Accession ID: MIRT005532 [miRNA, hsa-miR-29a-3p :: FGB, target gene]
pre-miRNA Information
pre-miRNA ID hsa-mir-29aLinkOut: [miRBase ]
Synonyms MIRN29, MIRN29A, hsa-mir-29, hsa-mir-29a, miRNA29A, MIR29A
Description Homo sapiens miR-29a stem-loop
Comment miR-29a was previously know as miR-29 here and in .
2nd Structure of pre-miRNA
Disease
Mature miRNA Information
Mature miRNA hsa-miR-29a-3p
Mature Sequence 42| UAGCACCAUCUGAAAUCGGUUA |63
Evidence Experimental
Experiments Northern
Putative hsa-miR-29a-3p Targets LinkOut: [ TargetScanS 5.1 | MicroCosm | microRNA.org | miRecords | miRDB | miRo | miRNAMap 2.0 ]
Gene Information
Gene Symbol FGB LinkOut: [ Entrez Gene | BioGPS | Wikipedia | iHop ]
Synonyms MGC104327, MGC120405
Description fibrinogen beta chain
Transcript NM_0051    LinkOut: [ RefSeq ]
Expression LinkOut: [ BioGPS ]
Putative miRNA Targets on FGB LinkOut: [ TargetScan 5.1 | MicroCosm | miRNAMap 2.0 ]
3'UTR of FGB
(miRNA target sites are highlighted)
>FGB|NM_0051|3'UTR
   1 TAGTCCCCAATACGTAGATTTTTGCTCTTCTGTATGTGACAACATTTTTGTACATTATGTTATTGGAATTTTCTTTCATA
  81 CATTATATTCCTCTAAAACTCTCAAGCAGACGTGAGTGTGACTTTTTGAAAAAAGTATAGGATAAATTACATTAAAATAG
 161 CACATGATTTTCTTTTGTTTTCTTCATTTCTCTTGCTCACCAAGAAGTAACAAAAGTATAGTTTTGACAGAGTTGGTGTT
 241 CATAATTTCAGTTCTAGTTGATTGCGAGAATTTTCAAATAAGGAAGAGGGGTCTTTTATCCTTGTCGTAGGAAAACCATG
 321 ACGGAAAGGAAAAACTGATGTTTAAAAGTCCACTTTTAAAACTATATTTATTTATGTAGGATCTGTCAAAGAAAACTTCC
 401 AAAAAGATTTATTAATTAAACCAGACTCTGTTGCAATAAAAAAAAAAAAAA
Target sites Provided by authors  Predicted by miRanda
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target hsa-miR-29a-3p :: FGB    [ Functional MTI ]
Validation Method Luciferase reporter assay , Other
Conditions HuH7 , HEK-293T
Location of target site 3'UTR
Original Description (Extracted from the article) ... We observed significant 24%, 30% and 30% decreases in fibrinogen production when HuH7 cells were transfected with 30 nM of hsa-miR-29c, hsa-miR-29a and hsa-miR- 29b respectively, compared to cells transfected with a negative control precursor molecule (Figure 2A). A similar effect was also observed at lower concentrations (3.3 nM and 10 nM). These results confirm that transfection of hsa-miR-29 family members can reduce fibrinogen production.//Compared to the control condition transfected with hsa-miR-144, a decrease of all five fibrinogen transcripts was observed when HuH7 cells were transfected with hsa-miR-29a, hsa-miR-29b or hsa-miR-29c (Figure 2B). The FGB mRNA level is on average reduced by 56% compared to the non-transfected control, while FGA and FGG transcript levels show reductions of 51% and 42% respectively. ...

- Fort, A. Borel, C. Migliavacca, E. et al., 2010, Blood.

Article - Fort, A. Borel, C. Migliavacca, E. et al.
- Blood, 2010
Elevated levels of fibrinogen are associated with increased risk of cardiovascular disease, whereas low fibrinogen can lead to a bleeding disorder. We investigated whether microRNAs (miRNAs), known to act as post-transcriptional regulators of gene expression, regulate fibrinogen production. Using transfection of a library of 470 annotated human miRNA precursor molecules in HuH7 hepatoma cells, and quantitative measurements of fibrinogen production, we identified 23 miRNAs with down-regulating (up to 64% decrease) and 4 with up-regulating effects (up to 129% increase) on fibrinogen production. Among the downregulating miRNAs, we investigated the mechanism of action of three hsa-miR-29 family members and hsa-miR-409-3p. Overexpression of hsa-miR-29 members lead to decreased steady-state levels of all fibrinogen gene (FGA, FGB, FGG) transcripts in HuH7 cells. Luciferase reporter gene assays demonstrated that this was independent of miRNA-fibrinogen 3'UTR interactions. In contrast, overexpression of hsa-miR-409-3p specifically lowered fibrinogen Bbeta (FGB) mRNA levels and this effect was dependent on a target site in the FGB mRNA 3'UTR. This study adds to the known mechanisms that control fibrinogen production, points towards a potential cause of variable circulating fibrinogen levels, and demonstrates that a screening approach can identify miRNAs that regulate clinically important proteins.
LinkOut: [PMID: 20570858]
MiRNA-Target Expression Profile:

 
MiRNA-Target Interaction Network:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
76 hsa-miR-29a-3p Target Genes:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000682 CDK6 cyclin-dependent kinase 6 4 2
MIRT001196 RAN RAN, member RAS oncogene family 3 1
MIRT001766 BACE1 beta-site APP-cleaving enzyme 1 3 1
MIRT003021 DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha 5 4
MIRT003027 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta 4 3
MIRT003220 COL4A2 collagen, type IV, alpha 2 4 2
MIRT003221 COL4A1 collagen, type IV, alpha 1 4 1
MIRT003286 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 5 5
MIRT003291 BCL2 B-cell CLL/lymphoma 2 4 1
MIRT003343 CD276 CD276 molecule 3 2
MIRT003607 SFRP2 secreted frizzled-related protein 2 4 1
MIRT003609 DKK1 dickkopf homolog 1 (Xenopus laevis) 4 1
MIRT003735 S100B S100 calcium binding protein B 3 1
MIRT003737 IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 2 1
MIRT004021 GLUL glutamate-ammonia ligase 4 1
MIRT004044 PPM1D protein phosphatase, Mg2+/Mn2+ dependent, 1D 5 1
MIRT004103 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) 4 2
MIRT004420 TET1 tet oncogene 1 2 1
MIRT004564 KREMEN2 kringle containing transmembrane protein 2 4 1
MIRT004630 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) 1 2
MIRT005521 FGG fibrinogen gamma chain 2 1
MIRT005531 FGA fibrinogen alpha chain 2 1
MIRT005532 FGB fibrinogen beta chain 2 1
MIRT005584 LPL lipoprotein lipase 4 1
MIRT005591 CPEB3 cytoplasmic polyadenylation element binding protein 3 3 1
MIRT005592 CPEB4 cytoplasmic polyadenylation element binding protein 4 3 1
MIRT005668 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 4 1
MIRT005675 ITGA11 integrin, alpha 11 4 1
MIRT005906 DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1) 1 1
MIRT005907 DIABLO diablo homolog (Drosophila) 1 1
MIRT005908 RET ret proto-oncogene 1 1
MIRT005909 TRIM63 tripartite motif-containing 63 1 1
MIRT005910 TGFB3 transforming growth factor, beta 3 1 1
MIRT006111 SAPCD2 chromosome 9 open reading frame 140 3 1
MIRT006135 MYCN v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) 2 2
MIRT006175 SPARC secreted protein, acidic, cysteine-rich (osteonectin) 5 3
MIRT006182 SERPINB9 serpin peptidase inhibitor, clade B (ovalbumin), member 9 4 1
MIRT006250 NASP nuclear autoantigenic sperm protein (histone-binding) 2 2
MIRT006379 DICER1 dicer 1, ribonuclease type III 1 1
MIRT006380 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 1 1
MIRT006485 PPP1R13B protein phosphatase 1, regulatory (inhibitor) subunit 13B 2 1
MIRT006490 CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 3 1
MIRT006549 NAV3 neuron navigator 3 1 1
MIRT006551 PXDN peroxidasin homolog (Drosophila) 2 1
MIRT006552 BCL7A B-cell CLL/lymphoma 7A 1 1
MIRT006553 ITIH5 inter-alpha (globulin) inhibitor H5 1 1
MIRT006873 C1QTNF6 C1q and tumor necrosis factor related protein 6 1 1
MIRT007028 PTEN phosphatase and tensin homolog 1 2
MIRT007197 ABL1 c-abl oncogene 1, receptor tyrosine kinase 1 1
MIRT028683 COL3A1 collagen, type III, alpha 1 1 1
MIRT035539 HBP1 HMG-box transcription factor 1 1 1
MIRT049964 ZFP91 zinc finger protein 91 homolog (mouse) 1 1
MIRT049965 CYTB cytochrome b 1 1
MIRT049966 CCDC14 coiled-coil domain containing 14 1 1
MIRT049967 AGO1 eukaryotic translation initiation factor 2C, 1 1 1
MIRT049968 WBSCR16 Williams-Beuren syndrome chromosome region 16 1 1
MIRT049969 EIF3E eukaryotic translation initiation factor 3, subunit E 1 1
MIRT049970 POLD3 polymerase (DNA-directed), delta 3, accessory subunit 1 1
MIRT049971 RPS6KA3 ribosomal protein S6 kinase, 90kDa, polypeptide 3 1 1
MIRT049972 FAM133A family with sequence similarity 133, member A 1 1
MIRT049973 BCAP31 B-cell receptor-associated protein 31 1 1
MIRT049974 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT049975 RRAGC Ras-related GTP binding C 1 1
MIRT049976 GAREML family with sequence similarity 59, member B 1 1
MIRT049977 RPS4X ribosomal protein S4, X-linked 1 1
MIRT049978 SUV420H2 suppressor of variegation 4-20 homolog 2 (Drosophila) 1 1
MIRT049979 CCT4 chaperonin containing TCP1, subunit 4 (delta) 1 1
MIRT049980 SARS seryl-tRNA synthetase 1 1
MIRT049981 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT049982 CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1 1
MIRT049983 SP2 Sp2 transcription factor 1 1
MIRT049984 HUWE1 HECT, UBA and WWE domain containing 1 1 1
MIRT049985 SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT049986 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT049987 FAM109B family with sequence similarity 109, member B 1 1
MIRT049988 PAN2 PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 1 1