Accession ID: MIRT005519 [miRNA, hsa-miR-409-3p :: FGG, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-409 LinkOut: [miRBase ]
Synonyms MIRN409, hsa-mir-409, MIR409
Description Homo sapiens miR-409 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-409-3p
Mature Sequence 47| GAAUGUUGCUCGGUGAACCCCU |68
Evidence Experimental
Experiments Cloned
Putative hsa-miR-409-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
miRNA-target interaction network
Gene Information
Gene Symbol FGG LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description fibrinogen gamma chain
Transcript NM_021870   LinkOut: [ RefSeq ]
Other Transcripts NM_000509   
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa04610    Complement and coagulation cascades - Homo sapiens (human)
Putative miRNA Targets on FGG LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGG
(miRNA target sites are highlighted)
>FGG|NM_021870|3'UTR
   1 TAGAAAATTAACTGCTAACTTCTATTGACCCACAAAGTTTCAGAAATTCTCTGAAAGTTTCTTCCTTTTTTCTCTTACTA
  81 TATTTATTGATTTCAAGTCTTCTATTAAGGACATTTAGCCTTCAATGGAAATTAAAACTCATTTAGGACTGTATTTCCAA
 161 ATTACTGATATCAGAGTTATTTAAAAATTGTTTATTTGAGGAGATAACATTTCAACTTTGTTCCTAAATATATAATAATA
 241 AAATGATTGACTTTATTTGCAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucccCAAGUGG----CUC-GUUGUAAg 5'
              |||:|::    ||| :|||||| 
Target 5' aattGTTTATTTGAGGAGATAACATTt 3'
186 - 212 140.00 -10.30
2
miRNA  3' uccccaAGUGGC--UCGUUGUAAg 5'
                |:||:|  | ||: :|| 
Target 5' tccaaaTTACTGATATCAGAGTTa 3'
156 - 179 90.00 -5.70
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target hsa-miR-409-3p :: FGG    [ Non-Functional MTI ]
Validation Method ELISA , Flow , Luciferase reporter assay
Conditions HuH7, HEK-293T
Tools used in this research RNA22, TargetScan
Original Description (Extracted from the article) ... overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bβ (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR.// ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]