATTTACTATACTGTAAATATATGTGATGATATATTGT
3121 ATTATTTTGCTTTTTTGTAAAGCAGTTAGTTGCTGCACATGGATAACAACAAAAATTTGATTATTCTCGTGTTAGTATTG
3201 TTAACTTCTTTTTGCGACTGCGTTACATCATTTAAAGAAAATGCTGTGTATTGTAAACTTAAATTGTATATGATAACTTA
3281 CTGTCCTTTCCATCCGGGCCTAAACTTTGGCAGTTCCTTTGTCTACAACCTTGTTAATACTGTAAACAGTTGTACGCCAG
3361 CAGGAAAAATACTGCCCAACAGACAAAATCGATCATTGTAGGGGAAAATCATAGAAATCCATTTCAGATCTTTATTGTTC
3441 CTCACCCCATTTTCCTCCTTGTGTATGTACTTCCCCCACCCCCCTTTTTTTAAGTAAAATGTAAATTCAATCTGCTCTAA
3521 GA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUAAGCCAAGAUGUCCCAu 5'
            | |||||   |  :|||||| 
Target 5' aaCTAATTC---TGAGCAGGGTa 3'
901 - 920 138.00 -13.20
2
miRNA  3' guGUUUAAGCCAAGAUG--UCCCAu 5'
            || |  ||| |:|||  ||||| 
Target 5' tcCATAAACGGGTTTACCAAGGGTg 3'
2191 - 2215 129.00 -18.20
3
miRNA  3' guguuuAAGCCAAGAUGUCCCAu 5'
                |||  | |||||| || 
Target 5' cccttcTTC-ATCCTACAGAGTa 3'
383 - 404 124.00 -8.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-10b-5p :: NF1    [ Functional MTI ]
Validation Method GFP reporter assay , Luciferase reporter assay , Microarray , qRT-PCR , Other
Conditions ST88-14 , T265p21 , STS26T , SBC5 , SBC3
Disease neurofibromatosis type 1;
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Co-transfection in 293T cells with either the miR-10b expression vector or a control vector showed that overexpression of miR-10b significantly reduced lucifer- ase activity from the construct containing NF1 3'UTR (Fig. 5b; P < 0.05), while miR-10b failed to reduce luciferase activity if its target sequence in the NF1 3'UTR was mutated (Fig. 5b). This result indicates that miR-10b directly targets 3'UTR of NF1 mRNA.// ...

- Chai, G. Liu, N. Ma, J. Li, H. Oblinger, J. et al., 2010, Cancer Sci.

Article - Chai, G. Liu, N. Ma, J. Li, H. Oblinger, J. et al.
- Cancer Sci, 2010
MicroRNAs (miRNAs) are frequently deregulated in human tumors, and play important roles in tumor development and progression. The pathological roles of miRNAs in neurofibromatosis type 1 (NF1) tumorigenesis are largely unknown. We demonstrated that miR-10b was up-regulated in primary Schwann cells isolated from NF1 neurofibromas and in cell lines and tumor tissues from malignant peripheral nerve sheath tumors (MPNSTs). Intriguingly, a significantly high level of miR-10b correlated with low neurofibromin expression was found in a neuroectodermal cell line: Ewing's sarcoma SK-ES-1 cells. Antisense inhibiting miR-10b in NF1 MPNST cells reduced cell proliferation, migration and invasion. Furthermore, we showed that NF1 mRNA was the target for miR-10b. Overexpression of miR-10b in 293T cells suppressed neurofibromin expression and activated RAS signaling. Antisense inhibition of miR-10b restored neurofibromin expression in SK-ES-1 cells, and decreased RAS signaling independent of neurofibromin in NF1 MPNST cells. These results suggest that miR-10b may play an important role in NF1 tumorigenesis through targeting neurofibromin and RAS signaling. (Cancer Sci 2010).
