Accession ID: MIRT005531 [miRNA, hsa-miR-29a-3p :: FGA, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29aLinkOut: [miRBase ]
Synonyms MIRN29, MIRN29A, hsa-mir-29, hsa-mir-29a, miRNA29A, MIR29A
Description Homo sapiens miR-29a stem-loop
Comment miR-29a was previously know as miR-29 here and in .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29a-3p
Mature Sequence 42| UAGCACCAUCUGAAAUCGGUUA |63
Evidence Experimental
Experiments Cloned
Putative hsa-miR-29a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms
Description
Transcript    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of
(miRNA target sites are highlighted)
>||3'UTR
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29a-3p :: FGA    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HuH7 , HEK-293T
Location of target site 3'UTR
Original Description (Extracted from the article) ... We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Expression Profile(TCGA):

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
221 hsa-miR-29a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000682 CDK6 cyclin-dependent kinase 6 5 7
MIRT001196 RAN RAN, member RAS oncogene family 3 1
MIRT001766 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT003021 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 4
MIRT003027 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 5 4
MIRT003220 COL4A2 collagen, type IV, alpha 2 4 3
MIRT003221 COL4A1 collagen, type IV, alpha 1 5 5
MIRT003286 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 6 11
MIRT003291 BCL2 B-cell CLL/lymphoma 2 4 2
MIRT003343 CD276 CD276 molecule 3 2
MIRT003607 SFRP2 secreted frizzled-related protein 2 4 1
MIRT003609 DKK1 dickkopf 1 homolog (Xenopus laevis) 4 1
MIRT003735 S100B S100 calcium binding protein B 3 1
MIRT003737 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 1
MIRT004021 GLUL glutamate-ammonia ligase 4 1
MIRT004044 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 5 1
MIRT004103 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 4 2
MIRT004420 TET1 tet methylcytosine dioxygenase 1 5 3
MIRT004564 KREMEN2 kringle containing transmembrane protein 2 4 1
MIRT004630 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) 2 4
MIRT005521 FGG fibrinogen gamma chain 2 1
MIRT005531 FGA fibrinogen alpha chain 2 1
MIRT005532 FGB fibrinogen beta chain 2 1
MIRT005584 LPL lipoprotein lipase 4 1
MIRT005591 CPEB3 cytoplasmic polyadenylation element binding protein 3 3 1
MIRT005592 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 1
MIRT005668 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 4 1
MIRT005675 ITGA11 integrin, alpha 11 4 1
MIRT005906 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT005907 DIABLO diablo, IAP-binding mitochondrial protein 1 1
MIRT005908 RET ret proto-oncogene 1 1
MIRT005909 TRIM63 tripartite motif containing 63, E3 ubiquitin protein ligase 1 1
MIRT005910 TGFB3 transforming growth factor, beta 3 1 1
MIRT006111 SAPCD2 suppressor APC domain containing 2 3 1
MIRT006135 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 3 3
MIRT006175 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 5 5
MIRT006182 SERPINB9 serpin peptidase inhibitor, clade B (ovalbumin), member 9 4 1
MIRT006250 NASP nuclear autoantigenic sperm protein (histone-binding) 2 2
MIRT006379 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006380 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT006485 PPP1R13B protein phosphatase 1, regulatory subunit 13B 2 1
MIRT006490 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 4 3
MIRT006549 NAV3 neuron navigator 3 1 1
MIRT006551 PXDN peroxidasin homolog (Drosophila) 2 1
MIRT006552 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT006553 ITIH5 inter-alpha-trypsin inhibitor heavy chain family, member 5 1 1
MIRT006873 C1QTNF6 C1q and tumor necrosis factor related protein 6 2 2
MIRT007028 PTEN phosphatase and tensin homolog 4 3
MIRT007197 ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 1 1
MIRT028683 COL3A1 collagen, type III, alpha 1 2 2
MIRT035539 HBP1 HMG-box transcription factor 1 1 1
MIRT049964 ZFP91 zinc finger protein 91 homolog (mouse) 1 2
MIRT049965 CYTB cytochrome b 1 1
MIRT049966 CCDC14 coiled-coil domain containing 14 1 1
MIRT049967 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT049968 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT049969 EIF3E eukaryotic translation initiation factor 3, subunit E 1 1
MIRT049970 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT049971 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT049972 FAM133A family with sequence similarity 133, member A 1 1
