Accession ID: MIRT005522 [miRNA, hsa-miR-29b ::
FGG, target gene]
| miRNA name | hsa-miR-29b |
|---|
 |
| Gene Symbol | FGG LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ] |
|---|---|
| Synonyms | - |
| Description | fibrinogen gamma chain |
| Transcript | NM_021870 LinkOut: [ RefSeq ] |
| Other Transcripts | NM_000509 |
| Expression | LinkOut: [ BioGPS ] |
| KEGG Pathway |
hsa04610 Complement and coagulation cascades - Homo sapiens (human) |
| Putative miRNA Targets on FGG | LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ] |
| 3'UTR of FGG (miRNA target sites are highlighted) |
>FGG|NM_021870|3'UTR 1 TAGAAAATTAACTGCTAACTTCTATTGACCCACAAAGTTTCAGAAATTCTCTGAAAGTTTCTTCCTTTTTTCTCTTACTA 81 TATTTATTGATTTCAAGTCTTCTATTAAGGACATTTAGCCTTCAATGGAAATTAAAACTCATTTAGGACTGTATTTCCAA 161 ATTACTGATATCAGAGTTATTTAAAAATTGTTTATTTGAGGAGATAACATTTCAACTTTGTTCCTAAATATATAATAATA 241 AAATGATTGACTTTATTTGCAAA Target sites Provided by authors Predicted by miRanda |
| miRNA:Target | hsa-miR-29b :: FGG [ Functional MTI ] |
|---|---|
| Validation Method | ELISA , Flow , Luciferase reporter assay |
| Conditions | HuH7, HEK-293T |
| Location of target site | 5'UTR, 3'UTR |
| Tools used in this research | RNA22, TargetScan, |
| Original Description (Extracted from the article) | ... Neither hsa-miR-29a nor hsa-miR-29b had a direct effect on luciferase activity using this reporter gene (Figure 3B).We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ... - Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood. |
| Article |
- Fort, A.
Borel, C.
Migliavacca, E. et al. - Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
|