Accession ID: MIRT005527 [miRNA, hsa-miR-29c-3p :: FGA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29cLinkOut: [miRBase ]
Description Homo sapiens miR-29c stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29c-3p
Mature Sequence 54| UAGCACCAUUUGAAAUCGGUUA |75
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29c-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGA LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms Fib2, MGC119422, MGC119423, MGC119425
Description fibrinogen alpha chain
Transcript NM_0005    LinkOut: [ RefSeq ]
Other Transcripts NM_0218   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGA LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGA
(miRNA target sites are highlighted)
>FGA|NM_0005|3'UTR
   1 TAGGCTGAAGAAGTGGGAATGGGAGCACTCTGTCTTCTTTGCTAGAGAAGTGGAGAGAAAATACAAAAGGTAAAGCAGTT
  81 GAGATTCTCTACAACCTAAAAAATTCCTAGGTGCTATTTTCTTATCCTTTGTACTGTAGCTAAATGTACCTGAGACATAT
 161 TAGTCTTTGAAAAATAAAGTTATGTAAGGTTTTTTTTATCTTTAAATAGCTCTGTGGGTTTTAACATTTTTATAAAGATA
 241 TACCAAGGGCCATTCAGTACATCAGGAAAGTGGCAGACAGAAGCTTCTCTCTGCAACCTTGAAGACTATTGGTTTGAGAA
 321 CTTCTCTTCCCATACCACCCAAAATCATAATGCCATTGGAAAGCAAAAAGTTGTTTTATCCATTTGATTTGAATTGTTTT
 401 AAGCCAATATTTTAAGGTAAAACTCACTGAATCTAACCATAGCTGACCTTTGTAGTAGAATTTACAACTTATAATTACAA
 481 TGCACAATTTATAATTACAATATGTATTTATGTCTTTTGCTATGGAGCAAATCCAGGAAGGCAAGAGAAACATTCTTTCC
 561 TAAATATAAATGAAAATCTATCCTTTAAACTCTTCCACTAGACGTTGTAATGCACACTTATTTTTTTCCCAAGGAGTAAC
 641 CAATTTCTTTCTAAAACACATTTAAAATTTTAAAACTATTTATGAATATTAAAAAAAGACATAATTCACACATTAATAAA
 721 CAATCTCCCAAGTATTGATTTAACTTCATTTTTCTAATAATCATAAACTATATTCTGTGACATGCTAATTATTATTAAAT
 801 GTAAGTCGTTAGTTCGAAAGCCTCTCACTAAGTATGATCTATGCTATATTCAAAATTCAACCCATTTACTTTGGTCAATA
 881 TTTGATCTAAGTTGCATCTTTAATCCTGGTGGTCTTGCCTTCTGATTTTTAATTTGTATCCTTTTCTATTAAGATATATT
 961 TGTCATTTTCTCTTGAATATGTATTAAAATATCCCAAGC
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29c-3p :: FGA    [ Functional MTI ]
Validation Method Luciferase reporter assay ,
Conditions HuH7 , HEK-293T
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... In agreement with the TargetScan prediction, we detected a direct effect of hsa-miR-29c (hsa- miR-29a and hsa-miR-29b were not tested) on luciferase activity from the reporter plasmid carrying the FGA-αE-3'UTR but not for the reporter plasmids carrying the other fibrinogen mRNA 3'UTRs (Figure 3A).// We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
107 hsa-miR-29c-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000927 COL3A1 collagen, type III, alpha 1 2 1
MIRT000928 COL1A1 collagen, type I, alpha 1 3 2
MIRT001921 TDG thymine-DNA glycosylase 2 1
MIRT001922 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 3 2
MIRT001923 LAMC1 laminin, gamma 1 (formerly LAMB2) 2 1
MIRT001925 COL15A1 collagen, type XV, alpha 1 3 1
MIRT001926 COL4A2 collagen, type IV, alpha 2 2 1
MIRT001927 COL4A1 collagen, type IV, alpha 1 3 2
MIRT001928 COL1A2 collagen, type I, alpha 2 3 2
MIRT001929 GAPDH glyceraldehyde-3-phosphate dehydrogenase 2 1
MIRT003025 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 1
MIRT003028 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 3
MIRT003200 CDK6 cyclin-dependent kinase 6 4 1
MIRT003288 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 6 3
MIRT003289 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT003829 FBN1 fibrillin 1 3 1
MIRT003994 SRSF10 splicing factor, arginine/serine-rich 13A 2 1
MIRT005375 Col6a2 collagen, type VI, alpha 2 3 1
MIRT005376 Ctsk cathepsin K 3 1
MIRT005382 Mmp15 matrix metallopeptidase 15 3 1
MIRT005384 MMP15 matrix metallopeptidase 15 (membrane-inserted) 2 1
MIRT005386 MMP24 matrix metallopeptidase 24 (membrane-inserted) 3 1
MIRT005388 Mmp24 matrix metallopeptidase 24 2 1
MIRT005525 FGG fibrinogen gamma chain 2 1
MIRT005526 FGB fibrinogen beta chain 2 1
MIRT005527 FGA fibrinogen alpha chain 2 1
MIRT006382 COL7A1 collagen, type VII, alpha 1 1 1
MIRT006383 COL21A1 collagen, type XXI, alpha 1 1 1
MIRT006384 TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) 1 1
MIRT006385 WNT4 wingless-type MMTV integration site family, member 4 1 1
MIRT006386 IGFBP1 insulin-like growth factor binding protein 1 1 1
MIRT006487 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 2 1
MIRT006489 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 1
MIRT020357 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 1 1
