Accession ID: MIRT005530 [miRNA, hsa-miR-144-3p :: FGB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-144LinkOut: [miRBase ]
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
2nd Structure of pre-miRNA
Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Mature Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
Putative hsa-miR-144-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms -
Description fibrinogen beta chain
Transcript NM_001184741    LinkOut: [ RefSeq ]
Other Transcripts NM_005141   
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGB
(miRNA target sites are highlighted)
Target sites Provided by authors  Predicted by miRanda
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            |:| | | |: ||:|||| 
2019 - 2039 134.00 -6.30
             |||| ::|| ||:|||  
Target 5' tgcACATGTGTC-ATGCTGga 3'
1626 - 1645 120.00 -6.40
            | ||| ||| ||||:|   
Target 5' ctTTCATACAT-TATATTcct 3'
70 - 89 105.00 -5.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-144-3p :: FGB    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HuH7 , HEK-293T
Location of target site 3'UTR
Original Description (Extracted from the article) ... We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

MiRNA-Target Expression Profile(TCGA):

MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
187 hsa-miR-144-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 pleiomorphic adenoma gene 1 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 notch 1 4 2
MIRT006114 TGFB1 transforming growth factor, beta 1 2 1
MIRT006872 MTOR mechanistic target of rapamycin (serine/threonine kinase) 1 1
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor (erythroid-derived 2)-like 2 1 1
MIRT053494 ZFX zinc finger protein, X-linked 5 3
MIRT054058 CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 2 1
MIRT054851 TTN titin 3 1
MIRT057677 LCOR ligand dependent nuclear receptor corepressor 1 4
MIRT065418 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 2
MIRT066720 CCT2 chaperonin containing TCP1, subunit 2 (beta) 1 3
MIRT066784 ARID1A AT rich interactive domain 1A (SWI-like) 1 1
MIRT067387 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT068846 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT069645 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 1 1
MIRT069657 PABPN1 poly(A) binding protein, nuclear 1 1 1
MIRT071717 CCNK cyclin K 1 1
MIRT073564 NR2F2 nuclear receptor subfamily 2, group F, member 2 1 2
MIRT080720 ZCCHC2 zinc finger, CCHC domain containing 2 1 2
MIRT090617 PLS1 plastin 1 1 1
MIRT097062 TNPO1 transportin 1 1 2
MIRT102618 UBN2 ubinuclein 2 1 2
MIRT118769 FAM217B family with sequence similarity 217, member B 1 3
MIRT147282 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1 5
MIRT159513 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 1 1
MIRT196438 TAOK1 TAO kinase 1 1 1
MIRT211238 FGF2 fibroblast growth factor 2 (basic) 1 1
MIRT220422 MKLN1 muskelin 1, intracellular mediator containing kelch motifs 1 1
MIRT223668 FZD6 frizzled family receptor 6 1 3
MIRT223805 OXR1 oxidation resistance 1 1 1
MIRT238585 NLN neurolysin (metallopeptidase M3 family) 1 1
MIRT238652 JMY junction mediating and regulatory protein, p53 cofactor 1 1
MIRT247188 BTG2 BTG family, member 2 1 3
MIRT249185 AKIRIN1 akirin 1 1 4
MIRT252653 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 1 2
MIRT305624 MBNL1 muscleblind-like splicing regulator 1 1 1
MIRT315671 NUS1 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 1 3
MIRT366555 EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa 1 1
MIRT403294 ZNF207 zinc finger protein 207 1 1
MIRT405966 CHAC1 ChaC, cation transport regulator homolog 1 (E. coli) 1 1
MIRT437437 EZH2 enhancer of zeste homolog 2 (Drosophila) 4 1
MIRT438343 MET met proto-oncogene (hepatocyte growth factor receptor) 5 1
MIRT444395 ZNF480 zinc finger protein 480 1 1
MIRT445255 SEMA5A sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A 1 1
MIRT445309 MLANA melan-A 1 1
