Accession ID: MIRT005530 [miRNA, hsa-miR-144-3p :: FGB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-144LinkOut: [miRBase ]
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Mature Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-144-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC104327, MGC120405
Description fibrinogen beta chain
Transcript NM_0051    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGB
(miRNA target sites are highlighted)
>FGB|NM_0051|3'UTR
   1 TAGTCCCCAATACGTAGATTTTTGCTCTTCTGTATGTGACAACATTTTTGTACATTATGTTATTGGAATTTTCTTTCATA
  81 CATTATATTCCTCTAAAACTCTCAAGCAGACGTGAGTGTGACTTTTTGAAAAAAGTATAGGATAAATTACATTAAAATAG
 161 CACATGATTTTCTTTTGTTTTCTTCATTTCTCTTGCTCACCAAGAAGTAACAAAAGTATAGTTTTGACAGAGTTGGTGTT
 241 CATAATTTCAGTTCTAGTTGATTGCGAGAATTTTCAAATAAGGAAGAGGGGTCTTTTATCCTTGTCGTAGGAAAACCATG
 321 ACGGAAAGGAAAAACTGATGTTTAAAAGTCCACTTTTAAAACTATATTTATTTATGTAGGATCTGTCAAAGAAAACTTCC
 401 AAAAAGATTTATTAATTAAACCAGACTCTGTTGCAATAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-144-3p :: FGB    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HuH7 , HEK-293T
Location of target site 3'UTR
Original Description (Extracted from the article) ... We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
9 hsa-miR-144-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 pleiomorphic adenoma gene 1 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 Notch homolog 1, translocation-associated (Drosophila) 4 2
MIRT006114 TGFB1 transforming growth factor, beta 1 2 1
MIRT006872 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1