MIRT049973 BCAP31 B-cell receptor-associated protein 31 1 1
MIRT049974 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT049975 RRAGC Ras-related GTP binding C 1 1
MIRT049976 GAREML family with sequence similarity 59, member B 1 1
MIRT049977 RPS4X ribosomal protein S4, X-linked 1 1
MIRT049978 SUV420H2 suppressor of variegation 4-20 homolog 2 (Drosophila) 1 1
MIRT049979 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT049980 SARS seryl-tRNA synthetase 1 1
MIRT049981 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT049982 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT049983 SP2 Sp2 transcription factor 1 1
MIRT049984 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT049985 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT049986 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT049987 FAM109B family with sequence similarity 109, member B 1 1
MIRT049988 PAN2 PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1
MIRT052916 KLF4 Kruppel-like factor 4 (gut) 3 2
MIRT052997 CCNT2 cyclin T2 3 4
MIRT053017 TRIM68 tripartite motif containing 68 3 1
MIRT053125 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 3 1
MIRT053292 TDG thymine-DNA glycosylase 5 4
MIRT053579 CCND2 cyclin D2 4 3
MIRT053580 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) 3 3
MIRT053585 VEGFA vascular endothelial growth factor A 4 4
MIRT053765 VDAC1 voltage-dependent anion channel 1 3 1
MIRT054191 AKT2 v-akt murine thymoma viral oncogene homolog 2 3 2
MIRT054309 CDK2 cyclin-dependent kinase 2 2 2
MIRT054573 PER1 period homolog 1 (Drosophila) 3 1
MIRT054878 FOXO3 forkhead box O3 3 1
MIRT061661 BTG2 BTG family, member 2 1 2
MIRT067384 TMTC3 transmembrane and tetratricopeptide repeat containing 3 1 2
MIRT079940 RNF138 ring finger protein 138, E3 ubiquitin protein ligase 1 1
MIRT080797 SH3GLB1 SH3-domain GRB2-like endophilin B1 1 2
MIRT081892 KCTD15 potassium channel tetramerisation domain containing 15 1 4
MIRT082514 CALM3 calmodulin 3 (phosphorylase kinase, delta) 1 1
MIRT102855 INSIG1 insulin induced gene 1 1 1
MIRT194613 NFIA nuclear factor I/A 1 1
MIRT197044 NKIRAS2 NFKB inhibitor interacting Ras-like 2 1 1
MIRT207248 TET3 tet methylcytosine dioxygenase 3 5 2
MIRT207754 VHL von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase 1 2
MIRT210968 TET2 tet methylcytosine dioxygenase 2 4 1
MIRT211649 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1 1
MIRT213229 REST RE1-silencing transcription factor 1 5
MIRT225102 GOLGA7 golgin A7 1 1
MIRT250480 MAZ MYC-associated zinc finger protein (purine-binding transcription factor) 1 1
MIRT264264 FAM102B family with sequence similarity 102, member B 1 1
MIRT303362 MXD1 MAX dimerization protein 1 2 1
MIRT316341 ULBP2 UL16 binding protein 2 1 1
MIRT401475 AIM1 absent in melanoma 1 2 1
MIRT437368 LAMC2 laminin, gamma 2 3 1
MIRT437373 ITGA6 integrin, alpha 6 3 1
MIRT437410 DNMT1 DNA (cytosine-5-)-methyltransferase 1 3 1
MIRT437545 COL5A2 collagen, type V, alpha 2 1 1
MIRT437546 COL10A1 collagen, type X, alpha 1 1 1
MIRT437547 FBN1 fibrillin 1 1 1
MIRT437548 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 3 2
MIRT437550 LOX lysyl oxidase 1 1
MIRT437551 PDGFRB platelet-derived growth factor receptor, beta polypeptide 1 1
MIRT437709 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437712 TUBB2A tubulin, beta 2A class IIa 2 1
MIRT437715 EMP1 epithelial membrane protein 1 2 1
MIRT437718 SNX24 sorting nexin 24 2 1
MIRT437721 AMFR autocrine motility factor receptor, E3 ubiquitin protein ligase 2 1
MIRT437724 RIOK3 RIO kinase 3 (yeast) 2 1
MIRT437727 WDR26 WD repeat domain 26 3 2
MIRT437730 DSC2 desmocollin 2 2 1
MIRT438098 CDC7 cell division cycle 7 homolog (S. cerevisiae) 1 1
MIRT438257 TRAF4 TNF receptor-associated factor 4 1 1
MIRT438265 CALCR calcitonin receptor 1 1
MIRT438266 CD93 CD93 molecule 1 1
MIRT438267 GPR85 G protein-coupled receptor 85 1 1
MIRT438268 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 1 1
MIRT438274 CEACAM6 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) 2 1
MIRT438346 CCND1 cyclin D1 2 1
MIRT438347 CDK4 cyclin-dependent kinase 4 2 1
MIRT438434 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 3 1
MIRT438679 IGF1 insulin-like growth factor 1 (somatomedin C) 3 1
MIRT454813 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 1 1
MIRT456828 MORF4L2 mortality factor 4 like 2 1 4
MIRT462152 RPL22 ribosomal protein L22 1 1
MIRT465313 TRAM2 translocation associated membrane protein 2 1 1
MIRT467809 SLC2A14 solute carrier family 2 (facilitated glucose transporter), member 14 1 1