MIRT449020 ANKRD12 ankyrin repeat domain 12 1 1
MIRT452136 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 1 1
MIRT459438 PPIC peptidylprolyl isomerase C (cyclophilin C) 1 1
MIRT460471 MMS22L MMS22-like, DNA repair protein 1 1
MIRT461294 COX10 cytochrome c oxidase assembly homolog 10 (yeast) 1 1
MIRT462948 ZNF800 zinc finger protein 800 1 6
MIRT463489 ZC3H11A zinc finger CCCH-type containing 11A 1 6
MIRT463846 WRN Werner syndrome, RecQ helicase-like 1 1
MIRT466183 TMED5 transmembrane emp24 protein transport domain containing 5 1 2
MIRT466882 STX16 syntaxin 16 1 1
MIRT468156 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT468259 SFXN4 sideroflexin 4 1 1
MIRT469660 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) 1 5
MIRT470040 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT470552 COASY CoA synthase 1 1
MIRT472208 NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 1 2
MIRT472555 NACC1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 2
MIRT473462 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 1 1
MIRT473925 LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3 1 2
MIRT474068 LMNB2 lamin B2 1 1
MIRT475079 ITSN2 intersectin 2 1 2
MIRT475286 TOR1AIP2 torsin A interacting protein 2 1 1
MIRT475570 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT477516 ELL2 elongation factor, RNA polymerase II, 2 1 1
MIRT478464 DAB2 disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) 1 1
MIRT478920 CPS1 carbamoyl-phosphate synthase 1, mitochondrial 1 1
MIRT479338 CERK ceramide kinase 1 1
MIRT480578 BZW1 basic leucine zipper and W2 domains 1 1 1
MIRT480915 BCL2L11 BCL2-like 11 (apoptosis facilitator) 1 1
MIRT481532 ARL5B ADP-ribosylation factor-like 5B 1 4
MIRT481681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT481724 APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 1 3
MIRT481938 ANKRD11 ankyrin repeat domain 11 1 6
MIRT487099 C2orf44 chromosome 2 open reading frame 44 1 1
MIRT489294 RBM8A RNA binding motif protein 8A 1 4
MIRT492255 SLC35F5 solute carrier family 35, member F5 1 1
MIRT493268 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT494770 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 1 1
MIRT496257 DNAJC28 DnaJ (Hsp40) homolog, subfamily C, member 28 1 1
MIRT497713 ZNF645 zinc finger protein 645 1 1
MIRT498027 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT499292 TSPYL1 TSPY-like 1 1 1
MIRT500105 SLC46A3 solute carrier family 46, member 3 1 1
MIRT501020 SPATA2 spermatogenesis associated 2 1 3
MIRT501816 NEURL1B neuralized homolog 1B (Drosophila) 1 1
MIRT502296 GNG12 guanine nucleotide binding protein (G protein), gamma 12 1 3
MIRT502493 FAM122B family with sequence similarity 122B 1 4
MIRT503948 MFSD6 major facilitator superfamily domain containing 6 1 3
MIRT504266 C1orf147 chromosome 1 open reading frame 147 1 2
MIRT504370 ARID1B AT rich interactive domain 1B (SWI1-like) 1 3
MIRT505125 YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) 1 2
MIRT506052 PPP6C protein phosphatase 6, catalytic subunit 1 2
MIRT506481 MYO5A myosin VA (heavy chain 12, myoxin) 1 3
MIRT506967 HOXA10 homeobox A10 1 3
MIRT507728 CLIC4 chloride intracellular channel 4 1 2
MIRT513081 IL20RB interleukin 20 receptor beta 1 3
MIRT513570 FKBP14 FK506 binding protein 14, 22 kDa 1 1
MIRT513631 UBE2A ubiquitin-conjugating enzyme E2A 1 2
MIRT513692 RNF111 ring finger protein 111 1 1
MIRT513764 PEX5L peroxisomal biogenesis factor 5-like 1 2
MIRT520786 TBX18 T-box 18 1 2
MIRT523402 GRIK3 glutamate receptor, ionotropic, kainate 3 1 2
MIRT525719 DCAF12L2 DDB1 and CUL4 associated factor 12-like 2 1 1
MIRT527750 NANOGNB NANOG neighbor homeobox 1 1
MIRT532823 ZNF827 zinc finger protein 827 1 1
MIRT534603 RORA RAR-related orphan receptor A 1 1
MIRT535762 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 1 1
MIRT536346 LEFTY1 left-right determination factor 1 1 1
MIRT543081 APP amyloid beta (A4) precursor protein 1 1
MIRT544064 KIAA1462 KIAA1462 1 1
