Accession ID: MIRT005521 [miRNA, hsa-miR-29a :: FGG, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29a LinkOut: [miRBase ]
Synonyms MIRN29, MIRN29A, hsa-mir-29, hsa-mir-29a, miRNA29A, MIR29A
Description Homo sapiens miR-29a stem-loop
Comment miR-29a was previously know as miR-29 here and in .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-29a-3p
Mature Sequence 42| UAGCACCAUCUGAAAUCGGUUA |63
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Mature miRNA hsa-miR-29a-5p
Mature Sequence 4| ACUGAUUUCUUUUGGUGUUCAG |25
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29a-5p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
miRNA-target interaction network
Gene Information
Gene Symbol FGG LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description fibrinogen gamma chain
Transcript NM_021870   LinkOut: [ RefSeq ]
Other Transcripts NM_000509   
Expression LinkOut: [ BioGPS ]
KEGG Pathway hsa04610    Complement and coagulation cascades - Homo sapiens (human)
Putative miRNA Targets on FGG LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGG
(miRNA target sites are highlighted)
>FGG|NM_021870|3'UTR
   1 TAGAAAATTAACTGCTAACTTCTATTGACCCACAAAGTTTCAGAAATTCTCTGAAAGTTTCTTCCTTTTTTCTCTTACTA
  81 TATTTATTGATTTCAAGTCTTCTATTAAGGACATTTAGCCTTCAATGGAAATTAAAACTCATTTAGGACTGTATTTCCAA
 161 ATTACTGATATCAGAGTTATTTAAAAATTGTTTATTTGAGGAGATAACATTTCAACTTTGTTCCTAAATATATAATAATA
 241 AAATGATTGACTTTATTTGCAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' auuggcuaAAGUCUACCacgau 5'
                  |||| ||||     
Target 5' atttagccTTCA-ATGGaaatt 3'
113 - 133 77.00 -6.53
2
miRNA  3' auUGGCUAAAGUCU-ACcacgau 5'
            ||: |||| :|| ||      
Target 5' aaACTCATTTAGGACTGtatttc 3'
135 - 157 68.00 -5.87
3
miRNA  3' auUGGCUAAAGUCUACCACGAu 5'
            |::|||||||    || :| 
Target 5' ttATTGATTTCAA---GTCTTc 3'
84 - 102 67.00 -7.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29a :: FGG    [ Functional MTI ]
Validation Method ELISA , Flow , Luciferase reporter assay
Conditions HuH7, HEK-293T
Location of target site 5'UTR, 3'UTR
Tools used in this research RNA22, TargetScan,
Original Description (Extracted from the article) ... Neither hsa-miR-29a nor hsa-miR-29b had a direct effect on luciferase activity using this reporter gene (Figure 3B).We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]