Accession ID: MIRT005522 [miRNA, hsa-miR-29b-3p :: FGG, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29b-1LinkOut: [miRBase ]
Synonyms MIRN29B1, miRNA29B1, MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 . Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29b-3p
Mature Sequence 51| UAGCACCAUUUGAAAUCAGUGUU |73
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29b-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGG LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description fibrinogen gamma chain
Transcript NM_0218    LinkOut: [ RefSeq ]
Other Transcripts NM_0005   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGG LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGG
(miRNA target sites are highlighted)
>FGG|NM_0218|3'UTR
   1 TAGAAAATTAACTGCTAACTTCTATTGACCCACAAAGTTTCAGAAATTCTCTGAAAGTTTCTTCCTTTTTTCTCTTACTA
  81 TATTTATTGATTTCAAGTCTTCTATTAAGGACATTTAGCCTTCAATGGAAATTAAAACTCATTTAGGACTGTATTTCCAA
 161 ATTACTGATATCAGAGTTATTTAAAAATTGTTTATTTGAGGAGATAACATTTCAACTTTGTTCCTAAATATATAATAATA
 241 AAATGATTGACTTTATTTGCAAA
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' uuGUGA--CUAAAGUUUACCacgau 5'
            ||:|  |  ||| |||||     
Target 5' gaCATTTAGCCTTC-AATGGaaatt 3'
110 - 133 82.00 -5.93
2
miRNA  3' uuGUGACUAAAGUUUACCACGAu 5'
            :|:|||||||||   || :| 
Target 5' ttTATTGATTTCAA---GTCTTc 3'
83 - 102 80.00 -11.47
3
miRNA  3' uugUGAC-UAAA-GUUU-ACCACGAu 5'
             |||| |||| |||| |  || | 
Target 5' aggACTGTATTTCCAAATTACTGATa 3'
145 - 170 80.00 -7.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29b-3p :: FGG    [ Functional MTI ]
Validation Method ELISA , Flow , Luciferase reporter assay ,
Conditions HuH7 , HEK-293T
Location of target site 5'UTR, 3'UTR
Tools used in this research RNA22 , TargetScan
Original Description (Extracted from the article) ... Neither hsa-miR-29a nor hsa-miR-29b had a direct effect on luciferase activity using this reporter gene (Figure 3B). We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
79 hsa-miR-29b-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000096 HDAC4 histone deacetylase 4 2 2
MIRT000097 CTNNBIP1 catenin, beta interacting protein 1 2 2
MIRT000098 COL5A3 collagen, type V, alpha 3 2 2
MIRT000099 COL4A2 collagen, type IV, alpha 2 1 1
MIRT000100 COL1A1 collagen, type I, alpha 1 5 6
MIRT000101 ACVR2A activin A receptor, type IIA 1 1
MIRT000445 SP1 Sp1 transcription factor 5 5
MIRT000684 CDK6 cyclin-dependent kinase 6 4 2
MIRT000930 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT002310 SFPQ splicing factor proline/glutamine-rich 3 1
MIRT002316 DNAJB11 DnaJ (Hsp40) homolog, subfamily B, member 11 3 1
MIRT003026 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 4
MIRT003029 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 5
MIRT003287 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 5 7
MIRT003290 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT003661 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT003736 S100B S100 calcium binding protein B 3 1
MIRT003813 VEGFA vascular endothelial growth factor A 2 1
MIRT004308 ESR1 estrogen receptor 1 2 1
MIRT004312 NCOA3 nuclear receptor coactivator 3 2 1
MIRT004419 TET1 tet oncogene 1 4 1
MIRT004510 TCL1A T-cell leukemia/lymphoma 1A 5 4
MIRT005381 Mmp15 matrix metallopeptidase 15 3 1
MIRT005383 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005385 MMP24 matrix metallopeptidase 24 (membrane-inserted) 3 1
MIRT005387 Mmp24 matrix metallopeptidase 24 2 1
MIRT005486 GRN granulin 4 1
MIRT005522 FGG fibrinogen gamma chain 2 1
MIRT005533 FGA fibrinogen alpha chain 2 1
MIRT005534 FGB fibrinogen beta chain 2 1
MIRT005567 COL3A1 collagen, type III, alpha 1 4 2
MIRT005568 COL4A1 collagen, type IV, alpha 1 4 1
MIRT005570 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 4 2
MIRT005667 ADAM12 ADAM metallopeptidase domain 12 4 2
MIRT005669 NID1 nidogen 1 4 1
MIRT006054 HMGA2 high mobility group AT-hook 2 3 1
MIRT006058 TGFB2 transforming growth factor, beta 2 2 1
MIRT006059 TGFB1 transforming growth factor, beta 1 2 1
MIRT006060 BMP1 bone morphogenetic protein 1 3 2
MIRT006098 PTEN phosphatase and tensin homolog 4 1
MIRT006251 NASP nuclear autoantigenic sperm protein (histone-binding) 2 1
MIRT006486 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 2 1
MIRT006488 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 1
MIRT006753 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT006815 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 3 1
MIRT006915 NKIRAS2 NFKB inhibitor interacting Ras-like 2 3 1
MIRT007011 RAX retina and anterior neural fold homeobox 2 1
MIRT007033 TBX21 T-box 21 1 1
MIRT007034 IFNG interferon, gamma 1 1
MIRT007102 DUSP2 dual specificity phosphatase 2 1 1
MIRT007254 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT027237 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT027238 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 2
MIRT027239 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT048359 SCAF8 RNA binding motif protein 16 1 1
MIRT048360 CLDN1 claudin 1 1 1
MIRT048361 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT048362 RSL24D1 ribosomal L24 domain containing 1 1 1
MIRT048363 LRP10 low density lipoprotein receptor-related protein 10 1 1
MIRT048364 HP1BP3 heterochromatin protein 1, binding protein 3 1 1
MIRT048365 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 1 1
MIRT048366 KIAA1671 KIAA1671 1 1
MIRT048367 NNT nicotinamide nucleotide transhydrogenase 1 1
MIRT048368 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT048369 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT048370 RUNDC3B RUN domain containing 3B 1 1
MIRT048371 CECR2 cat eye syndrome chromosome region, candidate 2 1 1
MIRT048372 TPD52L2 tumor protein D52-like 2 1 1
MIRT048373 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 1
MIRT048374 CIT citron (rho-interacting, serine/threonine kinase 21) 1 1
MIRT048375 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 1 1
MIRT048376 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1 1
MIRT048377 PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT048378 PIGN phosphatidylinositol glycan anchor biosynthesis, class N 1 1
MIRT048379 RPS4X ribosomal protein S4, X-linked 1 1
MIRT048380 CCSAP chromosome 1 open reading frame 96 1 1
MIRT048381 CALU calumenin 1 1
MIRT048382 NREP chromosome 5 open reading frame 13 1 1
MIRT048383 MKI67 antigen identified by monoclonal antibody Ki-67 1 1