MIRT467830 SLC29A2 solute carrier family 29 (nucleoside transporters), member 2 1 1
MIRT467969 SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) 1 2
MIRT468226 SGK1 serum/glucocorticoid regulated kinase 1 1 1
MIRT469449 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) 1 1
MIRT469724 RAB40C RAB40C, member RAS oncogene family 1 1
MIRT469842 R3HDM4 R3H domain containing 4 1 1
MIRT472645 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae) 1 1
MIRT474207 LEPRE1 leucine proline-enriched proteoglycan (leprecan) 1 1 1
MIRT474575 KLHDC3 kelch domain containing 3 1 1
MIRT475838 HDGF hepatoma-derived growth factor 1 2
MIRT476722 FRK fyn-related kinase 1 2
MIRT476773 FOS FBJ murine osteosarcoma viral oncogene homolog 1 1
MIRT477472 ELMSAN1 ELM2 and Myb/SANT-like domain containing 1 1 1
MIRT477925 DUSP2 dual specificity phosphatase 2 1 1
MIRT478669 CTC1 CTS telomere maintenance complex component 1 1 7
MIRT478711 CSRNP2 cysteine-serine-rich nuclear protein 2 1 1
MIRT478984 COMMD2 COMM domain containing 2 1 1
MIRT479825 CCNA2 cyclin A2 1 4
MIRT479900 CCDC117 coiled-coil domain containing 117 1 1
MIRT480067 CAND1 cullin-associated and neddylation-dissociated 1 1 1
MIRT480982 BBC3 BCL2 binding component 3 1 1
MIRT482013 AMER1 family with sequence similarity 123B 1 4
MIRT492514 RAET1L retinoic acid early transcript 1L 1 1
MIRT493826 FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) 1 1
MIRT495937 SLC7A5P2 solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2 1 1
MIRT496359 PPY pancreatic polypeptide 1 1
MIRT496663 TMEM237 transmembrane protein 237 1 1
MIRT497645 GLDN gliomedin 1 1
MIRT501877 MORF4L1 mortality factor 4 like 1 1 4
MIRT502933 CDC42SE1 CDC42 small effector 1 1 2
MIRT506748 LDOC1L leucine zipper, down-regulated in cancer 1-like 1 3
MIRT507169 GAS2L3 growth arrest-specific 2 like 3 1 1
MIRT514919 MDM2 Mdm2, p53 E3 ubiquitin protein ligase homolog (mouse) 1 3
MIRT523963 DYNLT1 dynein, light chain, Tctex-type 1 1 2
MIRT527676 CASP8 caspase 8, apoptosis-related cysteine peptidase 1 1
MIRT536935 HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT537360 FJX1 four jointed box 1 (Drosophila) 1 1
MIRT537688 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 1 1
MIRT538123 DDX6 DEAD (Asp-Glu-Ala-Asp) box helicase 6 1 1
MIRT538814 C21orf91 chromosome 21 open reading frame 91 1 1
MIRT546936 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT547103 PLAG1 pleiomorphic adenoma gene 1 1 1
MIRT547822 ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 1 1
MIRT548238 FEM1B fem-1 homolog b (C. elegans) 1 1
MIRT550037 WWTR1 WW domain containing transcription regulator 1 1 1
MIRT552620 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT556561 LIMS1 LIM and senescent cell antigen-like domains 1 1 1
MIRT558858 CDC23 cell division cycle 23 homolog (S. cerevisiae) 1 1
MIRT565486 SPRTN SprT-like N-terminal domain 1 1
MIRT568204 CBX6 chromobox homolog 6 1 1
MIRT576775 Tmem127 transmembrane protein 127 1 1
MIRT576959 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT610004 PIGS phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT616512 COX7A2L cytochrome c oxidase subunit VIIa polypeptide 2 like 1 1
MIRT640888 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT641351 RAB11FIP1 RAB11 family interacting protein 1 (class I) 1 1
MIRT642979 TESPA1 thymocyte expressed, positive selection associated 1 1 1
MIRT643635 YY2 YY2 transcription factor 1 1
MIRT644387 ZNF286A zinc finger protein 286A 1 1
MIRT650750 YAE1D1 Yae1 domain containing 1 1 1
MIRT661586 EPHX2 epoxide hydrolase 2, cytoplasmic 1 1
MIRT664288 RNMTL1 RNA methyltransferase like 1 1 1
MIRT689394 ZNF850 zinc finger protein 850 1 1
MIRT693816 SEC31A SEC31 homolog A (S. cerevisiae) 1 1
MIRT694533 TRIM72 tripartite motif containing 72 1 1
MIRT694629 ZFPM1 zinc finger protein, multitype 1 1 1
MIRT695136 PRY2 PTPN13-like, Y-linked 2 1 1
MIRT695153 PRY PTPN13-like, Y-linked 1 1
MIRT703642 FBRS fibrosin 1 1
MIRT704435 CTNNBIP1 catenin, beta interacting protein 1 1 1
MIRT704552 CNBP CCHC-type zinc finger, nucleic acid binding protein 1 1
MIRT704968 CBX2 chromobox homolog 2 1 1
MIRT705498 ASXL2 additional sex combs like 2 (Drosophila) 1 1
MIRT707995 OTUD4 OTU domain containing 4 1 1
MIRT708742 FAM71F2 family with sequence similarity 71, member F2 1 1
MIRT710622 COLEC10 collectin sub-family member 10 (C-type lectin) 1 1
MIRT713057 IFRD1 interferon-related developmental regulator 1 1 1
MIRT715513 MAPKBP1 mitogen-activated protein kinase binding protein 1 1 1
MIRT720771 FAM193A family with sequence similarity 193, member A 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*