Accession ID: MIRT005526 [miRNA, hsa-miR-29c-3p :: FGB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29cLinkOut: [miRBase ]
Description Homo sapiens miR-29c stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29c-3p
Mature Sequence 54| UAGCACCAUUUGAAAUCGGUUA |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29c-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description fibrinogen beta chain
Transcript NM_001184741    LinkOut: [ RefSeq ]
Other Transcripts NM_005141   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGB
(miRNA target sites are highlighted)
>FGB|NM_001184741|3'UTR
   1 TCCCCAATACGTAGATTTTTGCTCTTCTGTATGTGACAACATTTTTGTACATTATGTTATTGGAATTTTCTTTCATACAT
  81 TATATTCCTCTAAAACTCTCAAGCAGACGTGAGTGTGACTTTTTGAAAAAAGTATAGGATAAATTACATTAAAATAGCAC
 161 ATGATTTTCTTTTGTTTTCTTCATTTCTCTTGCTCACCAAGAAGTAACAAAAGTATAGTTTTGACAGAGTTGGTGTTCAT
 241 AATTTCAGTTCTAGTTGATTGCGAGAATTTTCAAATAAGGAAGAGGGGTCTTTTATCCTTGTCGTAGGAAAACCATGACG
 321 GAAAGGAAAAACTGATGTTTAAAAGTCCACTTTTAAAACTATATTTATTTATGTAGGATCTGTCAAAGAAAACTTCCAAA
 401 AAGATTTATTAATTAAACCAGACTCTGTTGCAATAAGTTAATGTTTTCTTGTTTTGTAATCCACACATTCAATGAGTTAG
 481 GCTTTGCACTTGTAAGGAAGGAGAAGCGTTCACAACCTCAAATAGCTAATAAACCGGTCTTGAATATTTGAAGATTTAAA
 561 ATCTGACTCTAGGACGGGCACGGTGGCTCACGACTATAATCCCAACACTTTGGGAGGCTGAGGCGGGCGGTCACAAGGTC
 641 AGGAGTTCAAGACCAGCCTGACCAATATGGTGAAACCCCATCTCTACTAAAAATACAAAAATTAGCCAGGCGTGGTGGCA
 721 GGTGCCTGTAGTCCCAGCTACCTGTGAGGTGGAGATTGCATTGAGCCAAGATCTCAACACTGCACTCCAGCCTGGGCAAC
 801 AGCGTGAGACTCCACCTCAAAAAAAAAAAAAAAAGAATCTGACTATATACCATGGAAAAGCCACCACTCTGCCACTTAAA
 881 TAAACATCAGGATCAGAGATTCCAAGAGGACAATCTGCATCAAGTCTTCACCAAGTGTTTTTTAAGCGAAATAATGAAAT
 961 AGGGAGCAGAATATGCCTGTTGCCCATAGAAACGAGGTCTATTCTTGTCCTCAATTAGGCTTTTTTTTCTTCATAGTTAC
1041 ACCAGAACTAAAGTAAAAGTGGTTTTTCTGTTCTTTCTACTTCTCCCCATGAAATGGGCATATCATCTCAACACTTCACT
1121 CCAAGTCGCCACGGGCAACCTTATGACCCTAGGTCCTCCACCCCTAATGTATCATCATTGCCACCCATTTTTATGGTACT
1201 TATTGTTCTTAAGCTTATCCTCTTAATCTTTTCATGTAAGCAAAGCTCATTAATTTCTGTCTTGGAAATGCTACTACTCT
1281 CTTTAATTACTCACCAAATCCAACTTTAACTTTTGACCTGGTTTCTCTGCCACAAGTTCTGTCCCACTGGAGCCCATACT
1361 CACCTACCGCTTTGCCATCACATTTAACAGAAAACTCTTATCAACTTACTTCCTGCTTAACATTAGCTCCTTCCTATCTA
1441 TATCCAAATTTCTTAAATTCAAATTTTTTAGCTGGAGTAAAAATGGTCCCAGTACCATTTCCTGTTCCCTTCACTATAAC
1521 CTACATTTTTGTCACATTAAGTTTTTCCCCATTCCAGGACAGGTCAGGCCCTTTAAAAATTTCAACAGCTTTATTGAGAT
1601 ATAATTGATATAATTTAAAAAATCCTGCACATGTGTCATGCTGGAGCCCTATTGATTCCAACAGGGATGGCGCCTTGTCC
1681 AAGAAGAGACCCAGAGCCAGTGAATGGGACATAGGGTTTATTTAGGACTTAAATACAGATGTGGTCCAGTGGCAGTGGGC
1761 TGGACAGGACCGCTACTATTTGTAAAGAGTATGTAGTTTATATAACATTTCTACTTAGCACTCTCCACTTAGCAACCTCC
1841 ATTTAACCCAAAATAAAAGGCCTTGGTTCCTTGCACATCCTGAGTTCCAACGGACAGGCAGGGAGTTCAAGTGTCCTTCA
1921 CAGATAAGAAGTGAATCTCTCTGGGTTGGCCATTCCCGGATTCCTTAGCTTAGACTCTGAACACATATTCTTCTTAGACC
2001 ATACAGTCATTCTCAGGGTATGCTTGAGTTAATGCTGTCGGATGCATCTGTCATACAAAGTGTTTAACATATACGATTTC
2081 ATGATTTTGGAAATATGCATACACCCATGATAT
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' auUGGCUAAA--GUUU--ACCACGAu 5'
            |: | |||  ||:|  |||||:| 
Target 5' gtATAGTTTTGACAGAGTTGGTGTTc 3'
213 - 238 140.00 -8.60
2
miRNA  3' auUGGCUAAAGUUUACCACGAu 5'
            ||| ||||:  ||||| || 
Target 5' ccACCCATTTT-TATGGTACTt 3'
1181 - 1201 135.00 -10.40
3
miRNA  3' auUGGCUAAAGUU-----UACCACGau 5'
            |::|||| |||     |||| ||  
Target 5' ctATTGATTCCAACAGGGATGGCGCct 3'
1649 - 1675 116.00 -10.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29c-3p :: FGB    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions HuH7 , HEK-293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... In agreement with the TargetScan prediction, we detected a direct effect of hsa-miR-29c (hsa- miR-29a and hsa-miR-29b were not tested) on luciferase activity from the reporter plasmid carrying the FGA-αE-3'UTR but not for the reporter plasmids carrying the other fibrinogen mRNA 3'UTRs (Figure 3A).// We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
228 hsa-miR-29c-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000927 COL3A1 collagen, type III, alpha 1 2 2
MIRT000928 COL1A1 collagen, type I, alpha 1 3 2
MIRT001921 TDG thymine-DNA glycosylase 5 4
MIRT001922 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 3 3
MIRT001923 LAMC1 laminin, gamma 1 (formerly LAMB2) 2 1
