Accession ID: MIRT005519 [miRNA, hsa-miR-409-3p :: FGG, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-409LinkOut: [miRBase ]
Synonyms MIRN409, hsa-mir-409, MIR409
Description Homo sapiens miR-409 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-409-3p
Mature Sequence 47| GAAUGUUGCUCGGUGAACCCCU |68
Evidence Experimental
Experiments Cloned
Putative hsa-miR-409-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGG LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description fibrinogen gamma chain
Transcript NM_021870    LinkOut: [ RefSeq ]
Other Transcripts NM_000509   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGG LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGG
(miRNA target sites are highlighted)
>FGG|NM_021870|3'UTR
   1 AAAATTAACTGCTAACTTCTATTGACCCACAAAGTTTCAGAAATTCTCTGAAAGTTTCTTCCTTTTTTCTCTTACTATAT
  81 TTATTGATTTCAAGTCTTCTATTAAGGACATTTAGCCTTCAATGGAAATTAAAACTCATTTAGGACTGTATTTCCAAATT
 161 ACTGATATCAGAGTTATTTAAAAATTGTTTATTTGAGGAGATAACATTTCAACTTTGTTCCTAAATATATAATAATAAAA
 241 TGATTGACTTTATTTGCA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' ucccCAAGUGG----CUC-GUUGUAAg 5'
              |||:|::    ||| :|||||| 
Target 5' aattGTTTATTTGAGGAGATAACATTt 3'
183 - 209 140.00 -10.30
2
miRNA  3' uccccaAGUGGC--UCGUUGUAAg 5'
                |:||:|  | ||: :|| 
Target 5' tccaaaTTACTGATATCAGAGTTa 3'
153 - 176 90.00 -5.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-409-3p :: FGG    [ Functional MTI ]
Validation Method ELISA , Flow , Luciferase reporter assay , Other
Conditions HuH7 , HEK-293T
Tools used in this research RNA22 , TargetScan
Original Description (Extracted from the article) ... overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bβ (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR.// ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
96 hsa-miR-409-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005517 FGB fibrinogen beta chain 2 1
MIRT005518 FGA fibrinogen alpha chain 2 1
MIRT005519 FGG fibrinogen gamma chain 2 1
MIRT006452 PHF10 PHD finger protein 10 3 1
MIRT006649 ANG angiogenin, ribonuclease, RNase A family, 5 3 1
MIRT006807 RDX radixin 3 1
MIRT007285 IFNG interferon, gamma 1 1
MIRT073565 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 2
MIRT074444 TNRC6A trinucleotide repeat containing 6A 1 3
MIRT082018 MTF2 metal response element binding transcription factor 2 1 2
MIRT088832 MSH6 mutS homolog 6 (E. coli) 1 1
MIRT093988 SLAIN2 SLAIN motif family, member 2 1 1
MIRT097133 FCHO2 FCH domain only 2 1 1
MIRT106302 ZFHX4 zinc finger homeobox 4 1 3
MIRT177611 UBE2D1 ubiquitin-conjugating enzyme E2D 1 1 2
MIRT181438 CTNND1 catenin (cadherin-associated protein), delta 1 1 1
MIRT196787 ZNF207 zinc finger protein 207 1 3
MIRT225511 PDE7A phosphodiesterase 7A 1 1
MIRT243468 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1 1
MIRT264506 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT275464 TMPO thymopoietin 1 1
MIRT295885 C20ORF24 chromosome 20 open reading frame 24 1 2
MIRT296170 PRNP prion protein 1 2
MIRT303233 PPP3R1 protein phosphatase 3, regulatory subunit B, alpha 1 2
MIRT322407 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT327207 ZFX zinc finger protein, X-linked 1 1
MIRT354895 SEC62 SEC62 homolog (S. cerevisiae) 1 1
MIRT357223 C5ORF15 chromosome 5 open reading frame 15 1 1
MIRT437442 MET met proto-oncogene (hepatocyte growth factor receptor) 3 1
MIRT439343 UNC13A unc-13 homolog A (C. elegans) 1 1
MIRT439545 SRP54 signal recognition particle 54kDa 1 1
MIRT439791 RECQL RecQ protein-like (DNA helicase Q1-like) 1 1
MIRT439892 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) 1 1