LinkOut: [PMID: 20550523]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
296 hsa-miR-10b-5p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002021 HOXD10 homeobox D10 4 11
MIRT003216 KLF4 Kruppel-like factor 4 (gut) 4 3
MIRT005068 PPARA peroxisome proliferator-activated receptor alpha 4 1
MIRT005455 NCOR2 nuclear receptor corepressor 2 3 2
MIRT005504 NF1 neurofibromin 1 4 1
MIRT006294 PIEZO1 piezo-type mechanosensitive ion channel component 1 1 1
MIRT006366 BCL2L11 BCL2-like 11 (apoptosis facilitator) 3 3
MIRT006367 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 3 2
MIRT006368 CDKN2A cyclin-dependent kinase inhibitor 2A 3 2
MIRT006369 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2 1
MIRT006538 TRA2B transformer 2 beta homolog (Drosophila) 2 2
MIRT006539 SRSF1 serine/arginine-rich splicing factor 1 1 1
MIRT006923 TP53 tumor protein p53 1 1
MIRT006924 NOTCH1 notch 1 1 1
MIRT006925 PAX6 paired box 6 1 1
MIRT007026 MAPRE1 microtubule-associated protein, RP/EB family, member 1 1 1
MIRT007072 SDC1 syndecan 1 1 3
MIRT025586 NR4A3 nuclear receptor subfamily 4, group A, member 3 1 1
MIRT025587 NRP2 neuropilin 2 1 1
MIRT047400 POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa 1 1
MIRT047401 LEMD3 LEM domain containing 3 1 1
MIRT047402 EXTL3 exostoses (multiple)-like 3 1 1
MIRT047403 TXNDC16 thioredoxin domain containing 16 1 1
MIRT047404 STK33 serine/threonine kinase 33 1 1
MIRT047405 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047406 GBAS glioblastoma amplified sequence 1 1
MIRT047407 COPS5 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) 1 1
MIRT047408 ADRA1B adrenoceptor alpha 1B 1 1
MIRT047409 RTKN2 rhotekin 2 1 1
MIRT047410 COL6A2 collagen, type VI, alpha 2 1 1
MIRT047411 ZNF318 zinc finger protein 318 1 1
MIRT047412 INHBA inhibin, beta A 1 1
MIRT047413 SYT11 synaptotagmin XI 1 1
MIRT047414 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT047415 IGSF1 immunoglobulin superfamily, member 1 1 1
MIRT047416 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047417 PPP1R13B protein phosphatase 1, regulatory subunit 13B 1 1
MIRT047418 APLNR apelin receptor 1 1
MIRT047419 MSL3 male-specific lethal 3 homolog (Drosophila) 1 1
MIRT047420 SLC25A30 solute carrier family 25, member 30 1 1
MIRT047421 CAMSAP3 calmodulin regulated spectrin-associated protein family, member 3 1 1
MIRT047422 XPO7 exportin 7 1 1
MIRT047423 STT3A STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) 1 1
MIRT047424 UROD uroporphyrinogen decarboxylase 1 1
MIRT047425 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047426 GLB1L3 galactosidase, beta 1-like 3 1 1
MIRT047427 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT047428 CLPTM1 cleft lip and palate associated transmembrane protein 1 1 1
MIRT047429 FAM13A family with sequence similarity 13, member A 1 1
MIRT047430 HSPA1B heat shock 70kDa protein 1B 1 1
MIRT047431 CSNK2A1 casein kinase 2, alpha 1 polypeptide 1 2
MIRT047432 KIF21A kinesin family member 21A 1 1
MIRT047433 HK1 hexokinase 1 1 1
MIRT047434 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047435 AP3M1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT047436 HIST1H2AL histone cluster 1, H2al 1 1
MIRT047437 ARFGEF1 ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited) 1 1
MIRT047438 RUNDC3B RUN domain containing 3B 1 1