MIRT001925 COL15A1 collagen, type XV, alpha 1 3 1
MIRT001926 COL4A2 collagen, type IV, alpha 2 2 2
MIRT001927 COL4A1 collagen, type IV, alpha 1 3 5
MIRT001928 COL1A2 collagen, type I, alpha 2 4 3
MIRT001929 GAPDH glyceraldehyde-3-phosphate dehydrogenase 2 1
MIRT003025 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 1
MIRT003028 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 4
MIRT003200 CDK6 cyclin-dependent kinase 6 5 2
MIRT003288 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 6 8
MIRT003289 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT003829 FBN1 fibrillin 1 3 2
MIRT003994 SRSF10 serine/arginine-rich splicing factor 10 2 1
MIRT004631 CD276 CD276 molecule 2 2
MIRT005375 Col6a2 collagen, type VI, alpha 2 3 1
MIRT005376 Ctsk cathepsin K 3 1
MIRT005382 Mmp15 matrix metallopeptidase 15 3 1
MIRT005384 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005386 MMP24 matrix metallopeptidase 24 (membrane-inserted) 3 1
MIRT005388 Mmp24 matrix metallopeptidase 24 2 1
MIRT005525 FGG fibrinogen gamma chain 2 1
MIRT005526 FGB fibrinogen beta chain 2 1
MIRT005527 FGA fibrinogen alpha chain 2 1
MIRT006382 COL7A1 collagen, type VII, alpha 1 1 1
MIRT006383 COL21A1 collagen, type XXI, alpha 1 1 1
MIRT006384 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 1 1
MIRT006385 WNT4 wingless-type MMTV integration site family, member 4 1 1
MIRT006386 IGFBP1 insulin-like growth factor binding protein 1 1 1
MIRT006487 PPP1R13B protein phosphatase 1, regulatory subunit 13B 2 1
MIRT006489 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 2
MIRT020357 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT020358 MKL2 MKL/myocardin-like 2 1 1
MIRT020359 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT020360 NUMB numb homolog (Drosophila) 1 1
MIRT020361 ZNF45 zinc finger protein 45 1 1
MIRT020362 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 2
MIRT020363 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT020364 WSB2 WD repeat and SOCS box containing 2 1 1
MIRT020365 PURG purine-rich element binding protein G 1 1
MIRT020366 CDV3 CDV3 homolog (mouse) 1 1
MIRT020367 JUN jun proto-oncogene 1 1
MIRT020368 TIPRL TIP41, TOR signaling pathway regulator-like (S. cerevisiae) 1 1
MIRT020369 OIP5 Opa interacting protein 5 1 1
MIRT020370 SCAF11 SR-related CTD-associated factor 11 1 1
MIRT020371 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT020372 R3HDM4 R3H domain containing 4 1 2
MIRT020373 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT020374 FAM102B family with sequence similarity 102, member B 1 2
MIRT020375 KCTD15 potassium channel tetramerisation domain containing 15 1 4
MIRT020376 U2SURP U2 snRNP-associated SURP domain containing 1 1
MIRT020377 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT020378 BFAR bifunctional apoptosis regulator 1 1
MIRT020379 CDC42SE1 CDC42 small effector 1 1 3
MIRT020380 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT020381 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 1
MIRT020382 SOWAHC sosondowah ankyrin repeat domain family member C 1 1
MIRT020383 TXNDC16 thioredoxin domain containing 16 1 1
MIRT020384 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 2
MIRT020385 IRGQ immunity-related GTPase family, Q 1 1
MIRT020386 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT020387 CEP68 centrosomal protein 68kDa 1 1
MIRT020388 NKIRAS2 NFKB inhibitor interacting Ras-like 2 1 2
MIRT020389 VEGFA vascular endothelial growth factor A 1 3
MIRT020390 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT020391 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1
MIRT020392 SPIN4 spindlin family, member 4 1 1
MIRT020393 KIAA0895 KIAA0895 1 1
MIRT020394 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 2
MIRT020395 DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 1 1
MIRT020396 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT020397 CCNT2 cyclin T2 1 3
MIRT020398 DICER1 dicer 1, ribonuclease type III 1 1
MIRT020399 FREM2 FRAS1 related extracellular matrix protein 2 1 1
MIRT020400 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT020401 AMER1 family with sequence similarity 123B 1 4
MIRT020402 KIAA1549 KIAA1549 1 1