MIRT439924 PPHLN1 periphilin 1 1 1
MIRT440164 MYO3A myosin IIIA 1 1
MIRT440247 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 1 1
MIRT440400 KDM4C lysine (K)-specific demethylase 4C 1 1
MIRT440581 GCK glucokinase (hexokinase 4) 1 1
MIRT440598 G6PC2 glucose-6-phosphatase, catalytic, 2 1 1
MIRT440868 CSDE1 cold shock domain containing E1, RNA-binding 1 1
MIRT440895 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT440969 CDCP1 CUB domain containing protein 1 1 1
MIRT441869 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 1 1
MIRT442239 DDX19A DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A 1 1
MIRT442528 MOB3B MOB kinase activator 3B 1 1
MIRT446947 ZMAT3 zinc finger, matrin-type 3 1 2
MIRT450362 GRAMD3 GRAM domain containing 3 1 1
MIRT464905 TXNRD1 thioredoxin reductase 1 1 1
MIRT468656 SECISBP2L SECIS binding protein 2-like 1 3
MIRT469045 RNF38 ring finger protein 38 1 3
MIRT471869 NUFIP2 nuclear fragile X mental retardation protein interacting protein 2 1 2
MIRT476278 GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type 1 3
MIRT477499 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT481310 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) 1 8
MIRT500590 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 1 2
MIRT509695 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510993 PDE12 phosphodiesterase 12 1 3
MIRT513594 DCTN6 dynactin 6 1 1
MIRT514621 CCDC38 coiled-coil domain containing 38 1 2
MIRT518536 FLCN folliculin 1 3
MIRT518779 ZFP14 zinc finger protein 14 homolog (mouse) 1 1
MIRT523340 GUCD1 chromosome 22 open reading frame 13 1 2
MIRT523797 FAM63B family with sequence similarity 63, member B 1 1
MIRT529114 AQPEP laeverin 1 1
MIRT529444 MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 1 1
MIRT532221 CCDC117 coiled-coil domain containing 117 1 1
MIRT537327 FOXN3 forkhead box N3 1 1
MIRT543543 C17orf105 chromosome 17 open reading frame 105 1 1
MIRT544607 DCAF5 DDB1 and CUL4 associated factor 5 1 1
MIRT544698 ZNF224 zinc finger protein 224 1 1
MIRT546741 RNF141 ring finger protein 141 1 1
MIRT547879 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT547936 HNRNPR heterogeneous nuclear ribonucleoprotein R 1 1
MIRT552131 MED10 mediator complex subunit 10 1 1
MIRT552462 ZNF367 zinc finger protein 367 1 1
MIRT557464 GSK3B glycogen synthase kinase 3 beta 1 2
MIRT558373 DIDO1 death inducer-obliterator 1 1 2
MIRT561621 SESN3 sestrin 3 1 1
MIRT564558 CCDC80 coiled-coil domain containing 80 1 1
MIRT564889 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 1 1
MIRT566731 MSL2 male-specific lethal 2 homolog (Drosophila) 1 1
MIRT566760 MOB4 MOB family member 4, phocein 1 1
MIRT567231 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 1
MIRT568435 GDNF glial cell derived neurotrophic factor 1 1
MIRT569813 XKR4 XK, Kell blood group complex subunit-related family, member 4 1 1
MIRT653673 SLC26A7 solute carrier family 26, member 7 1 1
MIRT656777 KPNA4 karyopherin alpha 4 (importin alpha 3) 1 1
MIRT657485 HCAR2 hydroxycarboxylic acid receptor 2 1 1
MIRT699999 RPS24 ribosomal protein S24 1 1
MIRT705005 CAMSAP1 calmodulin regulated spectrin-associated protein 1 1 1
MIRT712959 SGCD sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) 1 1
MIRT715488 MTMR7 myotubularin related protein 7 1 1
MIRT716842 EFR3B EFR3 homolog B (S. cerevisiae) 1 1
MIRT719345 VGLL4 vestigial like 4 (Drosophila) 1 1
MIRT721854 C1QTNF3 C1q and tumor necrosis factor related protein 3 1 1
MIRT722389 TRMT13 tRNA methyltransferase 13 homolog (S. cerevisiae) 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*