MIRT047439 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT047440 ND6 NADH dehydrogenase, subunit 6 (complex I) 1 1
MIRT047441 SCMH1 sex comb on midleg homolog 1 (Drosophila) 1 1
MIRT047442 LRRC59 leucine rich repeat containing 59 1 1
MIRT047443 ERLIN1 ER lipid raft associated 1 1 1
MIRT047444 FUT6 fucosyltransferase 6 (alpha (1,3) fucosyltransferase) 1 1
MIRT047445 CDK2 cyclin-dependent kinase 2 1 1
MIRT047446 DDHD2 DDHD domain containing 2 1 1
MIRT047447 PTPRT protein tyrosine phosphatase, receptor type, T 1 1
MIRT047448 UBE2Z ubiquitin-conjugating enzyme E2Z 1 1
MIRT047449 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047450 ACLY ATP citrate lyase 1 1
MIRT047451 PARL presenilin associated, rhomboid-like 1 1
MIRT047452 DIAPH2 diaphanous homolog 2 (Drosophila) 1 1
MIRT047453 RPS9 ribosomal protein S9 1 1
MIRT047454 FASN fatty acid synthase 1 1
MIRT047455 ESYT1 extended synaptotagmin-like protein 1 1 1
MIRT047456 TENM3 teneurin transmembrane protein 3 1 1
MIRT047457 GRINA glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) 1 1
MIRT047458 TUBA1B tubulin, alpha 1b 1 1
MIRT047459 CDK12 cyclin-dependent kinase 12 1 1
MIRT047460 PPP3CB protein phosphatase 3, catalytic subunit, beta isozyme 1 1
MIRT047461 RPS8 ribosomal protein S8 1 1
MIRT047462 ATG13 autophagy related 13 1 1
MIRT047463 PIK3CD phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta 1 1
MIRT047464 C9orf114 chromosome 9 open reading frame 114 1 1
MIRT047465 PLA2G4F phospholipase A2, group IVF 1 1
MIRT047466 USP3 ubiquitin specific peptidase 3 1 1
MIRT047467 SLC25A5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 1 1
MIRT047468 DMWD dystrophia myotonica, WD repeat containing 1 1
MIRT047469 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047470 RGP1 RGP1 retrograde golgi transport homolog (S. cerevisiae) 1 1
MIRT047471 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047472 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 1 1
MIRT047473 LAMC1 laminin, gamma 1 (formerly LAMB2) 1 1
MIRT047474 SURF6 surfeit 6 1 1
MIRT047475 GLOD4 glyoxalase domain containing 4 1 1
MIRT047476 PRMT7 protein arginine methyltransferase 7 1 1
MIRT047477 MSTO1 misato homolog 1 (Drosophila) 1 1
MIRT047478 NEK7 NIMA (never in mitosis gene a)-related kinase 7 1 1
MIRT047479 EPHA4 EPH receptor A4 1 1
MIRT047480 ACTG1 actin, gamma 1 1 1
MIRT047481 KIAA0100 KIAA0100 1 1
MIRT047482 TSPAN33 tetraspanin 33 1 1
MIRT047483 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT047484 THUMPD1 THUMP domain containing 1 1 1
MIRT047485 DLAT dihydrolipoamide S-acetyltransferase 1 1
MIRT047486 LRP3 low density lipoprotein receptor-related protein 3 1 1
MIRT047487 AASDH aminoadipate-semialdehyde dehydrogenase 1 1
MIRT047488 SETD7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT047489 RBM17 RNA binding motif protein 17 1 1
MIRT047490 GK glycerol kinase 1 1
MIRT047491 LMF2 lipase maturation factor 2 1 1
MIRT047492 CHPF2 chondroitin polymerizing factor 2 1 1
MIRT047493 CTBP1 C-terminal binding protein 1 1 1
MIRT047494 UHRF1 ubiquitin-like with PHD and ring finger domains 1 1 1
MIRT047495 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 1 1
MIRT047496 RALBP1 ralA binding protein 1 1 1
MIRT047497 NAP1L1 nucleosome assembly protein 1-like 1 1 1
MIRT047498 LSS lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 1 1
