Accession ID: MIRT005518 [miRNA, hsa-miR-409-3p :: FGA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-409LinkOut: [miRBase ]
Synonyms MIRN409, hsa-mir-409, MIR409
Description Homo sapiens miR-409 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-409-3p
Mature Sequence 47| GAAUGUUGCUCGGUGAACCCCU |68
Evidence Experimental
Experiments Cloned
Putative hsa-miR-409-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Fib2, MGC119422, MGC119423, MGC119425
Description fibrinogen alpha chain
Transcript NM_0005    LinkOut: [ RefSeq ]
Other Transcripts NM_0218   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGA
(miRNA target sites are highlighted)
>FGA|NM_0005|3'UTR
   1 TAGGCTGAAGAAGTGGGAATGGGAGCACTCTGTCTTCTTTGCTAGAGAAGTGGAGAGAAAATACAAAAGGTAAAGCAGTT
  81 GAGATTCTCTACAACCTAAAAAATTCCTAGGTGCTATTTTCTTATCCTTTGTACTGTAGCTAAATGTACCTGAGACATAT
 161 TAGTCTTTGAAAAATAAAGTTATGTAAGGTTTTTTTTATCTTTAAATAGCTCTGTGGGTTTTAACATTTTTATAAAGATA
 241 TACCAAGGGCCATTCAGTACATCAGGAAAGTGGCAGACAGAAGCTTCTCTCTGCAACCTTGAAGACTATTGGTTTGAGAA
 321 CTTCTCTTCCCATACCACCCAAAATCATAATGCCATTGGAAAGCAAAAAGTTGTTTTATCCATTTGATTTGAATTGTTTT
 401 AAGCCAATATTTTAAGGTAAAACTCACTGAATCTAACCATAGCTGACCTTTGTAGTAGAATTTACAACTTATAATTACAA
 481 TGCACAATTTATAATTACAATATGTATTTATGTCTTTTGCTATGGAGCAAATCCAGGAAGGCAAGAGAAACATTCTTTCC
 561 TAAATATAAATGAAAATCTATCCTTTAAACTCTTCCACTAGACGTTGTAATGCACACTTATTTTTTTCCCAAGGAGTAAC
 641 CAATTTCTTTCTAAAACACATTTAAAATTTTAAAACTATTTATGAATATTAAAAAAAGACATAATTCACACATTAATAAA
 721 CAATCTCCCAAGTATTGATTTAACTTCATTTTTCTAATAATCATAAACTATATTCTGTGACATGCTAATTATTATTAAAT
 801 GTAAGTCGTTAGTTCGAAAGCCTCTCACTAAGTATGATCTATGCTATATTCAAAATTCAACCCATTTACTTTGGTCAATA
 881 TTTGATCTAAGTTGCATCTTTAATCCTGGTGGTCTTGCCTTCTGATTTTTAATTTGTATCCTTTTCTATTAAGATATATT
 961 TGTCATTTTCTCTTGAATATGTATTAAAATATCCCAAGC
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uccccAAGUG--GCUCGUUGUAAg 5'
               ||:||  :|: |||:||| 
Target 5' acccaTTTACTTTGGTCAATATTt 3'
860 - 883 139.00 -8.40
2
miRNA  3' ucCCCAAGUGGCUCGUUGUAAg 5'
            |||||:      :|||||| 
Target 5' gtGGGTTT------TAACATTt 3'
214 - 229 132.00 -9.50
3
miRNA  3' uccCCAAGUGGCUCGUUGUAAg 5'
             | ||| |:  ||||| || 
Target 5' gaaGCTTCTCTCTGCAACCTTg 3'
280 - 301 127.00 -5.96
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-409-3p :: FGA    [ Functional MTI ]
Validation Method ELISA , Flow , Luciferase reporter assay , Other
Conditions HuH7 , HEK-293T
Tools used in this research RNA22 , TargetScan
Original Description (Extracted from the article) ... overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bβ (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR.// ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
7 hsa-miR-409-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005517 FGB fibrinogen beta chain 2 1
MIRT005518 FGA fibrinogen alpha chain 2 1
MIRT005519 FGG fibrinogen gamma chain 2 1
MIRT006452 PHF10 PHD finger protein 10 3 1
MIRT006649 ANG angiogenin, ribonuclease, RNase A family, 5 3 1
MIRT006807 RDX radixin 3 1
MIRT007285 IFNG interferon, gamma 1 1