MIRT020403 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT020404 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT020405 HDGF hepatoma-derived growth factor 1 2
MIRT020406 MORF4L1 mortality factor 4 like 1 1 4
MIRT020407 PLAG1 pleiomorphic adenoma gene 1 1 2
MIRT020408 RAB30 RAB30, member RAS oncogene family 1 1
MIRT020409 SUV420H2 suppressor of variegation 4-20 homolog 2 (Drosophila) 1 1
MIRT020410 FAM105B family with sequence similarity 105, member B 1 1
MIRT020411 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT020412 KDM5B lysine (K)-specific demethylase 5B 1 1
MIRT020413 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 1 1
MIRT020414 RNF19A ring finger protein 19A, E3 ubiquitin protein ligase 1 1
MIRT020415 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 2
MIRT020416 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT044232 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT044233 C15orf52 chromosome 15 open reading frame 52 1 1
MIRT044234 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT044235 CTC1 CTS telomere maintenance complex component 1 1 8
MIRT044236 XK X-linked Kx blood group (McLeod syndrome) 1 1
MIRT044237 TIMM44 translocase of inner mitochondrial membrane 44 homolog (yeast) 1 1
MIRT044238 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT044239 CHIC2 cysteine-rich hydrophobic domain 2 1 1
MIRT044240 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044241 STK19 serine/threonine kinase 19 1 1
MIRT044242 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT044243 BCKDHA branched chain keto acid dehydrogenase E1, alpha polypeptide 1 1
MIRT044244 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT044245 FAM126B family with sequence similarity 126, member B 1 1
MIRT053245 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 3 4
MIRT053343 SIRT1 sirtuin 1 3 1
MIRT053517 RCC2 regulator of chromosome condensation 2 3 1
MIRT053582 CCND2 cyclin D2 4 2
MIRT053594 PTEN phosphatase and tensin homolog 2 1
MIRT054193 AKT2 v-akt murine thymoma viral oncogene homolog 2 3 1
MIRT054276 CTNND1 catenin (cadherin-associated protein), delta 1 3 1
MIRT054575 PER1 period homolog 1 (Drosophila) 3 1
MIRT054731 TMEM132A transmembrane protein 132A 2 1
MIRT054732 COL6A2 collagen, type VI, alpha 2 2 1
MIRT061663 BTG2 BTG family, member 2 1 2
MIRT079947 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT082516 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT102858 INSIG1 insulin induced gene 1 1 1
MIRT207252 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT207756 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 2
MIRT210970 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211653 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT213231 REST RE1-silencing transcription factor 1 5
MIRT225104 GOLGA7 golgin A7 1 1
MIRT250482 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT267093 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT303364 MXD1 MAX dimerization protein 1 2 1
MIRT316345 ULBP2 UL16 binding protein 2 1 1
MIRT401477 AIM1 absent in melanoma 1 2 1
MIRT437370 LAMC2 laminin, gamma 2 3 1
MIRT437371 ITGA6 integrin, alpha 6 3 1
MIRT437558 COL5A2 collagen, type V, alpha 2 1 1
MIRT437559 COL10A1 collagen, type X, alpha 1 1 1
MIRT437560 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 1 1
MIRT437561 LOX lysyl oxidase 1 1
MIRT437562 PDGFRB platelet-derived growth factor receptor, beta polypeptide 1 1
MIRT437711 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437714 TUBB2A tubulin, beta 2A class IIa 2 1
MIRT437717 EMP1 epithelial membrane protein 1 2 1
MIRT437720 SNX24 sorting nexin 24 2 1
MIRT437723 AMFR autocrine motility factor receptor, E3 ubiquitin protein ligase 2 1
MIRT437726 RIOK3 RIO kinase 3 (yeast) 2 1
MIRT437729 WDR26 WD repeat domain 26 3 2
MIRT437732 DSC2 desmocollin 2 2 1
MIRT437800 TPM1 tropomyosin 1 (alpha) 1 1
MIRT437802 Col2a1 collagen, type II, alpha 1 1 1
MIRT438407 CD274 CD274 molecule 2 1
MIRT438431 TIAM1 T-cell lymphoma invasion and metastasis 1 3 1
MIRT454811 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 1 1
MIRT456826 MORF4L2 mortality factor 4 like 2 1 4
MIRT462150 RPL22 ribosomal protein L22 1 1