MIRT047499 NPTX1 neuronal pentraxin I 1 1
MIRT047500 PRRC2C proline-rich coiled-coil 2C 1 1
MIRT047501 PABPC1 poly(A) binding protein, cytoplasmic 1 1 1
MIRT047502 PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 1 1
MIRT047503 PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 1 1
MIRT047504 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 1
MIRT053002 TPM1 tropomyosin 1 (alpha) 1 1
MIRT053003 PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) 1 1
MIRT053593 TIAM1 T-cell lymphoma invasion and metastasis 1 3 1
MIRT054912 PTEN phosphatase and tensin homolog 2 2
MIRT056370 ZMYND11 zinc finger, MYND-type containing 11 0 1
MIRT057215 GATA3 GATA binding protein 3 0 1
MIRT071380 CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 1 3
MIRT076414 PAFAH1B1 platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) 1 1
MIRT093336 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 1 1
MIRT097758 ARSK arylsulfatase family, member K 1 1
MIRT099598 ID4 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein 1 3
MIRT299202 CSRNP3 cysteine-serine-rich nuclear protein 3 1 1
MIRT309534 TRIM2 tripartite motif containing 2 1 2
MIRT437374 HTATIP2 HIV-1 Tat interactive protein 2, 30kDa 3 1
MIRT437784 DDX58 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 1 1
MIRT439113 TCF19 transcription factor 19 0 1
MIRT439114 USP6 ubiquitin specific peptidase 6 (Tre-2 oncogene) 0 1
MIRT439115 TCF15 transcription factor 15 (basic helix-loop-helix) 1 2
MIRT439116 STAT6 signal transducer and activator of transcription 6, interleukin-4 induced 0 1
MIRT439117 SREBF1 sterol regulatory element binding transcription factor 1 0 1
MIRT439118 RARG retinoic acid receptor, gamma 0 1
MIRT439119 OLFM3 olfactomedin 3 0 1
MIRT439120 NUAK2 NUAK family, SNF1-like kinase, 2 0 1
MIRT439121 MYF5 myogenic factor 5 0 1
MIRT439122 NCOA6 nuclear receptor coactivator 6 0 1
MIRT439123 LYL1 lymphoblastic leukemia derived sequence 1 0 1
MIRT439124 HOXD1 homeobox D1 0 1
MIRT439125 HOXD11 homeobox D11 0 1
MIRT439126 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 0 1
MIRT439127 HHAT hedgehog acyltransferase 0 1
MIRT439128 DPF2 D4, zinc and double PHD fingers family 2 0 1
MIRT439129 FXR2 fragile X mental retardation, autosomal homolog 2 0 1
MIRT439130 DLX1 distal-less homeobox 1 0 1
MIRT439131 CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 0 1
MIRT439132 ASCL2 achaete-scute complex homolog 2 (Drosophila) 0 1
MIRT439134 ANXA7 annexin A7 0 1
MIRT448050 SFRP1 secreted frizzled-related protein 1 1 1
MIRT459964 POC1A POC1 centriolar protein homolog A (Chlamydomonas) 1 1
MIRT466174 TMED5 transmembrane emp24 protein transport domain containing 5 1 1
MIRT470411 PPP1R15B protein phosphatase 1, regulatory subunit 15B 1 1
MIRT475884 H3F3C H3 histone, family 3C 1 5
MIRT475918 H3F3B H3 histone, family 3B (H3.3B) 1 4
MIRT493172 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT497271 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT498894 RBM12B RNA binding motif protein 12B 1 2
MIRT506896 KCTD11 potassium channel tetramerisation domain containing 11 1 5
MIRT506958 HOXB3 homeobox B3 1 2
MIRT507099 GPCPD1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) 1 1
MIRT508099 ANKRD33B ankyrin repeat domain 33B 1 2
MIRT508627 PLA2G2C phospholipase A2, group IIC 1 1