MIRT020358 MKL2 MKL/myocardin-like 2 1 1
MIRT020359 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT020360 NUMB numb homolog (Drosophila) 1 1
MIRT020361 ZNF45 zinc finger protein 45 1 1
MIRT020362 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 1
MIRT020363 IRF2BP2 interferon regulatory factor 2 binding protein 2 1 1
MIRT020364 WSB2 WD repeat and SOCS box-containing 2 1 1
MIRT020365 PURG purine-rich element binding protein G 1 1
MIRT020366 CDV3 CDV3 homolog (mouse) 1 1
MIRT020367 JUN jun oncogene 1 1
MIRT020368 TIPRL TIP41, TOR signaling pathway regulator-like (S. cerevisiae) 1 1
MIRT020369 OIP5 Opa interacting protein 5 1 1
MIRT020370 SCAF11 splicing factor, arginine/serine-rich 2, interacting protein 1 1
MIRT020371 GNB4 guanine nucleotide binding protein (G protein), beta polypeptide 4 1 1
MIRT020372 R3HDM4 chromosome 19 open reading frame 22 1 1
MIRT020373 ADO 2-aminoethanethiol (cysteamine) dioxygenase 1 1
MIRT020374 FAM102B family with sequence similarity 102, member B 1 1
MIRT020375 KCTD15 potassium channel tetramerisation domain containing 15 1 1
MIRT020376 U2SURP U2-associated SR140 protein 1 1
MIRT020377 KLHL28 kelch-like 28 (Drosophila) 1 1
MIRT020378 BFAR bifunctional apoptosis regulator 1 1
MIRT020379 CDC42SE1 CDC42 small effector 1 1 1
MIRT020380 PPP1R14C protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 1
MIRT020381 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 1 1
MIRT020382 SOWAHC ankyrin repeat domain 57 1 1
MIRT020383 TXNDC16 thioredoxin domain containing 16 1 1
MIRT020384 ELMSAN1 chromosome 14 open reading frame 43 1 1
MIRT020385 IRGQ immunity-related GTPase family, Q 1 1
MIRT020386 PDHX pyruvate dehydrogenase complex, component X 1 1
MIRT020387 CEP68 centrosomal protein 68kDa 1 1
MIRT020388 NKIRAS2 NFKB inhibitor interacting Ras-like 2 1 1
MIRT020389 VEGFA vascular endothelial growth factor A 1 1
MIRT020390 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT020391 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1
MIRT020392 SPIN4 spindlin family, member 4 1 1
MIRT020393 KIAA0895 KIAA0895 1 1
MIRT020394 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT020395 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 1 1
MIRT020396 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1 1
MIRT020397 CCNT2 cyclin T2 1 1
MIRT020398 DICER1 dicer 1, ribonuclease type III 1 1
MIRT020399 FREM2 FRAS1 related extracellular matrix protein 2 1 1
MIRT020400 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 1
MIRT020401 AMER1 family with sequence similarity 123B 1 1
MIRT020402 KIAA1549 KIAA1549 1 1
MIRT020403 DCAF12 DDB1 and CUL4 associated factor 12 1 1
MIRT020404 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT020405 HDGF hepatoma-derived growth factor 1 1
MIRT020406 MORF4L1 mortality factor 4 like 1 1 1
MIRT020407 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT020408 RAB30 RAB30, member RAS oncogene family 1 1
MIRT020409 SUV420H2 suppressor of variegation 4-20 homolog 2 (Drosophila) 1 1
MIRT020410 FAM105B family with sequence similarity 105, member B 1 1
MIRT020411 PRKAB2 protein kinase, AMP-activated, beta 2 non-catalytic subunit 1 1
MIRT020412 KDM5B lysine (K)-specific demethylase 5B 1 1
MIRT020413 BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 1 1
MIRT020414 RNF19A ring finger protein 19A 1 1
MIRT020415 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT020416 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT044232 MMS19 MMS19 nucleotide excision repair homolog (S. cerevisiae) 1 1
MIRT044233 C15orf52 chromosome 15 open reading frame 52 1 1
MIRT044234 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 1 1
MIRT044235 CTC1 chromosome 17 open reading frame 68 1 1
MIRT044236 XK X-linked Kx blood group (McLeod syndrome) 1 1
MIRT044237 TIMM44 translocase of inner mitochondrial membrane 44 homolog (yeast) 1 1
MIRT044238 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 1 1
MIRT044239 CHIC2 cysteine-rich hydrophobic domain 2 1 1
MIRT044240 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT044241 STK19 serine/threonine kinase 19 1 1
MIRT044242 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT044243 BCKDHA branched chain keto acid dehydrogenase E1, alpha polypeptide 1 1
MIRT044244 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 1 1
MIRT044245 FAM126B family with sequence similarity 126, member B 1 1