MIRT465312 TRAM2 translocation associated membrane protein 2 1 1
MIRT467807 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT467828 SLC29A2 solute carrier family 29 (nucleoside transporters), member 2 1 1
MIRT467970 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 2
MIRT468224 SGK1 serum/glucocorticoid regulated kinase 1 1 1
MIRT469447 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT469722 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT472644 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae) 1 1
MIRT474208 LEPRE1 leucine proline-enriched proteoglycan (leprecan) 1 1 1
MIRT474574 KLHDC3 kelch domain containing 3 1 1
MIRT476720 FRK fyn-related kinase 1 2
MIRT476774 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT477924 DUSP2 dual specificity phosphatase 2 1 1
MIRT478709 CSRNP2 cysteine-serine-rich nuclear protein 2 1 1
MIRT478983 COMMD2 COMM domain containing 2 1 1
MIRT479824 CCNA2 cyclin A2 1 4
MIRT479902 CCDC117 coiled-coil domain containing 117 1 1
MIRT480065 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT480981 BBC3 BCL2 binding component 3 1 1
MIRT489023 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT492512 RAET1L retinoic acid early transcript 1L 1 1
MIRT493824 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT495935 SLC7A5P2 solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2 1 1
MIRT496357 PPY pancreatic polypeptide 1 1
MIRT496661 TMEM237 transmembrane protein 237 1 1
MIRT497643 GLDN gliomedin 1 1
MIRT506749 LDOC1L leucine zipper, down-regulated in cancer 1-like 1 3
MIRT507167 GAS2L3 growth arrest-specific 2 like 3 1 1
MIRT514917 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 3
MIRT523964 DYNLT1 dynein, light chain, Tctex-type 1 1 2
MIRT527674 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT536934 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT537358 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT537686 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 1 1
MIRT538125 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 1
MIRT538812 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT546937 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT547824 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT548239 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT550035 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT552621 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT556560 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT565484 SPRTN SprT-like N-terminal domain 1 1
MIRT568203 CBX6 chromobox homolog 6 1 1
MIRT576776 Tmem127 transmembrane protein 127 1 1
MIRT576957 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT610002 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT616510 COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1 1
MIRT640886 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT641349 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT642977 TESPA1 thymocyte expressed, positive selection associated 1 1 1
MIRT643633 YY2 YY2 transcription factor 1 1
MIRT644385 ZNF286A zinc finger protein 286A 1 1
MIRT650748 YAE1D1 Yae1 domain containing 1 1 1
MIRT661584 EPHX2 epoxide hydrolase 2, cytoplasmic 1 1
MIRT664286 RNMTL1 RNA methyltransferase like 1 1 1
MIRT689392 ZNF850 zinc finger protein 850 1 1
MIRT693814 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT694531 TRIM72 tripartite motif containing 72 1 1
MIRT694627 ZFPM1 zinc finger protein, multitype 1 1 1
MIRT695134 PRY2 PTPN13-like, Y-linked 2 1 1
MIRT695151 PRY PTPN13-like, Y-linked 1 1
MIRT703641 FBRS fibrosin 1 1
MIRT704434 CTNNBIP1 catenin, beta interacting protein 1 1 1
MIRT704550 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT704966 CBX2 chromobox homolog 2 1 1
MIRT705496 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT707994 OTUD4 OTU domain containing 4 1 1
MIRT708740 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT710620 COLEC10 collectin sub-family member 10 (C-type lectin) 1 1
MIRT713055 IFRD1 interferon-related developmental regulator 1 1 1
MIRT715514 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT720769 FAM193A family with sequence similarity 193, member A 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*