MIRT510734 SON SON DNA binding protein 1 3
MIRT513974 CNOT6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT514261 S1PR2 sphingosine-1-phosphate receptor 2 1 1
MIRT514576 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 1 2
MIRT515043 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT515691 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1
MIRT515751 ONECUT3 one cut homeobox 3 1 1
MIRT517388 METTL7A methyltransferase like 7A 1 1
MIRT519731 ZNF460 zinc finger protein 460 1 1
MIRT520246 USP9X ubiquitin specific peptidase 9, X-linked 1 2
MIRT520269 URGCP upregulator of cell proliferation 1 1
MIRT522214 NR2C2 nuclear receptor subfamily 2, group C, member 2 1 3
MIRT523699 FHL2 four and a half LIM domains 2 1 2
MIRT523979 DVL3 dishevelled, dsh homolog 3 (Drosophila) 1 1
MIRT525568 MTRNR2L7 MT-RNR2-like 7 1 3
MIRT525618 MTRNR2L3 MT-RNR2-like 3 1 2
MIRT530222 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT530548 SYNPO synaptopodin 1 1
MIRT531040 ZNF502 zinc finger protein 502 1 1
MIRT532578 GSS glutathione synthetase 1 1
MIRT534839 RAB15 RAB15, member RAS oncogene family 1 1
MIRT535792 MTRNR2L11 MT-RNR2-like 11 (pseudogene) 1 3
MIRT535810 MTRNR2L10 MT-RNR2-like 10 1 2
MIRT536817 HMGN2 high mobility group nucleosomal binding domain 2 1 1
MIRT539892 IRGQ immunity-related GTPase family, Q 1 1
MIRT540207 ARHGAP18 Rho GTPase activating protein 18 1 1
MIRT540950 SLC25A43 solute carrier family 25, member 43 1 1
MIRT541935 ORC1 origin recognition complex, subunit 1 1 2
MIRT542194 FUT1 fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) 1 3
MIRT542373 PAICS phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase 1 1
MIRT542507 WDR13 WD repeat domain 13 1 1
MIRT542574 ZNF280B zinc finger protein 280B 1 1
MIRT542713 RPS15A ribosomal protein S15a 1 1
MIRT546706 RORA RAR-related orphan receptor A 1 2
MIRT549622 TMEM101 transmembrane protein 101 1 1
MIRT549928 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 1 1
MIRT550161 ZNF223 zinc finger protein 223 1 2
MIRT554083 SNX4 sorting nexin 4 1 2
MIRT558567 CRLF3 cytokine receptor-like factor 3 1 2
MIRT560944 TPM4 tropomyosin 4 1 2
MIRT568634 ACVR2A activin A receptor, type IIA 1 1
MIRT574847 CADM1 cell adhesion molecule 1 1 1
MIRT575175 Atg9a autophagy related 9A 1 1
MIRT576663 Fam216a RIKEN cDNA 1500011H22 gene 1 1
MIRT609433 MTX3 metaxin 3 1 1
MIRT617413 API5 apoptosis inhibitor 5 1 1
MIRT617468 CCS copper chaperone for superoxide dismutase 1 1
MIRT618779 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618834 PHF20 PHD finger protein 20 1 1
MIRT619338 RNF2 ring finger protein 2 1 1
MIRT625243 C6orf89 chromosome 6 open reading frame 89 1 1
MIRT626438 CHDH choline dehydrogenase 1 1
MIRT634927 CHMP1B charged multivesicular body protein 1B 1 1
MIRT635874 SLC11A2 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1 1
MIRT636234 SLC24A4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 1 1
MIRT636640 CHAF1B chromatin assembly factor 1, subunit B (p60) 1 1
MIRT640544 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT648660 ALKBH4 alkB, alkylation repair homolog 4 (E. coli) 1 1
MIRT650185 LILRA2 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 1 1
MIRT650789 GSR glutathione reductase 1 1
MIRT652026 TTYH3 tweety homolog 3 (Drosophila) 1 1
MIRT652516 TMEM109 transmembrane protein 109 1 1