MIRT545424 SLC39A6 solute carrier family 39 (zinc transporter), member 6 1 1
MIRT546238 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 1 2
MIRT546324 TGFBR3 transforming growth factor, beta receptor III 1 1
MIRT547361 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT547539 MAML3 mastermind-like 3 (Drosophila) 1 1
MIRT548062 GOLGA7 golgin A7 1 1
MIRT549248 ATXN1L ataxin 1-like 1 2
MIRT549250 ATXN1 ataxin 1 1 1
MIRT549467 ACSL4 acyl-CoA synthetase long-chain family member 4 1 1
MIRT549937 RPL7L1 ribosomal protein L7-like 1 1 2
MIRT551489 TMEM192 transmembrane protein 192 1 2
MIRT552564 ZFP36L2 zinc finger protein 36, C3H type-like 2 1 2
MIRT553688 TFAP4 transcription factor AP-4 (activating enhancer binding protein 4) 1 2
MIRT553951 STAMBP STAM binding protein 1 1
MIRT554163 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 2
MIRT554477 SAMD12 sterile alpha motif domain containing 12 1 1
MIRT554918 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT555003 RAB39B RAB39B, member RAS oncogene family 1 1
MIRT555109 PURB purine-rich element binding protein B 1 1
MIRT555445 NT5C3A 5'-nucleotidase, cytosolic III 1 1
MIRT555535 PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 1 1
MIRT556092 MORC3 MORC family CW-type zinc finger 3 1 1
MIRT556571 LIFR leukemia inhibitory factor receptor alpha 1 1
MIRT556936 INO80D INO80 complex subunit D 1 2
MIRT558176 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT558368 DIDO1 death inducer-obliterator 1 1 2
MIRT558464 DCUN1D1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT559236 BICD2 bicaudal D homolog 2 (Drosophila) 1 2
MIRT560099 ERCC8 excision repair cross-complementing rodent repair deficiency, complementation group 8 1 1
MIRT560725 ZNF749 zinc finger protein 749 1 1
MIRT561142 SPAG1 sperm associated antigen 1 1 1
MIRT561721 PPP2R2A protein phosphatase 2, regulatory subunit B, alpha 1 1
MIRT562484 CHORDC1 cysteine and histidine-rich domain (CHORD) containing 1 1 1
MIRT562681 AGO4 eukaryotic translation initiation factor 2C, 4 1 1
MIRT564997 WNK1 WNK lysine deficient protein kinase 1 1 1
MIRT565068 USP25 ubiquitin specific peptidase 25 1 1
MIRT565184 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT565946 RREB1 ras responsive element binding protein 1 1 1
MIRT566315 POU2F1 POU class 2 homeobox 1 1 1
MIRT566435 PHF3 PHD finger protein 3 1 1
MIRT566485 PCCB propionyl CoA carboxylase, beta polypeptide 1 1
MIRT566612 NR3C1 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 1 1
MIRT566761 MOB4 MOB family member 4, phocein 1 1
MIRT566867 LRRC1 leucine rich repeat containing 1 1 1
MIRT567232 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 1
MIRT567245 HSPA13 heat shock protein 70kDa family, member 13 1 1
MIRT567292 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT568426 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT570705 FAM69A family with sequence similarity 69, member A 1 1
MIRT570931 ZNF284 zinc finger protein 284 1 1
MIRT571631 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1 1
MIRT571647 SIX4 SIX homeobox 4 1 1
MIRT574274 ZNF350 zinc finger protein 350 1 1
MIRT574304 CMTM6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT574614 LZIC leucine zipper and CTNNBIP1 domain containing 1 1
MIRT574843 CADM1 cell adhesion molecule 1 1 1
MIRT608128 TSC22D2 TSC22 domain family, member 2 1 1
MIRT648849 WNT7A wingless-type MMTV integration site family, member 7A 1 1
MIRT687559 MLEC malectin 1 1
MIRT696548 HIST1H3B histone cluster 1, H3b 1 1
MIRT697517 ZBTB7A zinc finger and BTB domain containing 7A 1 1
MIRT701146 PANK1 pantothenate kinase 1 1 1
MIRT704284 DENND5B DENN/MADD domain containing 5B 1 1
MIRT704541 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 1 1
MIRT707687 GPR50 G protein-coupled receptor 50 1 1
MIRT707810 TSPAN6 tetraspanin 6 1 1
MIRT710019 KCNQ5 potassium voltage-gated channel, KQT-like subfamily, member 5 1 1
MIRT712705 TEX9 testis expressed 9 1 1
Error report submission
Your e-Mail*