MIRT661939 MAVS mitochondrial antiviral signaling protein 1 1
MIRT661950 FAHD1 fumarylacetoacetate hydrolase domain containing 1 1 1
MIRT662019 ZNF445 zinc finger protein 445 1 1
MIRT664014 LOH12CR1 loss of heterozygosity, 12, chromosomal region 1 1 1
MIRT664058 KIAA1551 KIAA1551 1 1
MIRT666871 POU2F2 POU class 2 homeobox 2 1 1
MIRT669167 CCNG1 cyclin G1 1 1
MIRT673242 KLHDC8A kelch domain containing 8A 1 1
MIRT680409 SFT2D2 SFT2 domain containing 2 1 1
MIRT680483 ATP1B4 ATPase, Na+/K+ transporting, beta 4 polypeptide 1 1
MIRT683576 CARD8 caspase recruitment domain family, member 8 1 1
MIRT684397 MCTS1 malignant T cell amplified sequence 1 1 1
MIRT684557 ZNF708 zinc finger protein 708 1 1
MIRT685420 ACAD8 acyl-CoA dehydrogenase family, member 8 1 1
MIRT686049 SLC5A5 solute carrier family 5 (sodium iodide symporter), member 5 1 1
MIRT687954 HHIP hedgehog interacting protein 1 1
MIRT688180 FRRS1 ferric-chelate reductase 1 1 1
MIRT688302 FAM208A family with sequence similarity 208, member A 1 1
MIRT688899 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT689204 ZNF574 zinc finger protein 574 1 1
MIRT689916 ACOT13 acyl-CoA thioesterase 13 1 1
MIRT692930 EXOSC2 exosome component 2 1 1
MIRT693631 CENPL centromere protein L 1 1
MIRT694761 FZD2 frizzled family receptor 2 1 1
MIRT695372 PHAX phosphorylated adaptor for RNA export 1 1
MIRT696629 WDR77 WD repeat domain 77 1 1
MIRT696689 APOC3 apolipoprotein C-III 1 1
MIRT697366 ZNF394 zinc finger protein 394 1 1
MIRT697610 XIAP X-linked inhibitor of apoptosis 1 1
MIRT697736 USP6NL USP6 N-terminal like 1 1
MIRT697787 UBXN7 UBX domain protein 7 1 1
MIRT698360 TMEM127 transmembrane protein 127 1 1
MIRT704518 CNKSR3 CNKSR family member 3 1 1
MIRT704599 CLN8 ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation) 1 1
MIRT705848 AHCY adenosylhomocysteinase 1 1
MIRT707092 TIMM50 translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) 1 1
MIRT707153 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT707242 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 1 1
MIRT707354 XPNPEP3 X-prolyl aminopeptidase (aminopeptidase P) 3, putative 1 1
MIRT707458 PPFIBP1 PTPRF interacting protein, binding protein 1 (liprin beta 1) 1 1
MIRT707502 AXL AXL receptor tyrosine kinase 1 1
MIRT707646 CRIPT cysteine-rich PDZ-binding protein 1 1
MIRT707702 FAM118A family with sequence similarity 118, member A 1 1
MIRT707713 CDC6 cell division cycle 6 homolog (S. cerevisiae) 1 1
MIRT707824 TMEM170A transmembrane protein 170A 1 1
MIRT707965 PDK3 pyruvate dehydrogenase kinase, isozyme 3 1 1
MIRT708005 NUDT4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1 1
MIRT708034 MRPS14 mitochondrial ribosomal protein S14 1 1
MIRT708072 LIX1L Lix1 homolog (mouse)-like 1 1
MIRT708130 GK5 glycerol kinase 5 (putative) 1 1
MIRT708199 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 1 1
MIRT708208 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1 1
MIRT708939 CRY2 cryptochrome 2 (photolyase-like) 1 1
MIRT709198 SAPCD2 suppressor APC domain containing 2 1 1
MIRT714402 FBXO31 F-box protein 31 1 1
MIRT714628 KIAA1143 KIAA1143 1 1
MIRT720740 ELOVL7 ELOVL fatty acid elongase 7 1 1
MIRT720893 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 1 1
MIRT723334 DGAT1 diacylglycerol O-acyltransferase 1 1 1
MIRT724451 OPA3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*